Molecular Cloning, Tissue Distribution and Antiviral Immune Response of Duck Src
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Analysis of Duck Src Gene Cloning and Sequencing
2.3. Cell Culture and Treatment
2.4. Plasmid Construction
2.5. RT-qPCR
2.6. Luciferase Reporter Assays and ELISA Analysis
3. Results
3.1. Cloning of duSrc and Sequence Analysis
3.2. Tissue Expression Profile of Src in Ducks Treated with Newcastle Disease Virus
3.3. Response of Chicken and Duck Embryonic Fibroblasts to 5′ppp dsRNA Stimulation
3.4. The Induction Ability of duSRC and Its Domain to IFN-β
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Anguita, E.; Villalobo, A. Src-family tyrosine kinases and the Ca signal. BBA-Mol. Cell Res. 2017, 1864, 915–932. [Google Scholar] [CrossRef] [Scilit]
- Johnson, F.M.; Gallick, G.E. Src family nonreceptor tyrosine kinases as molecular targets for cancer therapy. Anti-Cancer Agents Med. Chem. 2007, 7, 651–659. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, J.; Li, G.; Li, L.; Li, D.; Dong, Z.J.; Jiang, P. Asparagine enhances LCK signalling to potentiate CD8 T-cell activation and anti-tumour responses. Nat. Cell Biol. 2021, 23, 75–86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brian, B.; Freedman, T.S. The Src-family Kinase Lyn in Immunoreceptor Signaling. Endocrinology 2021, 162, bqab152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Toubiana, J.; Rossi, A.L.; Belaidouni, N.; Grimaldi, D.; Pene, F.; Chafey, P.; Comba, B.; Camoin, L.; Bismuth, G.; Claessens, Y.E.; et al. Src-family-tyrosine kinase Lyn is critical for TLR2-mediated NF-κB activation through the PI 3-kinase signaling pathway. Innate Immun. 2015, 21, 685–697. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johnsen, I.B.; Nguyen, T.T.; Bergstroem, B.; Fitzgerald, K.A.; Anthonsen, M.W. The Tyrosine Kinase c-Src Enhances RIG-I (Retinoic Acid-inducible Gene I)-elicited Antiviral Signaling. J. Biol. Chem. 2009, 284, 19122–19131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Engen, J.R.; Wales, T.E.; Hochrein, J.M.; Meyn, M.A.; Ozkan, S.B.; Bahar, I.; Smithgall, T.E. Structure and dynamic regulation of Src-family kinases. Cell Mol. Life Sci. 2008, 65, 3058–3073. [Google Scholar] [CrossRef] [Scilit]
- Chehayeb, R.J.; Boggon, T.J. SH2 Domain Binding: Diverse FLVRs of Partnership. Front. Endocrinol. 2020, 11, 575220. [Google Scholar] [CrossRef] [Scilit]
- Lu, X.; Hu, X.D.; Song, L.Z.; An, L.; Duan, M.H.; Chen, S.L.; Zhao, S.T. The SH2 domain is crucial for function of Fyn in neuronal migration and cortical lamination. BMB Rep. 2015, 48, 97–102. [Google Scholar] [CrossRef] [Scilit]
- Kästle, M.; Merten, C.; Hartig, R.; Kaehne, T.; Liaunardy-Jopeace, A.; Woessner, N.M.; Schamel, W.W.; James, J.; Minguet, S.; Simeoni, L.; et al. Tyrosine 192 within the SH2 domain of the Src-protein tyrosine kinase p56 regulates T-cell activation independently of Lck/CD45 interactions. Cell Commun. Signal 2020, 18, 183. [Google Scholar] [CrossRef] [Scilit]
- Mehrabipour, M.; Jasemi, N.S.K.; Dvorsky, R.; Ahmadian, M.R. A Systematic Compilation of Human SH3 Domains: A Versatile Superfamily in Cellular Signaling. Cells 2023, 12, 2054. [Google Scholar] [CrossRef] [Scilit]
- Dionne, U.; Percival, L.J.; Chartier, F.J.M.; Landry, C.R.; Bisson, N. SRC homology 3 domains: Multifaceted binding modules. Trends Biochem. Sci. 2022, 47, 772–784. [Google Scholar] [CrossRef] [Scilit]
