Mapping of Leaf Rust Resistance Loci in Two Kenyan Wheats and Development of Linked Markers
Abstract
:1. Introduction
2. Materials and Methods
3. Results
3.1. Phenotypic Assessment of Parental Lines and RILs
3.2. Mapping of Resistance
3.3. Development and Validation of KASP Markers
3.4. Assessment of Interaction among Detected APR Loci
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- FAOSTAT Statistics Database: Food Balance Sheets. Available online: http://www.fao.org/faostat/en/#data/FBS (accessed on 25 April 2022).
- Chai, Y.; Senay, S.; Horvath, D.; Pardey, P. Multi-peril pathogen risks to global wheat production: A probabilistic loss and investment assessment. Front. Plant Sci. 2022, 13, 1034600. [Google Scholar] [CrossRef] [PubMed]
- Herrera-Foessel, S.A.; Singh, R.P.; Huerta-Espino, J.; Crossa, J.; Jin, Y.; Djurle, A. Effect of leaf rust on grain yield and yield traits of durum wheats with race-specific and slow rusting resistance to leaf rust. Plant Dis. 2006, 90, 1065–1072. [Google Scholar] [CrossRef] [PubMed]
- Singh, D.; Simmonds, J.; Park, R.F.; Bariana, H.; Snape, J. Inheritance and QTL mapping of leaf rust resistance in the European winter wheat cultivar ‘Beaver’. Euphytica 2009, 169, 253–261. [Google Scholar] [CrossRef]
- Singh, D.; Park, R.F.; Bariana, H.S.; McIntosh, R.A. Cytogenetic studies in wheat XIX: Chromosome location and linkage studies of a gene for leaf rust resistance in the Australian cultivar Harrier. Plant Breed. 2001, 120, 7–12. [Google Scholar] [CrossRef]
- Cavanagh, C.R.; Chao, S.; Wang, S.; Huang, B.E.; Stephen, S.; Kiani, S.; Forrest, K.; Saintenac, C.; Brown-Guedira, G.L.; Akhunova, A.; et al. Genome-wide comparative diversity uncovers multiple targets of selection for improvement in hexaploid wheat landraces and cultivars. Proc. Natl. Acad. Sci. USA 2013, 14, 8057–8062. [Google Scholar] [CrossRef] [PubMed]
- Somers, D.J.; Isaac, P.; Edwards, K. A high-density microsatellite consensus map for bread wheat (Triticum aestivum L.). Theor. Appl. Genet. 2004, 109, 1105–1114. [Google Scholar] [CrossRef] [PubMed]
- International Wheat Genome Sequencing Consortium (IWGSC). Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science 2018, 17, 361. [Google Scholar] [CrossRef] [PubMed]
- Zhu, T.; Wang, L.; Rimbert, H.; Rodriguez, J.C.; Deal, K.R.; De Oliveira, R.; Choulet, F.; Keeble-Gagnère, G.; Tibbits, J.; Rogers, J.; et al. Optical maps refine the bread wheat Triticum aestivum cv. Chinese Spring genome assembly. Plant J. 2021, 107, 303–314. [Google Scholar] [CrossRef] [PubMed]
- Kwankwaso, P.; Park, R.F.; Singh, D. African wheat germplasm—A valuable resource for resistance to rust diseases. Plant Pathol. 2019, 68, 1308–1319. [Google Scholar] [CrossRef]
- Park, R. Breeding cereals for rust resistance in Australia. Plant Pathol. 2008, 57, 591–602. [Google Scholar] [CrossRef]
- McIntosh, R.; Wellings, C.R.; Park, R.F. Wheat Rusts: An Atlas of Resistance Genes; CSIRO Publishing: Melbourne, VIC, Australia, 1995. [Google Scholar] [CrossRef]
