Isolation and Characterization of Phenylalanine Ammonia Lyase (PAL) Genes in Ferula pseudalliacea: Insights into the Phenylpropanoid Pathway
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material
2.2. DNA and RNA Extraction and cDNA Synthesis
2.3. Primer Design and Gene Cloning and Sequencing
2.4. Phylogeny Analysis
2.5. Prediction of FpPAL Phosphorylation Regions and Interaction Network
2.6. Real-Time PCR Analysis
3. Results
3.1. Screening and Confirmation of Clones
3.2. Structure and Physicochemical Analysis of FpPALs
3.3. Phylogenetic Analyses
3.4. Interaction Analysis
3.5. Expression Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fitzgerald, M.; Heinrich, M.; Booker, A. Medicinal plant analysis: A historical and regional discussion of emergent complex techniques. Front. Pharmacol. 2020, 10, 1480. [Google Scholar] [CrossRef]
- Oksman-Caldentey, K.-M.; Inzé, D. Plant cell factories in the post-genomic era: New ways to produce designer secondary metabolites. Trends Plant Sci. 2004, 9, 433–440. [Google Scholar] [CrossRef] [PubMed]
- Mohammadhosseini, M.; Venditti, A.; Sarker, S.D.; Nahar, L.; Akbarzadeh, A. The genus Ferula: Ethnobotany, phytochemistry and bioactivities—A review. Ind. Crops Prod. 2019, 129, 350–394. [Google Scholar] [CrossRef]
- Salehi, M.; Naghavi, M.R.; Bahmankar, M. A review of Ferula species: Biochemical characteristics, pharmaceutical and industrial applications, and suggestions for biotechnologists. Ind. Crops Prod. 2019, 139, 111511. [Google Scholar] [CrossRef]
- Dastan, D.; Hamah-Ameen, B.A.; Salehi, P.; Ghaderi, H.; Miran, M. Chemical composition and bioactivities of essential oils from different plant parts of Ferula pseudalliacea Rech. f. as an endemic plant from Iran. Nat. Prod. Res. 2022, 36, 1311–1316. [Google Scholar] [CrossRef] [PubMed]
- Naji Reyhani Garmroudi, S.; Karimi, E.; Oskoueian, E.; Homayouni-Tabrizi, M.; Iranshahi, M. Ferutinin: A phytoestrogen from ferula and its anticancer, antioxidant, and toxicity properties. J. Biochem. Mol. Toxicol. 2021, 35, e22713. [Google Scholar] [CrossRef]
- Trantas, E.; Navakoudis, E.; Pavlidis, T.; Nikou, T.; Halabalaki, M.; Skaltsounis, L.; Ververidis, F. Dual pathway for metabolic engineering of Escherichia coli to produce the highly valuable hydroxytyrosol. PLoS ONE 2019, 14, e0212243. [Google Scholar] [CrossRef]
- Simos, Y.V.; Zerikiotis, S.; Lekkas, P.; Athinodorou, A.-M.; Zachariou, C.; Tzima, C.; Assariotakis, A.; Peschos, D.; Tsamis, K.; Halabalaki, M. Oral Supplementation with Hydroxytyrosol Synthesized Using Genetically Modified Escherichia coli Strains and Essential Oils Mixture: A Pilot Study on the Safety and Biological Activity. Microorganisms 2023, 11, 770. [Google Scholar] [CrossRef] [PubMed]
- Simos, Y.V.; Zerikiotis, S.; Lekkas, P.; Zachariou, C.; Halabalaki, M.; Ververidis, F.; Trantas, E.A.; Tsamis, K.; Peschos, D.; Angelidis, C. Hydroxytyrosol produced by engineered Escherichia coli strains activates Nrf2/HO-1 pathway: An in vitro and in vivo study. Exp. Biol. Med. 2023, 248, 1598–1612. [Google Scholar] [CrossRef]
- Dastan, D.; Salehi, P.; Gohari, A.R.; Zimmermann, S.; Kaiser, M.; Hamburger, M.; Khavasi, H.R.; Ebrahimi, S.N. Disesquiterpene and sesquiterpene coumarins from Ferula pseudalliacea, and determination of their absolute configurations. Phytochemistry 2012, 78, 170–178. [Google Scholar] [CrossRef]
