Next Article in Journal
Post-COVID Myocarditis in Patients with Primary Cardiomyopathies: Diagnosis, Clinical Course and Outcomes
Previous Article in Journal
Effects of KRTAP20-1 Gene Variation on Wool Traits in Chinese Tan Sheep
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 15
Issue 8
10.3390/genes15081061
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Association Analysis of METTL23 Gene Polymorphisms with Reproductive Traits in Kele Pigs

by
Jie Sun
1,2,
Chunyuan Wang
1,2,
Yan Wu
1,2,
Jin Xiang
1,2 and
Yiyu Zhang
1,2,*
1
Key Laboratory of Animal Genetics, Breeding and Reproduction in the Plateau Mountainous Region, Ministry of Education, College of Animal Science, Guizhou University, West Campus, Huaxi District, Guiyang 550025, China
2
Institute of Xiang Pigs, Guizhou University, West Campus, Huaxi District, Guiyang 550025, China
*
Author to whom correspondence should be addressed.
Genes 2024, 15(8), 1061; https://doi.org/10.3390/genes15081061
Submission received: 4 July 2024 / Revised: 27 July 2024 / Accepted: 9 August 2024 / Published: 12 August 2024
(This article belongs to the Section Animal Genetics and Genomics)
Browse Figures
Versions Notes

Abstract

:
Methyltransferase-like 23 (METTL23) is a kind of RNA methyltransferase that catalyzes the methylation transfer to the N6-adenosine of RNA, serving as one of the key mediators in this process. However, the METTL23 gene has been poorly researched in pigs. In this study, we investigated the genetic effects of METTL23 single-nucleotide polymorphism(SNPs) on reproductive traits in Kele pigs. The DNA was extracted from 228 healthy multiparous Kele sows, and Sanger sequencing revealed three SNPs, g.4804958 G > T (intron 2), g.4805082 C > T (exon 2), and g.4806821 A > G (exon 3). The polymorphism information content (PIC) for each SNP was 0.264, 0.25, and 0.354, indicating moderate polymorphism (0.25 < PIC < 0.5) and providing genetic information. Linkage disequilibrium analysis showed no strong linkage disequilibrium between the three SNPs. The association analysis revealed that in the SNP g.4804958 G > T individuals with the GG genotype had a significantly higher number of piglets born alive, litter birth weight, number of weaned piglets, and weaning litter weight compared to those with the TT genotype (p < 0.05). Individuals with the GG genotype in the SNP g.4806821 A > G group had significantly higher litter birth weight and average birth weight than those with the AA genotype (p < 0.05). The H4H4 diplotype showed significant effects on the number of piglets born alive, litter birth weight, number of weaned piglets, weaning litter weight, and weaning weight (p < 0.05). Together, the METTL23 gene could be used as a candidate gene for the selection of reproductive traits in Kele pigs.