- Lim, Y.J.; Koo, J.B.; Hong, E.H.; Park, Z.Y.; Lim, K.M.; Bae, O.N.; Lee, J.Y. A Src-family-tyrosine kinase, Lyn, is required for efficient IFN-β, expression in pattern recognition receptor, RIG-I, signal pathway by interacting with IPS-1. Cytokine 2015, 72, 63–70. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raji, L.; Tetteh, A.; Amin, A.R.M.R. Role of c-Src in Carcinogenesis and Drug Resistance. Cancers 2024, 16, 32. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lv, Y.F.; Deng, H.; Liu, Y.P.; Chang, K.L.; Du, H.L.; Zhou, P.C.; Mao, H.L.; Hu, C.Y. The tyrosine kinase SRC of grass carp up-regulates the expression of IFN I by activating TANK binding kinase 1. Dev. Comp. Immunol. 2021, 114, 103834. [Google Scholar] [CrossRef] [Scilit]
- Evseev, D.; Magor, K.E. Innate Immune Responses to Avian Influenza Viruses in Ducks and Chickens. Vet. Sci. 2019, 6, 5. [Google Scholar] [CrossRef] [Scilit]
- Kim, L.M.; King, D.J.; Curry, P.E.; Suarez, D.L.; Swayne, D.E.; Stallknecht, D.E.; Slemons, R.D.; Pedersen, J.C.; Senne, D.A.; Winker, K.; et al. Phylogenetic diversity among low-virulence newcastle disease viruses from waterfowl and shorebirds and comparison of genotype distributions to those of poultry-origin isolates. J. Virol. 2007, 81, 12641–12653. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morris, K.M.; Mishra, A.; Raut, A.A.; Gaunt, E.R.; Borowska, D.; Kuo, R.I.; Wang, B.; Vijayakumar, P.; Chingtham, S.; Dutta, R.; et al. Corrigendum: The molecular basis of differential host responses to avian influenza viruses in avian species with differing susceptibility. Front. Cell. Infect. Microbiol. 2023, 13, 1067993. [Google Scholar] [CrossRef] [Scilit]
- Huang, Y.H.; Feng, H.P.; Huang, L.R.; Yi, K.; Rong, E.G.; Chen, X.Y.; Li, J.W.; Wang, Z.; Zhu, P.Y.; Liu, X.J.; et al. Transcriptomic analyses reveal new genes and networks response to H5N1 influenza viruses in duck (Anas platyrhynchos). J. Integr. Agric. 2019, 18, 1460–1472. [Google Scholar] [CrossRef] [Scilit]
- Parsons, S.J.; Parsons, J.T. Src family kinases, key regulators of signal transduction. Oncogene 2004, 23, 7906–7909. [Google Scholar] [CrossRef] [Scilit]
- Giannoni, E.; Taddei, M.L.; Chiarugi, P. Src redox regulation: Again in the front line. Free Radic. Bio Med. 2010, 49, 516–527. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Danilova, N. The evolution of immune mechanisms. J. Exp. Zool. Part. B 2006, 306b, 496–520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carpenter, S.; O’Neill, L.A.J. From periphery to center stage: 50 years of advancements in innate immunity. Cell 2024, 187, 2030–2051. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takaoka, A.; Wang, Z.; Choi, M.K.; Yanai, H.; Negishi, H.; Ban, T.; Lu, Y.; Miyagishi, M.; Kodama, T.; Honda, K.; et al. DAI (DLM-1/ZBP1) is a cytosolic DNA sensor and an activator of innate immune response. Nature 2007, 448, 501–514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoneyama, M.; Kato, H.; Fujita, T. Physiological functions of RIG-I-like receptors. Immunity 2024, 57, 731–751. [Google Scholar] [CrossRef] [Scilit]
- Li, X.L.; Yang, M.J.; Yu, Z.; Tang, S.Q.; Wang, L.; Cao, X.T.; Chen, T.Y. The tyrosine kinase Src promotes phosphorylation of the kinase TBK1 to facilitate type I interferon production after viral infection. Sci. Signal. 2017, 10, eaae0435. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barber, M.R.W.; Aldridge, J.R.; Webster, R.G.; Magor, K.E. Association of RIG-I with innate immunity of ducks to influenza. Proc. Natl. Acad. Sci. USA 2010, 107, 5913–5918. [Google Scholar] [CrossRef] [Scilit]
