Genetic Analysis of the ts-Lethal Mutant Δpa0665/pTS-pa0665 Reveals Its Role in Cell Morphology and Oxidative Phosphorylation in Pseudomonas aeruginosa
Abstract
:1. Introduction
2. Materials and Methods
2.1. DNA, Plasmids, and Bacterial Cultures
2.2. Plasmid Construction
2.3. Plasmid-Based ts-Mutant Strain Construction
2.4. Spot-Plating Assay
2.5. Fluorescence Microscopic Analysis
2.6. Fluorescence Activated Cell Sorting (FACS) Analysis
2.7. ATP Content Measurement
2.8. RNA Extraction and RNA-Seq Analysis
2.9. Statistics
2.10. Data Availability
3. Results
3.1. pa0665 Gene Is Essential for Growth on LB-Agar Plate
3.2. Putative Ortholog erpA in E. coli Functionally Complements the Defect of pa0665 in P. aeruginosa
3.3. The Δpa0665/pTS-pa0665 Mutant Exhibits Petite Cell Morphology under Restrictive Temperature
3.4. ATP Content Was Decreased in Δpa0665/pTS-pa0665 Mutant under Restrictive Temperature
3.5. The Δpa0665/pTS-pa0665 Mutant Is Hypersensitive to Oxidative Stress Mediated by H2O2
3.6. Transcriptomic Analysis Reveals Impaired Oxidative Phosphorylation in pa0665-Deficient P. aeruginosa
3.7. Impairment of pa4067/oprG Possibly Linked to the Altered Morphology of Δpa0665/pTS-pa0665 Mutant at 42 °C
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Vasil, M.L. Pseudomonas aeruginosa: Biology, mechanisms of virulence, epidemiology. J. Pediatr. 1986, 108, 800–805. [Google Scholar] [CrossRef] [PubMed]
- Tacconelli, E.; Carrara, E.; Savoldi, A.; Harbarth, S.; Mendelson, M.; Monnet, D.L.; Pulcini, C.; Kahlmeter, G.; Kluytmans, J.; Carmeli, Y. Discovery, research, and development of new antibiotics: The WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect. Dis. 2018, 18, 318–327. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.A.; Gallagher, L.A.; Thongdee, M.; Staudinger, B.J.; Lippman, S.; Singh, P.K.; Manoil, C. General and condition-specific essential functions of Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 2015, 112, 5189–5194. [Google Scholar] [CrossRef] [PubMed]
- Ijaq, J.; Chandrasekharan, M.; Poddar, R.; Bethi, N.; Sundararajan, V.S. Annotation and curation of uncharacterized proteins-challenges. Front. Genet. 2015, 6, 115944. [Google Scholar] [CrossRef] [PubMed]
- Naveed, M.; Chaudhry, Z.; Ali, Z.; Amjad, M. Annotation and curation of hypothetical proteins: Prioritizing targets for experimental study. Adv. Life Sci. 2018, 5, 73–87. [Google Scholar]
- Galperin, M.Y.; Koonin, E.V. ‘Conserved hypothetical’ proteins: Prioritization of targets for experimental study. Nucleic Acids Res. 2004, 32, 5452–5463. [Google Scholar] [CrossRef]
- Goodall, E.C.; Robinson, A.; Johnston, I.G.; Jabbari, S.; Turner, K.A.; Cunningham, A.F.; Lund, P.A.; Cole, J.A.; Henderson, I.R. The essential genome of Escherichia coli K-12. mBio 2018, 9, e02096-17. [Google Scholar] [CrossRef] [PubMed]
- Loiseau, L.; Gerez, C.; Bekker, M.; Ollagnier-de Choudens, S.; Py, B.; Sanakis, Y.; Teixeira de Mattos, J.; Fontecave, M.; Barras, F. ErpA, an iron–sulfur (Fe–S) protein of the A-type essential for respiratory metabolism in Escherichia coli. Proc. Natl. Acad. Sci. USA 2007, 104, 13626–13631. [Google Scholar] [CrossRef] [PubMed]
- Oppermann, S.; Höfflin, S.; Friedrich, T. ErpA is important but not essential for the Fe/S cluster biogenesis of Escherichia coli NADH: Ubiquinone oxidoreductase (complex I). Biochim. Biophys. Acta (BBA)-Bioenerg. 2020, 1861, 148286. [Google Scholar] [CrossRef]