- Stakman, E.C.; Stewart, D.M.; Loegering, W.Q. Identification of Physiologic Races of Puccinia graminis var. tritici; USDA ARS; United States Government Printing Office: Washington, DC, USA, 1962; p. E-617. [Google Scholar]
- Sandhu, K.; Singh, D.; Park, R.F. A pictorial disease assessment scale for assessing wheat stripe rust at adult plant growth stage. Aust. Plant Pathol. 2021, 51, 27–29. [Google Scholar] [CrossRef]
- Bansal, U.K.; Kazi, A.G.; Singh, B.; Hare, R.; Bariana, H.S. Mapping of durable stripe rust resistance in a durum wheat cultivar Wollaroi. Mol. Breed. 2014, 33, 51. [Google Scholar] [CrossRef]
- Lagudah, E.S.; McFadden, H.; Singh, R.P.; Huerta-Espino, J.; Bariana, H.S.; Spielmeyer, W. Molecular genetic characterisation of the Lr34/Yr18 slow rusting resistance gene region in wheat. Theor. Appl. Genet. 2006, 114, 21–30. [Google Scholar] [CrossRef] [PubMed]
- Ren, Y.; Singh, R.P.; Basnet, B.R.; Lan, C.X.; Huerta-Espino, J.; Lagudah, E.S.; Ponce-Molina, L.J. Identification and mapping of adult plant resistance loci to leaf rust and stripe rust in common wheat cultivar Kundan. Plant Dis. 2017, 101, 456–463. [Google Scholar] [CrossRef] [PubMed]
- Moore, J.W.; Herrera-Foessel, S.; Lan, C.; Schnippenkoetter, W.; Ayliffe, M.; Huerta-Espino, J.; Lillemo, M.; Viccars, L.; Milne, R.; Periyannan, S.; et al. A recently evolved hexose transporter variant confers resistance to multiple pathogens in wheat. Nat. Genet. 2015, 47, 1494–1498. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Basten, C.J.; Zeng, Z.B. Windows QTL Cartographer 2.5; Department of Statistics, North Carolina State University: Raleigh, NC, USA, 2012. [Google Scholar]
- Voorrips, R.E. MapChart: Software for the graphical presentation of linkage maps and QTL. J. Heredit. 2002, 93, 77–78. [Google Scholar] [CrossRef] [PubMed]
- Nsabiyera, V.; Qureshi, N.; Bariana, H.S.; Wong, D.; Forrest, K.; Hayden, M.; Bansal, U. Molecular markers for adult plant leaf rust resistance gene Lr48 in wheat. Mol. Breed. 2016, 36, 65. [Google Scholar] [CrossRef]
- Bariana, H.S.; Babu, P.; Forrest, K.L.; Park, R.F.; Bansal, U.K. Discovery of the new leaf rust resistance gene Lr82 in wheat: Molecular Mapping and Marker Development. Genes 2022, 13, 964. [Google Scholar] [CrossRef] [PubMed]
- Kumar, K.; Jan, I.; Saripalli, G.; Sharma, P.K.; Mir, R.R.; Balyan, H.S.; Gupta, P.K. An update on resistance genes and their use in development of leaf rust resistant cultivars in wheat. Front. Genet. 2022, 13, 816057. [Google Scholar] [CrossRef]
- Ren, X.; Wang, C.; Ren, Z.; Wang, J.; Zhang, P.; Zhao, S.; Li, M.; Yuan, M.; Yu, X.; Li, Z.; et al. Genetics of Resistance to Leaf Rust in Wheat: An Overview in a Genome-Wide Level. Sustainability 2023, 15, 3247. [Google Scholar] [CrossRef]
- Kthiri, D.; Loladze, A.; N’Diaye, A.; Nilsen, K.T.; Walkowiak, S.; Dreisigacker, S.; Ammar, K.; Pozniak, C.J. Mapping of genetic loci conferring resistance to leaf rust from three globally resistant durum wheat sources. Front. Plant Sci. 2019, 10, 1247. [Google Scholar] [CrossRef] [PubMed]