1. Introduction

Pigs were one of the earliest domesticated animals in the Near East around 9000 YBP [1,2]. China proved to be a major center of domestication in Asia [3]. The reproductive traits of sows determine the efficiency of pig production and economic returns, and one of the main reasons for weeding out sows is reproductive failure. It is an issue for economic and sustainability reasons [4], so the reproductive trait of sows has always been one of the most important concerns of breeders and the farming industry. As the reproductive trait is strongly influenced by the environment and traits with low heritability, we are limited to improving reproductive traits in pigs through conventional selection and crossbreeding systems [5]. The completion of the porcine genome sequence provided a valuable resource both in agricultural production and biomedical research [6]. One of the most important means to improve reproduction is the application of molecular breeding techniques in the selection of reproductive traits in pigs [7]. The Kele pig is one of the excellent local pig breeds in China, with its main origin in the Weining and Hezhang counties of Guizhou Province. It has the characteristics of cold resistance, roughage tolerance, high resistance to adversity, excellent meat quality with high increased intramuscular fat (IMF) [8], and well-developed hind legs, which is a high-quality raw material for making ham [9]. Due to the low reproductive performance of the Kele pigs, the development of the industry is restricted, and their reproductive performance needs to be improved. [10,11]
Methyltransferase-like 23 (METTL23) belongs to type I PRMTs and can catalyze the asymmetric dimethylation of histone H3R17 [12]. Protein arginine methyltransferases (PRMTs) are a class of enzymes that are responsible for adding methyl groups on arginine residues to target proteins [13,14]. This modification process, known as arginine methylation, is an important form of post-translational modification of proteins that affects a variety of biological processes, including gene transcription, cell signaling, protein interactions, etc. [15,16]. The family of PRMTs includes nine members, which have been classified into three categories: Type I, Type II, and Type III. Each PRMT member has different substrate specificities and methylation patterns, allowing them to perform their own unique functions in cells [17]. Studies in humans have found that the METTL23 gene mutation alters histone H3R17 methylation in normal-tension glaucoma [18]. Moreover, many of the studies on the METTL23 gene have been about human intelligence [19,20,21,22,23], and there were also studies showing that the METTL23 gene was associated with glaucoma in humans [24,25]. A study found that the METTL23 gene is implicated in congenital heart disease [26]. Another study has found that METTL23 is not the methyltransferase responsible for eEF1A methylation [27]. Yuki Hatanaka et al. [28] established that H3R17me2a and its catalyzing enzyme METTL23 are key regulators of paternal genome reprogramming. Wang et al. [29] identified that the METTL23 gene may play an important role in both the prognostic assessment and the prediction of recurrence risk for prostate cancer. In addition, studies on animals found that the METTL23 gene is involved in mental disorders in wild boars [30]. Furthermore, there was also a study about the METTL23 gene on medicinal plants, where Zhao et al. [31] discovered that the METTL23 gene has the potential to increase the production of dendrobium in the medicinal plant Dendrobium catenatum.
The porcine METTL23 gene is located on chromosome 12 (NC 010454.4) and encodes 190 amino acids with a total length of 6545 bp and five exons, and it is highly expressed in the ovary [32,33]. The METTL23 gene is a kind of type I PRMT, and studies have shown that the methylation modification by PRMTs plays an important role in mouse embryo implantation [34,35]. Research has demonstrated that protein arginine methyltransferases (PRMTs) are critically involved in murine embryogenesis, exerting regulatory control over gene expression, sustaining the pluripotency of stem cells, and facilitating the proper development of the nervous system [36,37,38]. However, the discovery of the METTL23 gene has had very limited reports in pigs. In this study, we hypothesized that the METTL23 gene affects reproductive performance on the foundation of previous research. For this purpose, we designed PCR primers for the coding region sequence (CDS) of the METTL23 gene and used Sanger direct sequencing to search for single-nucleotide polymorphisms (SNP) in the CDS of the METTL23 gene. In addition, the association analyses were carried out with the reproductive traits of Kele pigs in order to determine whether genetic variations in the METTL23 gene affect reproductive traits in pigs.

2. Materials and Methods

2.1. Experimental Materials

A total of 228 healthy sows were selected from the breeding farm of Kele pigs in Hezhang County, Bijie City, Guizhou Province, and reproductive indexes of two to four births were recorded, including piglets born alive, litter birth weight, average birth weight, number of weaned piglets, weaning litter weight, weaning weight, etc. A total of 0.5 g of ear tissue was collected from the sows with ear clamps, then we placed it into centrifuge tubes containing 75% ethanol for temporary storage and recorded the corresponding ear numbers. The ear tissues were taken back to the laboratory and stored in the refrigerator at −40 °C for future use.

2.2. DNA Extraction

The DNA was extracted using the tissue DNA kit (D3396-3) provided by Guizhou Xibao Trade Co., Ltd., (Guizhou, China) from the ear tissues of 228 Kele pigs. The concentration and purity of genomic DNA were detected by the nucleic acid concentration detector NanoDrop2000 (Thermo Fisher Scientific, Waltham, MA, USA) and checked at 1% agarose gel electrophoresis. Then, we stored the qualified samples at −20 °C.

2.3. Primer Design and Synthesis

The complete gene sequence of porcine METTL23 (NC_010454.4) was searched at the URL NCBI https://www.ncbi.nlm.nih.gov (accessed on 4 May 2024). The primer design excludes the first exon to circumvent non-specific amplification that may arise from its high GC content or sequence complexity, ensuring the precision and reproducibility of the experiment. Four pairs of primer sequences were designed around exon 2, 3, 4, and 5 regions of the METTL23 gene by Permer 5.0 software (listed in Table 1). The primers were synthesized by Bioengineering Co., Ltd. (Shanghai, China).

2.4. PCR Amplification

The PCR amplification system was a 20 μL reaction system, consisting of 10 μL 2 × Taq PCR Master Mix (GenStar, Beijing, China), 7 μL RNase-free H2O, 1 μL each of upstream and downstream primers, and 1 μL 10 μmol/L DNA template. The reaction procedure was set as follows, pre-denaturation at 95 °C for 8 min, denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s with 32 cycles. Final extension was at 72 °C for 8 min, then stored at 4 °C. After PCR amplification, products were detected by 1.5% agarose gel electrophoresis. The amplified products with good specificity were selected and sent to Sangon Biological Engineering Co., Ltd. (Shanghai, China).