- Ververidis, F.; Trantas, E.; Douglas, C.; Vollmer, G.; Kretzschmar, G.; Panopoulos, N. Biotechnology of flavonoids and other phenylpropanoid-derived natural products. Part II: Reconstruction of multienzyme pathways in plants and microbes. Biotechnol. J. Healthc. Nutr. Technol. 2007, 2, 1235–1249. [Google Scholar] [CrossRef]
- Yadav, V.; Wang, Z.; Wei, C.; Amo, A.; Ahmed, B.; Yang, X.; Zhang, X. Phenylpropanoid pathway engineering: An emerging approach towards plant defense. Pathogens 2020, 9, 312. [Google Scholar] [CrossRef]
- Levy, H.L.; Sarkissian, C.N.; Scriver, C.R. Phenylalanine ammonia lyase (PAL): From discovery to enzyme substitution therapy for phenylketonuria. Mol. Genet. Metab. 2018, 124, 223–229. [Google Scholar] [CrossRef] [PubMed]
- Amri, R.; Font i Forcada, C.; Giménez, R.; Pina, A.; Moreno, M.Á. Biochemical characterization and differential expression of PAL genes associated with “translocated” peach/plum graft-incompatibility. Front. Plant Sci. 2021, 12, 622578. [Google Scholar] [CrossRef]
- Zhan, C.; Li, Y.; Li, H.; Wang, M.; Gong, S.; Ma, D.; Li, Y. Phylogenomic analysis of phenylalanine ammonia-lyase (PAL) multigene family and their differential expression analysis in wheat (Triticum aestivum L.) suggested their roles during different stress responses. Front. Plant Sci. 2022, 13, 982457. [Google Scholar] [CrossRef]
- Yu, X.-Z.; Fan, W.-J.; Lin, Y.-J.; Zhang, F.-F.; Gupta, D.K. Differential expression of the PAL gene family in rice seedlings exposed to chromium by microarray analysis. Ecotoxicology 2018, 27, 325–335. [Google Scholar] [CrossRef]
- Chang, A.; Lim, M.-H.; Lee, S.-W.; Robb, E.J.; Nazar, R.N. Tomato phenylalanine ammonia-lyase gene family, highly redundant but strongly underutilized. J. Biol. Chem. 2008, 283, 33591–33601. [Google Scholar] [CrossRef] [PubMed]
- Joos, H.; Hahlbrock, K. Phenylalanine ammonia-lyase in potato (Solanum tuberosum L.) Genomic complexity, structural comparison of two selected genes and modes of expression. Eur. J. Biochem. 1992, 204, 621–629. [Google Scholar] [CrossRef] [PubMed]
- Blount, J.W.; Korth, K.L.; Masoud, S.A.; Rasmussen, S.; Lamb, C.; Dixon, R.A. Altering expression of cinnamic acid 4-hydroxylase in transgenic plants provides evidence for a feedback loop at the entry point into the phenylpropanoid pathway. Plant Physiol. 2000, 122, 107–116. [Google Scholar] [CrossRef]
- Rogers, S.O.; Bendich, A.J. Extraction of DNA from plant tissues. In Plant Molecular Biology Manual; Springer: Berlin/Heidelberg, Germany, 1989; pp. 73–83. [Google Scholar]
- Mazzara, M.; James, D.J. The influence of photoperiodic growth condition on isolation of RNA from strawberry (Fragaria × ananassa Duch.) tissue. Mol. Biotechnol. 2000, 15, 237–241. [Google Scholar] [CrossRef]
- Sievers, F.; Higgins, D.G. Clustal omega. Curr. Protoc. Bioinform. 2014, 48, 3–13. [Google Scholar] [CrossRef]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef]
- Sambrook, J.; Russell, D.W. Transcriptional run-on assays. Cold Spring Harb. Protoc. 2006, 2006, pdb-rot3956. [Google Scholar] [CrossRef]
- Nguyen, L.-T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating Maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef] [PubMed]
- Quevillon, E.; Silventoinen, V.; Pillai, S.; Harte, N.; Mulder, N.; Apweiler, R.; Lopez, R. InterProScan: Protein domains identifier. Nucleic Acids Res. 2005, 33, W116–W120. [Google Scholar] [CrossRef]
- Blom, N.; Gammeltoft, S.; Brunak, S. Sequence and structure-based prediction of eukaryotic protein phosphorylation sites. J. Mol. Biol. 1999, 294, 1351–1362. [Google Scholar] [CrossRef]