- Rosewarne, G.; Singh, R.; Huerta-Espino, J.; Rebetzke, G. Quantitative trait loci for slow-rusting resistance in wheat to leaf rust and stripe rust identified with multi-environment analysis. Theor. Appl. Genet. 2008, 116, 1027–1034. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Ren, Y.; Lillemo, M.; Yao, Z.; Zhang, P.; Xia, X.; He, Z.; Li, Z.; Liu, D. QTL mapping of adult-plant resistance to leaf rust in a RIL population derived from a cross of wheat cultivars Shanghai 3/Catbird and Naxos. Theor. Appl. Genet. 2014, 127, 1873–1883. [Google Scholar] [CrossRef] [PubMed]
- Buerstmayr, M.; Matiasch, L.; Mascher, F.; Vida, G.; Ittu, M.; Robert, O.; Holdgate, S.; Flath, K.; Neumayer, A.; Buerstmayr, H. Mapping of quantitative adult plant field resistance to leaf rust and stripe rust in two European winter wheat populations reveals co-location of three QTL conferring resistance to both rust pathogens. Theor. Appl. Genet. 2014, 127, 2011–2028. [Google Scholar] [CrossRef] [PubMed]
- Iqbal, M.; Semagn, K.; Jarquin, D.; Randhawa, H.; McCallum, B.D.; Howard, R.; Aboukhaddour, R.; Ciechanowska, I.; Strenzke, K.; Crossa, J. Identification of Disease Resistance Parents and Genome-Wide Association Mapping of Resistance in Spring Wheat. Plants 2022, 11, 2905. [Google Scholar] [CrossRef] [PubMed]
- Leonova, I.N.; Skolotneva, E.S.; Salina, E.A. Genome-wide association study of leaf rust resistance in Russian spring wheat varieties. BMC Plant Biol. 2020, 20, 135. [Google Scholar] [CrossRef] [PubMed]
- Pasam, R.K.; Bansal, U.; Daetwyler, H.D.; Forrest, K.L.; Wong, D.; Petkowski, J.; Willey, N.; Randhawa, M.; Chhetri, M.; Miah, H. Detection and validation of genomic regions associated with resistance to rust diseases in a worldwide hexaploid wheat landrace collection using BayesR and mixed linear model approaches. Theor. Appl. Genet. 2017, 130, 777–793. [Google Scholar] [CrossRef] [PubMed]
- Sapkota, S.; Hao, Y.; Johnson, J.; Buck, J.; Aoun, M.; Mergoum, M. Genome-wide association study of a worldwide collection of wheat genotypes reveals novel quantitative trait loci for leaf rust resistance. Plant Genome 2019, 12, 190033. [Google Scholar] [CrossRef] [PubMed]
- Rosa, S.B.; McCallum, B.; Brûlé-Babel, A.; Hiebert, C.; Shorter, S.; Randhawa, H.S.; Barcellos, A.L. Inheritance of leaf rust and stripe rust resistance in the Brazilian wheat cultivar ‘Toropi’. Plant Dis. 2016, 100, 1132–1137. [Google Scholar] [CrossRef]
- Herrera-Foessel, S.A.; Singh, R.P.; Huerta-Espino, J.; Rosewarne, G.M.; Periyannan, S.K.; Viccars, L.; Calvo-Salazar, V.; Lan, C.; Lagudah, E.S. Lr68: A new gene conferring slow rusting resistance to leaf rust in wheat. Theor. Appl. Genet. 2012, 124, 1475–1486. [Google Scholar] [CrossRef]
- Zhang, P.; Li, X.; Gebrewahid, T.; Liu, H.; Xia, X.; He, Z.; Li, Z.; Liu, D. QTL mapping of adult plant resistance to leaf and stripe rust in wheat cross SW8588/Thatcher using the wheat 55K SNP array. Plant Dis. 2019, 103, 3041–3049. [Google Scholar] [CrossRef] [PubMed]
- Bokore, F.E.; Knox, R.E.; Hiebert, C.W.; Cuthbert, R.D.; DePauw, R.M.; Meyer, B.; N’Diaye, A.; Pozniak, C.J.; McCallum, B.D. A combination of leaf rust resistance genes; including Lr34 and Lr46; is the key to the durable resistance of the Canadian wheat cultivar Carberry. Front. Plant Sci. 2022, 12, 775383. [Google Scholar] [CrossRef] [PubMed]