2.5. Statistical Analysis

The genotype frequency, allele frequency, and polymorphic information content (PIC) of each site were calculated by using Excel 2020 to count all the mutation sites of the METTL23 gene. The Hardy–Weinberg equilibrium was analyzed by using the chi-square fitness test (χ2). The sequencing results of the METTL23 gene were screened and identified for SNP sites using the MegAlign program in the biological software DNAstar 17.6. The D’ values and R2 values for linkage disequilibrium of the SNP sites, as well as the haplotype frequencies, were calculated using the online SHEsis software http://analysis.bio-x.cn/ (accessed on 29 June 2024), and then the haplotype was used to synthesize the diplotype of each individual sow. IBM SPSS 23.0 (Armonk, NY, USA) was used to analyze the association analysis of METTL23 genotypes as follows:
yijk = μ+ Gi + Pj +Gi × Pj + eijk
where yijk = the phenotyPIC observations, μ = the population mean, Gi = fixed effects of genotypes or diplotypes, Pj = fixed effects of different parity sows, Gi×Pj = interactions between Gi and Pj, and eijk = random error. Data are presented as mean ± standard deviation (SD) and p < 0.05 as the criterion of significance of the differences.

3. Results

3.1. SNPs Identification

Agarose gel electrophoresis of PCR products showed that the amplified bands were clear, and the fragment sizes were consistent with the target fragments (Figure 1). Sequencing results of PCR products were further compared and analyzed. As shown in Figure 2, a total of three SNPs were found in the SNPs of g.4804958 G > T, g.4805082 C > T, and g.4806821 A > G, which existed in all three genotypes. Among them, the SNP g.4804958 G > T was located in intron 2, and the SNP g.4805082 C > T was located in exon 2. The coding amino acid codon had a mutation from CCC to CCT, and the coding amino acids were all proline (P), which was a synonymous mutation. Moreover, the SNP g.4806821 A > G was located in exon 3, the coding amino acid codon had a mutation from TTA to TTG, and the coding amino acids were all leucine (L), also a synonymous mutation.

3.2. Population Genetic Analysis of SNPs

The genetic characterization of the METTL23 gene’s SNPs in Kele pigs is shown in Table 2. The dominant genotypes in the SNPs g.4804958 G > T, g.4805082 C > T, and g.4806821 A > G were GG, CC, and AA, respectively. The corresponding dominant alleles for these genotypes are G, C, and A. The polymorphic information content (PIC) of the three SNPs was 0.264, 0.259, and 0.354, respectively, which were moderately polymorphic (0.25 < PIC < 0.5) and were therefore capable of providing a certain amount of genetic information. The results of the chi-square fitness test showed that the genotype distribution in the SNP g.4805082 C>T of the METTL23 gene was in agreement with the Hardy–Weinberg equilibrium (p > 0.05). The SNPs g.4804958 G > T and g. 4806821 A > G significantly deviate from the Hardy–Weinberg equilibrium (0.01 < p < 0.05).

3.3. Linkage Disequilibrium Analysis of SNPs

Linkage disequilibrium analysis of the three SNPs of the Kele pig METTL23 gene showed that (Table 3) among the three SNPs g.4804958 G > T, g.4805082 C > T, and g.4806821 A > G, none of them satisfy D’ > 0.800 and R2 > 0.330, which indicates that there was no strong linkage disequilibrium effect among the SNPs.

3.4. Haplotype and Diplotype Analysis of SNPs

Haplotype and diplotype analyses were carried out on the three SNPs of the METTL23 gene in Kele pigs (Table 4). The results showed that four haplotypes and ten diplotypes were detected. Haplotype H1 had the highest frequency (0.397), which was the dominant haplotype, and H4 had the lowest frequency (0.169), which was the inferior haplotype. Diplotype H1H2 had the highest frequency (0.202), which was the dominant diplotype, followed by H3H4 (0.105). In addition, H4H4 (0.026) had the lowest frequency, which was the inferior diplotype.