- Schweibenz, B.D.; Solotchi, M.; Hanpude, P.; Devarkar, S.C.; Patel, S.S. RIG-I recognizes metabolite-capped RNAs as signaling ligands. Nucleic Acids Res. 2023, 51, 8102–8114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Corey, S.J.; Anderson, S.M. Src-related protein tyrosine kinases in hematopoiesis. Blood 1999, 93, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Abram, C.L.; Courtneidge, S.A. Src family tyrosine kinases and growth factor signaling. Exp. Cell Res. 2000, 254, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Kang, Y.F.; Li, Y.L.; Yuan, R.Y.; Feng, M.S.; Xiang, B.; Sun, M.H.; Li, Y.L.; Xie, P.; Tan, Y.T.; Ren, T. Host Innate Immune Responses of Ducks Infected with Newcastle Disease Viruses of Different Pathogenicities. Front. Microbiol. 2015, 6, 1283. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoneyama, M.; Kikuchi, M.; Natsukawa, T.; Shinobu, N.; Imaizumi, T.; Miyagishi, M.; Taira, K.; Akira, S.; Fujita, T. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat. Immunol. 2004, 5, 730–737. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Agalioti, T.; Lomvardas, S.; Parekh, B.; Yie, J.M.; Maniatis, T.; Thanos, D. Ordered recruitment of chromatin modifying and general transcription factors to the IFN-β promoter. Cell 2000, 103, 667–678. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lomvardas, S.; Thanos, D. Modifying gene expression programs by altering core promoter chromatin architecture. Cell 2002, 110, 261–271. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stetson, D.B.; Medzhitov, R. Type I interferons in host defense. Immunity 2006, 25, 373–381. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Theofilopoulos, A.N.; Baccala, R.; Beutler, B.; Kono, D.H. Type I interferons (α/β) in immunity and autoimmunity. Annu. Rev. Immunol. 2005, 23, 307–336. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.Y.; Jiang, L.J.; Chen, L.; Ding, M.L.; Guo, H.Z.; Zhang, W.; Zhang, H.X.; Ma, X.D.; Liu, X.Z.; Xi, X.D.; et al. RIG-I Modulates Src-Mediated AKT Activation to Restrain Leukemic Stemness. Mol. Cell 2014, 53, 407–419. [Google Scholar] [CrossRef] [Scilit]
- Matsubara, T.; Yasuda, K.; Mizuta, K.; Kawaue, H.; Kokabu, S. Tyrosine Kinase Src Is a Regulatory Factor of Bone Homeostasis. Int. J. Mol. Sci. 2022, 23, 5508. [Google Scholar] [CrossRef] [Scilit]




| Primer Name | Primer Sequence (5′→3′) | Temperature (℃) | Note |
|---|---|---|---|
| duSrc-Flag-F | ccaagctggctagttaagcttATGGGGAGCAGCAAGAGCA | 68 | RT-PCR |
| duSrc-Flag-R | tgctggatatctgcagaattTATAGGTTCTCGCCGGGCTG | ||
| 5′ Router | GCCGCTTTGCTGGGTGTCTG | 60 | 5’ RACE-PCR |
| 5′ Inner | CCCCGTGGTGGGTGCTGTCG | ||
| 3′ Router | GCAAGGTGCCAAGTTCCCCATC | 60 | 3’ RACE-PCR |
| 3′ Inner | CATCCTGCTGACCGAGCTGACCAC | ||
| duSrc(SH3)-Flag-R | ccaagctggctagttaagcttACCTTCGTGGCCCTCTACGA | 55 | RT-PCR |
| duSrc(SH3)-Flag-R | tgctggatatctgcagaattcTGAGGGCGCGACATAGTTACT | ||
| duSrc(SH2)-Flag-F | ccaagctggctagttaagcttCAGGCTGAAGAGTGGTATTTCGG | 55 | RT-PCR |
| duSrc(SH2)-Flag-R | tgctggatatctgcagaattcGACGGTGGTCAGACGGTGG | ||
| duSrc(PTKc)-Flag-F | ccaagctggctagttaagcttAAGGATGCCTGGGAAATCCC | 55 | RT-PCR |
| duSrc(PTKc)-Flag-R duIFN-β-promoter-F duIFN-β-promoter-R qduSrc-F qduSrc-R qchSrc-F qchSrc-R | tgctggatatctgcagaattcTAGGTTCTCGCCGGGCTG CCCAAGCTTAAGCGATGGGAAAGATGT GGAAGATCTTGTAGGGGCTATGTGGT ATGGGGAGCAGCAAGAGCAAACCCA GGGGTCTTTGGGTTTGC ACTTCTGACACCGTCACGTC ACCAGTCACCTTCCGTGTTG | 58 60 60 | RT-PCR RT-qPCR RT-qPCR |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, J.; Luo, S.; Wang, G.; Hu, X.; Chen, G.; Xu, Q. Molecular Cloning, Tissue Distribution and Antiviral Immune Response of Duck Src. Genes 2024, 15, 1044. https://doi.org/10.3390/genes15081044
Liu J, Luo S, Wang G, Hu X, Chen G, Xu Q. Molecular Cloning, Tissue Distribution and Antiviral Immune Response of Duck Src. Genes. 2024; 15(8):1044. https://doi.org/10.3390/genes15081044
Chicago/Turabian StyleLiu, Jinlu, Shuwen Luo, Guoyao Wang, Xuming Hu, Guohong Chen, and Qi Xu. 2024. "Molecular Cloning, Tissue Distribution and Antiviral Immune Response of Duck Src" Genes 15, no. 8: 1044. https://doi.org/10.3390/genes15081044
APA StyleLiu, J., Luo, S., Wang, G., Hu, X., Chen, G., & Xu, Q. (2024). Molecular Cloning, Tissue Distribution and Antiviral Immune Response of Duck Src. Genes, 15(8), 1044. https://doi.org/10.3390/genes15081044