- Yang, Z.; Zhang, Z.; Zhu, J.; Ma, Y.; Wang, J.; Liu, J. Analysis of the Plasmid-Based ts Allele of PA0006 Reveals Its Function in Regulation of Cell Morphology and Biosynthesis of Core Lipopolysaccharide in Pseudomonas aeruginosa. Appl. Environ. Microbiol. 2022, 88, e00480-22. [Google Scholar] [CrossRef]
- Tian, L.; Yang, Z.; Wang, J.; Liu, J. Analysis of the Plasmid-Based ts-Mutant ΔfabA/pTS-fabA Reveals Its Lethality under Aerobic Growth Conditions That Is Suppressed by Mild Overexpression of desA at a Restrictive Temperature in Pseudomonas aeruginosa. Microbiol. Spectr. 2023, 11, e01338-23. [Google Scholar] [CrossRef]
- Kovach, M.E.; Elzer, P.H.; Hill, D.S.; Robertson, G.T.; Farris, M.A.; Roop II, R.M.; Peterson, K.M. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 1995, 166, 175–176. [Google Scholar] [CrossRef]
- Hung, C.-W.; Martínez-Márquez, J.Y.; Javed, F.T.; Duncan, M.C. A simple and inexpensive quantitative technique for determining chemical sensitivity in Saccharomyces cerevisiae. Sci. Rep. 2018, 8, 11919. [Google Scholar] [CrossRef]
- Prieto, C.; Barrios, D. RaNA-Seq: Interactive RNA-Seq analysis from FASTQ files to functional analysis. Bioinformatics 2020, 36, 1955–1956. [Google Scholar] [CrossRef]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
- Patro, R.; Duggal, G.; Love, M.I.; Irizarry, R.A.; Kingsford, C. Salmon provides fast and bias-aware quantification of transcript expression. Nat. Methods 2017, 14, 417–419. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Charbon, G.; Riber, L.; Cohen, M.; Skovgaard, O.; Fujimitsu, K.; Katayama, T.; Løbner-Olesen, A. Suppressors of DnaAATP imposed overinitiation in Escherichia coli. Mol. Microbiol. 2011, 79, 914–928. [Google Scholar] [CrossRef]
- Rost, B. Twilight zone of protein sequence alignments. Protein Eng. 1999, 12, 85–94. [Google Scholar] [CrossRef]
- Guzman, L.-M.; Belin, D.; Carson, M.J.; Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J. Bacteriol. 1995, 177, 4121–4130. [Google Scholar] [CrossRef]
- Brzóska, K.; Meczyńska, S.; Kruszewski, M. Iron-sulfur cluster proteins: Electron transfer and beyond. Acta Biochim. Pol. 2006, 53, 685–691. [Google Scholar] [CrossRef] [PubMed]
- Stehling, O.; Lill, R. The role of mitochondria in cellular iron–sulfur protein biogenesis: Mechanisms, connected processes, and diseases. Cold Spring Harb. Perspect. Biol. 2013, 5, a011312. [Google Scholar] [CrossRef]
- Saninjuk, K.; Romsang, A.; Duang-Nkern, J.; Wongsaroj, L.; Leesukon, P.; Dubbs, J.M.; Vattanaviboon, P.; Mongkolsuk, S. Monothiol Glutaredoxin Is Essential for Oxidative Stress Protection and Virulence in Pseudomonas aeruginosa. Appl. Environ. Microbiol. 2023, 89, e01714-22. [Google Scholar] [CrossRef]
- Touw, D.S.; Patel, D.R.; van den Berg, B. The crystal structure of OprG from Pseudomonas aeruginosa, a potential channel for transport of hydrophobic molecules across the outer membrane. PLoS ONE 2010, 5, e15016. [Google Scholar] [CrossRef]
- Coleman Jr, W.G. The rfaD gene codes for ADP-L-glycero-D-mannoheptose-6-epimerase. An enzyme required for lipopolysaccharide core biosynthesis. J. Biol. Chem. 1983, 258, 1985–1990. [Google Scholar] [CrossRef]
- Liu, Y.; Lin, Y.; Guan, N.; Song, Y.; Li, Y.; Xie, X. A lipopolysaccharide synthesis gene rfaD from Mesorhizobium huakuii is involved in nodule development and symbiotic nitrogen fixation. Microorganisms 2022, 11, 59. [Google Scholar] [CrossRef]
- Barras, F.; Loiseau, L.; Py, B. How Escherichia coli and Saccharomyces cerevisiae build Fe/S proteins. Adv. Microb. Physiol. 2005, 50, 41–101. [Google Scholar] [PubMed]