3.5. Association Analysis of SNPs in the METTL23 Gene with Reproductive Traits

By analyzing the parity effect, it was found that parity had no significant effect on the measured reproductive indexes. Further analysis showed that the SNP genotypes had significant differences in reproductive traits (shown in Table 5). The results showed that the number of piglets born alive, litter birth weight, the number of weaned piglets, and weaning litter weight of individuals with the GG genotype in the SNP g.4804958 G > T were significantly higher than those of individuals with the TT genotype (p < 0.05). The SNP g.4805082 C > T had no significant effect on the reproductive traits. The litter birth weight and the average birth weights with GG genotypes were significantly higher than those of AA genotypes (p < 0.05) in the SNPs g.4806821 A > G.
The association analysis between the three SNPs’ haplotypes and reproductive traits is shown in Table 6. The results indicate that the number of piglets born alive, litter birth weight, number of weaned piglets, and weaning litter weight from individuals of haplotype H4H4 (GGCCGG) were significantly higher than those of the other haplotypes (p < 0.05). Individuals of the haplotype H1H3 (GTCTAG) had a significantly higher average birth weight than individuals of the haplotypes H1H1 (TTCCAA), H1H2 (GTCCAA), and H4H4 (GGCCGG) (p < 0.05); and the weaning weight of individuals of haplotypes H4H4 (GGCCGG), H1H2 (GTCCAA), and H1H3 (GTCTAG) were significantly higher than that of H1H4 (GTCCAG), H2H2 (GGCCAA), and H3H3 (GGCTGG) diplotype individuals (p < 0.05). In conclusion, H4H4 was the optimal haplotype affecting reproductive traits in Kele pigs.

3.6. mRNA Secondary Structure Prediction of Different Haplotypes

Two SNPs, g.4805082 C > T in exon 2 and g.4806821 A > G in exon 3, were selected to predict the secondary structure of the METTL23 gene in pigs using the online tool RNAfold http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi (accessed on 30 June 2024). The mRNA secondary structures of each haplotype, predicted before and after gene mutation, correspond to the haplotype analysis presented above (Figure 3). Different parts of the secondary structures of the three mRNAs have been selected and highlighted with circles, and a total of two changes were observed. These observations indicated that the mutations at both loci caused changes in the mRNA secondary structure of the METTL23 gene. As in Figure 3, the SNP g.4805082 C > T caused the change in the blue circle, and the SNP g.4806821 A > G caused the change in the red circle. Haplotypes H1 and H2, corresponding to the genomic information included in NCBI, had a minimum free energy of −2657.24 kJ/mol. Haplotype H3 had a minimum free energy of −2673.41 kJ/mol. Haplotype H4 had a minimum free energy of −2665.33 kJ/mol. The combined changes in the secondary structure of the mRNA of the METTL23 gene, both the SNPs g.4805082 C > T and g.4806821 A > G, change the mRNA secondary structure, and both made the METTL23 gene mRNA structure more stable.