Genotype | Infection Type Response | Disease Response | |||
---|---|---|---|---|---|
Greenhouse | Field | ||||
Pt. 1 * | Pt. 2 | Pt. 3 | Pt. 4 | Pts. 1 + 2 + 3 + 4 | |
AUS12568 | 3+ | 3+ | 3+ | 3+ | 5–10 RMR |
Kenya Kudu | 3+ | 33 + C | 3+ | 3+ | 10 MR |
AWDH161 | 3+ | 3+ | 3+ | 3+ | 90–100 S |
RIL Population | Field Disease Response Category | Segregation | Genetic Ratio | χ2 | p | ||
---|---|---|---|---|---|---|---|
RMR | MS | SVS | R:S a | (R:S) | |||
A12568/AWDH161 | 38 | 45 | 25 | 83:25 | 3:1 | 0.492 | 0.483 |
Kenya Kudu/AWDH161 | 41 | 43 | 22 | 84:22 | 3:1 | 1.019 | 0.310 |
Population | QTL/Chr | Left Marker | Right Marker | LOD | PVE (%) | Contributing Parent | Position in CS Physical Map (bp) | |
---|---|---|---|---|---|---|---|---|
Left Marker | Right Marker | |||||||
AUS12568/AWDH161 | QLrKK_1B | scaffold95194|TaGBSv2-6835_494429 | scaffold95194|TaGBSv2-734_2005054 | 5.6 | 19.9 | AUS12568 | 668,762,861 | 670,273,486 |
QLrKK_5A | scaffold63793-1|TaGBSv2-9834_151799 | scaffold31523|TaGBSv2-9879_1647822 | 5.5 | 15.2 | AUS12568 | 560,600,410 | 594,143,849 | |
QLrKK_7B | scaffold42040-2|TaGBSv2-5623_4726145 | scaffold67584|TaGBSv2-5649_9487071 | 3.7 | 17.3 | AUS12568 | 29,588,094 | 46,347,338 | |
Kenya Kudu/AWDH161 | QLrKK_1B | scaffold48390|TaGBSv2-6823_159757 | scaffold95194|TaGBSv2-6835_494429 | 9.1 | 41.9 | Kenya Kudu | 661,632,366 | 668,762,861 |
QLrKK_2B | scaffold94773|TaGBSv2-3185_1310796 | scaffold44840|TaGBSv2-7721_219820 | 3.9 | 18.9 | Kenya Kudu | 697,784,429 | 707,968,413 |
LrQTL | Marker Name | Allele 1 | Allele 2 | Common |
---|---|---|---|---|
QLrKK_2B | sunKASP_536 | ttgcaccattcttatatctggaatT | ttgcaccattcttatatctggaatC | actgtcagCtcattgccttca |
QLrAus12568_5A | sunKASP_522 | gttggatgagagctacacacC | gttggatgagagctacacacT | catcgccAgtccagatggag |
QLrAus12568_5A | sunKASP_524 | tgatcagtgtggcatgacaG | tgatcagtgtggcatgacaA | aacttccatgaagctgctagt |
Population | Locus | No of Lines | Average DS * |
---|---|---|---|
Kenya Kudu/AWDH161 | LrKK_2B | 21 | 4.18 AB |
Lr46 | 20 | 5.4 A | |
LrKK_2B + Lr46 | 36 | 3.73 B | |
None | 17 | 7.44 C | |
lsd | 1.23 | ||
AUS12568/AWDH161 | LrAus12568_5A | 21 | 4.54 A |
Lr46 | 27 | 5.16 A | |
LrAus12568_5A + Lr46 | 20 | 3 B | |
None | 38 | 6.62 C | |
lsd | 1.31 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Singh, D.; Kankwatsa, P.; Sandhu, K.S.; Bansal, U.K.; Forrest, K.L.; Park, R.F. Mapping of Leaf Rust Resistance Loci in Two Kenyan Wheats and Development of Linked Markers. Genes 2024, 15, 583. https://doi.org/10.3390/genes15050583
Singh D, Kankwatsa P, Sandhu KS, Bansal UK, Forrest KL, Park RF. Mapping of Leaf Rust Resistance Loci in Two Kenyan Wheats and Development of Linked Markers. Genes. 2024; 15(5):583. https://doi.org/10.3390/genes15050583
Chicago/Turabian StyleSingh, Davinder, Peace Kankwatsa, Karanjeet S. Sandhu, Urmil K. Bansal, Kerrie L. Forrest, and Robert F. Park. 2024. "Mapping of Leaf Rust Resistance Loci in Two Kenyan Wheats and Development of Linked Markers" Genes 15, no. 5: 583. https://doi.org/10.3390/genes15050583