- Szklarczyk, D.; Gable, A.L.; Lyon, D.; Junge, A.; Wyder, S.; Huerta-Cepas, J.; Simonovic, M.; Doncheva, N.T.; Morris, J.H.; Bork, P.; et al. STRING v11: Protein–protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 2019, 47, D607–D613. [Google Scholar] [CrossRef]
- Gasteiger, E.; Hoogland, C.; Gattiker, A.; Duvaud, S.; Wilkins, M.R.; Appel, R.D.; Bairoch, A. Protein identification and analysis tools on the ExPASy server. In The Proteomics Protocols Handbook; Humana Press: Totowa, NJ, USA, 2005; pp. 571–607. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Mo, F.; Li, L.; Zhang, C.; Yang, C.; Chen, G.; Niu, Y.; Si, J.; Liu, T.; Sun, X.; Wang, S. Genome-wide analysis and expression profiling of the phenylalanine ammonia-lyase gene family in Solanum tuberosum. Int. J. Mol. Sci. 2022, 23, 6833. [Google Scholar] [CrossRef]
- Rasool, F.; Uzair, M.; Naeem, M.K.; Rehman, N.; Afroz, A.; Shah, H.; Khan, M.R. Phenylalanine ammonia-lyase (PAL) genes family in wheat (Triticum aestivum L.): Genome-wide characterization and expression profiling. Agronomy 2021, 11, 2511. [Google Scholar] [CrossRef]
- Yan, F.; Li, H.; Zhao, P. Genome-Wide Identification and transcriptional expression of the PAL Gene family in common Walnut (Juglans regia L.). Genes 2019, 10, 46. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Zhong, X.; Jiang, X.; Cong, H.; Sun, H.; Qiao, F. Characterisation, expression and functional analysis of PAL gene family in Cephalotaxus hainanensis. Plant Physiol. Biochem. 2020, 156, 461–470. [Google Scholar] [CrossRef]
- Zhao, T.; Li, R.; Yao, W.; Wang, Y.; Zhang, C.; Li, Y. Genome-wide identification and characterisation of phenylalanine ammonia-lyase gene family in grapevine. J. Hortic. Sci. Biotechnol. 2021, 96, 456–468. [Google Scholar] [CrossRef]
- Shang, Q.-M.; Li, L.; Dong, C.-J. Multiple tandem duplication of the phenylalanine ammonia-lyase genes in Cucumis sativus L. Planta 2012, 236, 1093–1105. [Google Scholar] [CrossRef] [PubMed]
- Lepelley, M.; Mahesh, V.; McCarthy, J.; Rigoreau, M.; Crouzillat, D.; Chabrillange, N.; de Kochko, A.; Campa, C. Characterization, high-resolution mapping and differential expression of three homologous PAL genes in Coffea canephora Pierre (Rubiaceae). Planta 2012, 236, 313–326. [Google Scholar] [CrossRef]
- Shi, R.; Shuford, C.M.; Wang, J.P.; Sun, Y.-H.; Yang, Z.; Chen, H.-C.; Tunlaya-Anukit, S.; Li, Q.; Liu, J.; Muddiman, D.C. Regulation of phenylalanine ammonia-lyase (PAL) gene family in wood forming tissue of Populus trichocarpa. Planta 2013, 238, 487–497. [Google Scholar] [CrossRef] [PubMed]
- Cochrane, F.C.; Davin, L.B.; Lewis, N.G. The Arabidopsis phenylalanine ammonia lyase gene family: Kinetic characterization of the four PAL isoforms. Phytochemistry 2004, 65, 1557–1564. [Google Scholar] [CrossRef]
- Faraji, S.; Filiz, E.; Kazemitabar, S.K.; Vannozzi, A.; Palumbo, F.; Barcaccia, G.; Heidari, P. The AP2/ERF Gene Family in Triticum durum: Genome-Wide Identification and Expression Analysis under Drought and Salinity Stresses. Genes 2020, 11, 1464. [Google Scholar] [CrossRef]
- Yaghobi, M.; Heidari, P. Genome-Wide Analysis of Aquaporin Gene Family in Triticum turgidum and Its Expression Profile in Response to Salt Stress. Genes 2023, 14, 202. [Google Scholar] [CrossRef]