4. Discussion

The reproductive traits of sows directly affect the productivity of pig farms and industrial economic returns. Compared with breeds that have high pig productivity and high lean meat percentages, such as Duroc, Landrace, and Yorkshire, Chinese local specialty breeds are at a disadvantage due to lower fertility, slower growth, and longer breeding cycles. Among the diverse pig breeds native to China, such as the Kele pig, several physiological traits are commonly observed. These include a relatively low litter size, precocious sexual maturity, a suboptimal reproductive rate, a notable tolerance to fibrous feed, adaptability to various stocking conditions, and a decelerated growth rate. It was found that there is a difference in germplasm between the Kele pig and the large white pig. Although the carcass quality of the Kele pig is not as good as that of the large white pig, its meat quality is excellent, with excellent breed characteristics such as strong water retention, juicy muscles, rich flavor [39], etc. These attributes render its meat highly desirable to consumers, underscoring the urgency of enhancing the Kele pig’s breeding traits as a critical issue in the field of porcine genetics.
Wu et al. [40] found that the METTL23 gene interacts with Ten-Eleven Translocation (TET) enzymes as an N6-methyladenosine (m6A)-modifying enzyme in DNA methylation and demethylation modification, proving its potential function in genome homeostasis regulation. Alarcón et al. [41] found that the METTL23 gene (also known as ZCCHC4) plays an important role as an m6A-modifying enzyme in methylation modification of RNA, revealing the interaction between it and HNRNPA2B1, which contributed to the comprehension of its function in RNA processing events in the nucleus. Zhao et al. [42] explored the effects of FTO-mediated m6A demethylation methylation on the regulation of mRNA splicing, and the METTL23 gene, as one of the m6A methyltransferases, was associated with RNA modification and splicing regulation. In light of these findings, this experiment held that methyltransferases might be involved in the methylation modification of RNA or DNA in cells to regulate gene (including reproductive performance-related genes) expression and cell biological processes, thereby affecting the reproductive traits of Kele pigs. In this experiment, the METTL23 gene was selected as a candidate gene for reproductive traits in Kele pigs, the SNPs of this gene were screened and identified by Sanger direct sequencing, and a total of three SNPs were found: g.4804958 G > T (intron 2), g.4805082 C > T (exon 2), and g.4806821 A > G (exon 3). The polymorphism information content (PIC) indicates the degree of population variation. High polymorphism is indicated by a PIC value greater than 0.5, which reflects a high degree of population variation. Moderate polymorphism is denoted by PIC values between 0.25 and 0.5, also indicating a high degree of population variation. Low polymorphism is indicated by a PIC value lower than 0.25, reflecting a low degree of population variation [43]. In this study, the polymorphic information content of the three SNPs varied, but all of them showed moderate polymorphism (0.25 < PIC < 0.5) with a large degree of population variation, indicating a certain amount of genetic information. The χ2 fitness test showed that the genotype distributions of the SNP g.4805082 C > T did not deviate from the Hardy–Weinberg equilibrium; this indicates that this locus has not been affected by mutation, selection, or genetic drift, or has been affected but is in a new equilibrium after long-term artificial selection and large-scale expansion. However, the SNPs g.4804958 G > T and g. 4806821 A > G significantly deviated from the Hardy–Weinberg equilibrium, and this suggested that the locus may be influenced by mutation, selection, and genetic drift. Linkage disequilibrium analysis is important for understanding the association between genes and phenotypes, revealing the genetic structure of human populations, and in the study of genetic diseases and complex traits, according to the basis for the division of linkage disequilibrium in gene seating as reported by Slatkin, Ardlie et al. and Andrade et al. [44,45,46], the SNPs g.4804958 G > T, g.4805082 C > T, and g.4806821 A > G did not have a strong linkage disequilibrium between each other (the conditions D’ > 0.800 and R2 > 0.330 were not satisfied).
In this study, the association analysis of the three SNPs of the METTL23 gene with reproductive traits showed that two SNPs, g.4804958 G > T and g.4806821 A > G, had a significant effect on the reproductive performance of Kele pigs. METTL23 is highly conserved among species and expressed in major organs such as porcine oocytes, testes, and early embryos. The METTL23 gene, a member of the protein arginine methyltransferase family (PRMTs), plays a crucial role in the regulation of early embryonic development and organ formation [47]. Research has demonstrated that the inhibition of protein arginine methyltransferases (PRMTs) in murine embryonic fibroblasts leads to hypo-methylation of glycine-arginine motifs, which in turn triggers spontaneous DNA damage and cell cycle dysregulation. This culminates in chromosomal aneuploidy or polyploidy, ultimately precipitating embryonic demise [48]. The aforementioned studies underscore the pivotal role of protein arginine methyltransferases (PRMTs) in the regulation of reproductive processes. The METTL23 gene is a type of PRMT. It may play an important role in the development of early embryos, tissues, and organs of pigs. In addition, there is a polymorphic site A62G in exon 4 of the METTL23 gene, which is significantly correlated with the number of litters of the Songliao black pig, and it can be used as a genetic marker for the number of litters of the Songliao black pig for molecular breeding. The number of piglets born alive, litter birth weight, the number of weaned piglets, and weaning litter weight in the GG genotype in the SNP g.4804958 G > T were significantly higher than those in the TT genotype (p < 0.05), while the litter birth weight and average birth weight in the GG genotype in the SNP g.4806821 A > G were significantly higher than those in the AA genotype (p < 0.05). Therefore, the GG genotype in the SNP g.4804958 G > T can be used for marker-assisted selection (MAS) to improve the traits of piglets born alive, litter birth weight, and the number of weaned piglets. Diplotype analysis has wide applications in genetics, biomedical, and population genetics studies. It provides an important tool for studying associations between genetic variation and phenotype, disease risk, drug reaction, etc. In addition, diplotype analysis is important for personalized medicine and genetic disease research. The correlation analysis between diplotypes and reproductive performance showed that the five indicators of reproductive data, respectively, piglets born alive, litter birth weight, number of weaned piglets, weaning litter weight, and weaning weight of diplotype H4H4 (GGCCGG) individuals were optimal across the group. In addition, the indicator of average birth weight of diplotype H4H4 (GGCCGG) individuals was above the average value of the group. In conclusion, diplotype H4H4 (GGCCGG) could be used as a marker-assisted selection (MAS) tool in breeding programs. Wan et al. [49] found that mRNA’s secondary structure had a direct impact on its expression, stability, and translation and then affects protein expression. Prediction of the mRNA secondary structure of the METTL23 gene of the Kele pig showed that mutations at the g.4805082 C > T and g.4806821 A > G loci would change the mRNA secondary structure of the METTL23 gene of the Kele pig, and both of them would make its minimum free energy smaller and more stable. The three SNPs are all synonymous mutations which lead to changes in the mRNA secondary structure, resulting in a more stable mRNA secondary structure. A more stable mRNA structure can increase the efficiency of protein translation and synthesis, thereby affecting its reproductive trait. However, the number of sows in this study, 228, is a limited sample size, which may lead to positive effects of SNPs on reproductive traits and thus limit the application of those SNPs. Therefore, we will further increase the sample to further identify these SNPs and discover new SNPs. At the same time, further studies of the biological function of the METTL23 gene through techniques such as gene silencing or overexpression will be carried out in order to lay the foundation for the utilization of the METTL23 gene.