- Roche, B.; Aussel, L.; Ezraty, B.; Mandin, P.; Py, B.; Barras, F. Reprint of: Iron/sulfur proteins biogenesis in prokaryotes: Formation, regulation and diversity. Biochim. Biophys. Acta (BBA)-Bioenerg. 2013, 1827, 923–937. [Google Scholar] [CrossRef] [PubMed]
- Pinske, C.; Sawers, R.G. A-type carrier protein ErpA is essential for formation of an active formate-nitrate respiratory pathway in Escherichia coli K-12. J. Bacteriol. 2012, 194, 346–353. [Google Scholar] [CrossRef]
- Chepuri, V.; Lemieux, L.; Au, D.; Gennis, R.B. The sequence of the cyo operon indicates substantial structural similarities between the cytochrome o ubiquinol oxidase of Escherichia coli and the aa3-type family of cytochrome c oxidases. J. Biol. Chem. 1990, 265, 11185–11192. [Google Scholar] [CrossRef]
- Kučera, I.; Sedláček, V. Involvement of the cbb 3-type terminal oxidase in growth competition of Bacteria, biofilm formation, and in switching between denitrification and aerobic respiration. Microorganisms 2020, 8, 1230. [Google Scholar] [CrossRef] [PubMed]
- Zheng, M.; Wang, X.; Templeton, L.J.; Smulski, D.R.; LaRossa, R.A.; Storz, G. DNA microarray-mediated transcriptional profiling of the Escherichia coli response to hydrogen peroxide. J. Bacteriol. 2001, 183, 4562–4570. [Google Scholar] [CrossRef] [PubMed]
- McPhee, J.B.; Tamber, S.; Bains, M.; Maier, E.; Gellatly, S.; Lo, A.; Benz, R.; Hancock, R.E. The major outer membrane protein OprG of Pseudomonas aeruginosa contributes to cytotoxicity and forms an anaerobically regulated, cation-selective channel. FEMS Microbiol. Lett. 2009, 296, 241–247. [Google Scholar] [CrossRef]
Oligonucleotides | ||
---|---|---|
Name | Sequence (5′-3′) | Usage |
F1 | CTGGAACTGCCTGCCAGCGT | Assay pa0665 alleles in chr and TS plasmid |
R1 | CGGCAACTGCCCTGATGTGA | Ditto |
F2 | CTCCGGCATTTCCAGTCGAT | Assay pa0665 alleles in chr but not TS plasmid |
R2 | AGGTGAACCACGCACTGCTG | Ditto |
Plasmids | Relevant genotype | Reference |
pDEL | pUC-Gmr-sacB | [10,11] |
pRES or pTS | pUC-Tcr-orits | [10,11] |
pOE | pBBRMCS-5-araC-PBAD-Gmr | [10,11] |
pDEL-pa0665 | pa0665 deletion cassette in pDEL | This study |
pRES-pa0665 | pa0665 rescue cassette in pTS | This study |
pOE-pa0665 | araC-PBAD- pa0665 in pOE | This study |
pOE-ec.erpA | araC-PBAD-ec.erpA in pOE | This study |
Strains | Rel genotype/Usage | Reference |
PAO1 | Wild type | [10,11] |
Δpa0665/pTS-pa0665 | pa0665 ts-allele | This study |
Δpa0665/pTS-pa0665/pOE-pa0665 | pa0665-OE in ts | This study |
Δpa0665/pTS-pa0665/pOE-ec.erpA | ec.erpA-OE in ts | This study |
Δpa0665/pTS-pa0665/pOE | pOE in ts | This study |
Δpa4067/oprG | pa4067-deletion | This study |
Δpa3337/rfaD | pa3337-deletion | This study |
wt/pOE-pa0665 | pa0665-OE in wt | This study |
wt/pOE-ec.erpA | ec.erpA-OE in wt | This study |
wt/pOE | pOE in wt | This study |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, J.; Zhao, H.; Yang, Z. Genetic Analysis of the ts-Lethal Mutant Δpa0665/pTS-pa0665 Reveals Its Role in Cell Morphology and Oxidative Phosphorylation in Pseudomonas aeruginosa. Genes 2024, 15, 590. https://doi.org/10.3390/genes15050590
Zhu J, Zhao H, Yang Z. Genetic Analysis of the ts-Lethal Mutant Δpa0665/pTS-pa0665 Reveals Its Role in Cell Morphology and Oxidative Phosphorylation in Pseudomonas aeruginosa. Genes. 2024; 15(5):590. https://doi.org/10.3390/genes15050590
Chicago/Turabian StyleZhu, Jiayin, Hulin Zhao, and Zhili Yang. 2024. "Genetic Analysis of the ts-Lethal Mutant Δpa0665/pTS-pa0665 Reveals Its Role in Cell Morphology and Oxidative Phosphorylation in Pseudomonas aeruginosa" Genes 15, no. 5: 590. https://doi.org/10.3390/genes15050590