- Arab, M.; Najafi Zarrini, H.; Nematzadeh, G.; Heidari, P.; Hashemipetroudi, S.H.; Kuhlmann, M. Comprehensive Analysis of Calcium Sensor Families, CBL and CIPK, in Aeluropus littoralis and Their Expression Profile in Response to Salinity. Genes 2023, 14, 753. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.; Wang, M.-H. Characterization of the phenylalanine ammonia-lyase gene (SlPAL5) from tomato (Solanum lycopersicum L.). Mol. Biol. Rep. 2009, 36, 1579–1585. [Google Scholar] [CrossRef] [PubMed]
- Mu, D.; Chen, L.; Wang, H.; Hu, Z.; Chen, S.; Chen, S.; Cai, N.; Xu, Y.; Tang, J. The Identification of Phenylalanine Ammonia-Lyase (PAL) Genes from Pinus yunnanensis and an Analysis of Enzyme Activity in vitro. Phyton 2024, 93, 3. [Google Scholar] [CrossRef]
- Dixon, R.A.; Achnine, L.; Kota, P.; Liu, C.; Reddy, M.S.S.; Wang, L. The phenylpropanoid pathway and plant defence—A genomics perspective. Mol. Plant Pathol. 2002, 3, 371–390. [Google Scholar] [CrossRef] [PubMed]
- Khakdan, F.; Alizadeh, H.; Ranjbar, M. Molecular cloning, functional characterization and expression of a drought inducible phenylalanine ammonia-lyase gene (ObPAL) from Ocimum basilicum L. Plant Physiol. Biochem. 2018, 130, 464–472. [Google Scholar] [CrossRef] [PubMed]
- Dong, C.-J.; Shang, Q.-M. Genome-wide characterization of phenylalanine ammonia-lyase gene family in watermelon (Citrullus lanatus). Planta 2013, 238, 35–49. [Google Scholar] [CrossRef] [PubMed]
- Xu, F.; Cai, R.; Cheng, S.; Du, H.; Wang, Y. Molecular cloning, characterization and expression of phenylalanine ammonia-lyase gene from Ginkgo biloba. Afr. J. Biotechnol. 2008, 7, 721–729. [Google Scholar]
- D’Auria, J.C.; Gershenzon, J. The secondary metabolism of Arabidopsis thaliana: Growing like a weed. Curr. Opin. Plant Biol. 2005, 8, 308–316. [Google Scholar] [CrossRef]
Primer Name | Sequence (5′-3′) | tm °C | Product Size |
---|---|---|---|
F-PAL | TACATYGCTGGACTTCTMACTGG | 58 | 960 |
R-PAL | CTCCTCCAARTGCCTCARGTC | ||
F-PAL2-D | GTCCAAAGYGCTGARCARCAC | 60 | 860 |
Oligo(dT) primer | GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV | ||
PCR anchor primer | GACCACGCGTATCGATGTCGAC | ||
F-FpPAL1.RT | CACAGGAGAAAAAGTGCGGTCA | 60 | 179 |
R-FpPAL1.RT | CTTGATAAAACAACACCGATTGC | ||
F-FpPAL2.RT | CATAAGGGAAGAGTTGGGG | 60 | 182 |
R-FpPAL2.RT | CATAACAGAAGCTCTTTAATTAAGCA | ||
F-FpPAL3.RT | CAGAACTGGGAACCGAATATCTT | 60 | 175 |
R-FpPAL3.RT | ATACTTGACTGCATGCCCATTTAG | ||
F-FpACTIN.RT | GCCATCTATGATTGGGAATGG | 56 | 190 |
R-FpACTIN.RT | GCCACCACCTTGATCTTCATG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shahidi, P.; Bahramnejad, B.; Vafaee, Y.; Dastan, D.; Heidari, P. Isolation and Characterization of Phenylalanine Ammonia Lyase (PAL) Genes in Ferula pseudalliacea: Insights into the Phenylpropanoid Pathway. Genes 2024, 15, 771. https://doi.org/10.3390/genes15060771
Shahidi P, Bahramnejad B, Vafaee Y, Dastan D, Heidari P. Isolation and Characterization of Phenylalanine Ammonia Lyase (PAL) Genes in Ferula pseudalliacea: Insights into the Phenylpropanoid Pathway. Genes. 2024; 15(6):771. https://doi.org/10.3390/genes15060771
Chicago/Turabian StyleShahidi, Pegah, Bahman Bahramnejad, Yavar Vafaee, Dara Dastan, and Parviz Heidari. 2024. "Isolation and Characterization of Phenylalanine Ammonia Lyase (PAL) Genes in Ferula pseudalliacea: Insights into the Phenylpropanoid Pathway" Genes 15, no. 6: 771. https://doi.org/10.3390/genes15060771
APA StyleShahidi, P., Bahramnejad, B., Vafaee, Y., Dastan, D., & Heidari, P. (2024). Isolation and Characterization of Phenylalanine Ammonia Lyase (PAL) Genes in Ferula pseudalliacea: Insights into the Phenylpropanoid Pathway. Genes, 15(6), 771. https://doi.org/10.3390/genes15060771