5. Conclusions

In this study, a total of three SNPs were identified on the METLL23 gene of the Kele pig through Sanger sequencing, among which the SNP g.4804958 G > T had a significant effect on the number of piglets born alive, litter birth weight, number of weaned piglets, and weaning litter weight; and the SNP g.4806821 A > G had a significant effect on litter birth weight and average birth weight. The diplotype H4H4 (GGCCGG) had a significant effect on the number of piglets born alive, litter birth weight, number of weaned piglets, weaning litter weight, and weaning weight, indicating it can be used for marker-assisted selection (MAS). The METTL23 gene was able to be a candidate gene for reproductive traits in the Kele pig.

Author Contributions

Conceptualization, Y.Z.; validation, J.S. and C.W.; methodology, J.S. and C.W.; software, J.S.; formal analysis, J.S.; investigation, J.S., C.W. and Y.W.; resources, Y.Z.; data curation, J.S., C.W., Y.W. and J.X.; writing—original draft preparation, J.S.; writing—review and editing, Y.Z.; visualization, J.S.; supervision, Y.Z.; project administration, J.X.; funding acquisition, Y.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was jointly funded by the Guizhou Provincial Science and Technology Plan Project (QKHPTRC [2021]5630), Guizhou Provincial Swine Industry Technology System Construction (GZSZCYJSTX-03), and National Key Research and Development Program (2022YFD1100308-01).

Institutional Review Board Statement

All of the animal studies between September 2022 and January 2024 were conducted in strict compliance with the relevant guidelines established by the Animal Ethics Committee of Guizhou University, China (ethics approval file no. EAE-GZU-2022-P049).

Informed Consent Statement

Not applicable.

Data Availability Statement

The authors affirm that all of the data necessary for confirming the conclusions of this article are present within the article, figures, and tables.

Conflicts of Interest

The authors declare no competing interests.

References

  1. Vigne, J.D. The origins of animal domestication and husbandry: A major change in the history of humanity and the biosphere. Comptes Rendus Biol. 2011, 334, 171–181. [Google Scholar] [CrossRef] [PubMed]
  2. Zeder, M.A. The origins of agriculture in the Near East. Curr. Anthropol. 2011, 52, S221–S235. [Google Scholar] [CrossRef]
  3. Ramos-Onsins, S.E.; Burgos-Paz, W.; Manunza, A.; Amills, M. Mining the pig genome to investigate the domestication process. Heredity 2014, 113, 471–484. [Google Scholar] [CrossRef] [PubMed]
  4. Nonneman, D.J.; Lents, C.A. Functional genomics of reproduction in pigs: Are we there yet? Mol. Reprod. Dev. 2023, 90, 436–444. [Google Scholar] [CrossRef] [PubMed]
  5. Rothschild, M.F.; Messer, L.A.; Vincent, A. Molecular approaches to improved pig fertility. J. Reprod. Fertil. Suppl. 1997, 52, 227–236. [Google Scholar] [CrossRef]
  6. Groenen, M.A.; Archibald, A.L.; Uenishi, H.; Tuggle, C.K.; Takeuchi, Y.; Rothschild, M.F.; Rogel-Gaillard, C.; Park, C.; Milan, D.; Megens, H.-J.; et al. Analyses of pig genomes provide insight into porcine demography and evolution. Nature 2012, 491, 393–398. [Google Scholar] [CrossRef] [PubMed]
  7. Distl, O. Mechanisms of regulation of litter size in pigs on the genome level. Reprod. Domest. Anim. 2007, 42, 10–16. [Google Scholar] [CrossRef]
  8. Hui, Y.T.; Yang, Y.Q.; Liu, R.Y.; Zhang, Y.Y.; Xiang, C.J.; Liu, Z.Z.; Ding, Y.H.; Zhang, Y.L.; Wang, B.R. Significant association of APOA5 and APOC3 gene polymorphisms with meat quality traits in Kele pigs. Genet. Mol. Res. 2013, 12, 3643–3650. [Google Scholar] [CrossRef]
  9. Xie, J.; Li, R.; Li, S.; Ran, X.; Wang, J.; Jiang, J.; Zhao, P. Identification of Copy Number Variations in Xiang and Kele Pigs. PLoS ONE 2016, 11, e0148565. [Google Scholar] [CrossRef]
  10. Liu, J.J.; Ran, X.Q.; Li, S.; Feng, Y.; Wang, J.F. Polymorphism in the first intron of follicle stimulating hormone beta gene in three Chinese pig breeds and two European pig breeds. Anim. Reprod. Sci. 2009, 111, 369–375. [Google Scholar] [CrossRef]
  11. Zhang, C.; Wu, Z.; Hu, G.; Zhang, Y.; Ao, Z. Exploring characteristics of placental transcriptome and cord serum metabolome associated with low birth weight in Kele pigs. Trop. Anim. Health Prod. 2023, 55, 340. [Google Scholar] [CrossRef] [PubMed]
  12. Bedford, M.T. Arginine methylation at a glance. J. Cell Sci. 2007, 120, 4243–4246. [Google Scholar] [CrossRef] [PubMed]
  13. Blanc, R.S.; Richard, S. Arginine Methylation: The Coming of Age. Mol Cell. 2017, 65, 8–24. [Google Scholar] [CrossRef] [PubMed]
  14. Guccione, E.; Richard, S. The regulation, functions and clinical relevance of arginine methylation. Nat. Rev. Mol. Cell Biol. 2019, 20, 642–657, Erratum in Nat. Rev. Mol. Cell Biol. 2019, 20, 567. [Google Scholar] [CrossRef] [PubMed]
  15. Fuhrmann, J.; Clancy, K.W.; Thompson, P.R. Chemical biology of protein arginine modifications in epigenetic regulation. Chem. Rev. 2015, 115, 5413–5461. [Google Scholar] [CrossRef] [PubMed]
  16. Bedford, M.T.; Clarke, S.G. Protein arginine methylation in mammals: Who, what, and why. Mol. Cell. 2009, 33, 1–13. [Google Scholar] [CrossRef] [PubMed]
  17. Wei, H.H.; Fan, X.J.; Hu, Y.; Tian, X.-X.; Guo, M.; Mao, M.-W.; Fang, Z.-Y.; Wu, P.; Gao, S.-X.; Peng, C.; et al. A systematic survey of PRMT interactomes reveals the key roles of arginine methylation in the global control of RNA splicing and translation. Sci. Bull. 2021, 66, 1342–1357. [Google Scholar] [CrossRef] [PubMed]
  18. Pan, Y.; Suga, A.; Kimura, I.; Kimura, C.; Minegishi, Y.; Nakayama, M.; Yoshitake, K.; Iejima, D.; Minematsu, N.; Yamamoto, M.; et al. METTL23 mutation alters histone H3R17 methylation in normal-tension glaucoma. J. Clin. Invest. 2022, 132, e153589. [Google Scholar] [CrossRef]
  19. Almannai, M.; Obaid, O.; Faqeih, E.; Alasmari, A.; Samman, M.M.; Pinz, H.; Braddock, S.R.; Alkuraya, F.S. Further delineation of METTL23-associated intellectual disability. Am. J. Med. Genet. Part A 2020, 182, 785–791. [Google Scholar] [CrossRef] [PubMed]
  20. Bernkopf, M.; Webersinke, G.; Tongsook, C.; Koyani, C.N.; Rafiq, M.A.; Ayaz, M.; Müller, D.; Enzinger, C.; Aslam, M.; Naeem, F.; et al. Disruption of the methyltransferase-like 23 gene METTL23 causes mild autosomal recessive intellectual disability. Hum. Mol. Genet. 2014, 23, 4015–4023. [Google Scholar] [CrossRef]
  21. Khan, A.; Miao, Z.; Umair, M.; Ullah, A.; Alshabeeb, M.A.; Bilal, M.; Ahmad, F.; Rappold, G.A.; Ansar, M.; Carapito, R. Two Cases of Recessive Intellectual Disability Caused by NDST1 and METTL23 Variants. Genes 2020, 11, 1021. [Google Scholar] [CrossRef] [PubMed]
  22. Reiff, R.E.; Ali, B.R.; Baron, B.; Yu, T.W.; Ben-Salem, S.; Coulter, M.E.; Schubert, C.R.; Hill, R.S.; Akawi, N.A.; Al-Younes, B.; et al. METTL23, a transcriptional partner of GABPA, is essential for human cognition. Hum. Mol. Genet. 2014, 23, 3456–3466. [Google Scholar] [CrossRef] [PubMed]
  23. Smaili, W.; Elalaoui, S.C.; Zrhidri, A.; Raymond, L.; Egéa, G.; Taoudi, M.; Mouatassim, S.E.L.; Sefiani, A.; Lyahyai, J. Exome sequencing revealed a novel homozygous METTL23 gene mutation leading to familial mild intellectual disability with dysmorphic features. Eur. J. Med. Genet. 2020, 63, 103951. [Google Scholar] [CrossRef] [PubMed]
  24. Pan, Y.; Iwata, T. Molecular genetics of inherited normal tension glaucoma. Indian J. Ophthalmol. 2024, 72, S335–S344. [Google Scholar] [CrossRef] [PubMed]
  25. Liu, W.W.; Sun, Y. Epigenetics in glaucoma: A link between histone methylation and neurodegeneration. J. Clin. Invest. 2023, 133, e173784. [Google Scholar] [CrossRef] [PubMed]
  26. Ekure, E.N.; Adeyemo, A.; Liu, H.; Sokunbi, O.; Kalu, N.; Martinez, A.F.; Owosela, B.; Tekendo-Ngongang, C.; Addissie, Y.A.; Olusegun-Joseph, A.; et al. Exome Sequencing and Congenital Heart Disease in Sub-Saharan Africa. Circ. Genom. Precis. Med. 2021, 14, e003108. [Google Scholar] [CrossRef] [PubMed]
  27. Hamey, J.J.; Wienert, B.; Quinlan, K.G.R.; Wilkins, M.R. METTL21B Is a Novel Human Lysine Methyltransferase of Translation Elongation Factor 1A: Discovery by CRISPR/Cas9 Knockout. Mol. Cell. Proteom. 2017, 16, 2229–2242. [Google Scholar] [CrossRef] [PubMed]
  28. Hatanaka, Y.; Tsusaka, T.; Shimizu, N.; Morita, K.; Suzuki, T.; Machida, S.; Satoh, M.; Honda, A.; Hirose, M.; Kamimura, S.; et al. Histone H3 Methylated at Arginine 17 Is Essential for Reprogramming the Paternal Genome in Zygotes. Cell Rep. 2017, 20, 2756–2765. [Google Scholar] [CrossRef] [PubMed]
  29. Wang, T.H.; Lee, C.Y.; Lee, T.Y.; Huang, H.D.; Hsu, J.B.; Chang, T.H. Biomarker Identification through Multiomics Data Analysis of Prostate Cancer Prognostication Using a Deep Learning Model and Similarity Network Fusion. Cancers 2021, 13, 2528. [Google Scholar] [CrossRef]
  30. Fabbri, M.C.; Crovetti, A.; Tinacci, L.; Bertelloni, F.; Armani, A.; Mazzei, M.; Fratini, F.; Bozzi, R.; Cecchi, F. Identification of candidate genes associated with bacterial and viral infections in wild boars hunted in Tuscany (Italy). Sci. Rep. 2022, 12, 8145. [Google Scholar] [CrossRef]
  31. Zhao, M.; Zhao, Y.; Yang, Z.; Ming, F.; Li, J.; Kong, D.; Wang, Y.; Chen, P.; Wang, M.; Wang, Z. Metabolic Pathway Engineering Improves Dendrobine Production in Dendrobium catenatum. Int. J. Mol. Sci. 2023, 25, 397. [Google Scholar] [CrossRef] [PubMed]
  32. Uenishi, H.; Eguchi, T.; Suzuki, K.; Sawazaki, T.; Toki, D.; Shinkai, H.; Okumura, N.; Hamasima, N.; Awata, T. PEDE (Pig EST Data Explorer): Construction of a database for ESTs derived from porcine full-length cDNA libraries. Nucleic Acids Res. 2004, 32, D484–D488. [Google Scholar] [CrossRef] [PubMed]
  33. Onishi, A.; Iwamoto, M.; Akita, T.; Mikawa, S.; Takeda, K.; Awata, T.; Hanada, H.; Perry, A.C. Pig cloning by microinjection of fetal fibroblast nuclei. Science 2000, 289, 1188–1190. [Google Scholar] [CrossRef] [PubMed]
  34. Tang, J.; Kao, P.N.; Herschman, H.R. Protein-arginine methyltransferase I, the predominant protein-arginine methyltransferase in cells, interacts with and is regulated by interleukin enhancer-binding factor 3. J. Biol. Chem. 2000, 275, 19866–19876. [Google Scholar] [CrossRef] [PubMed]
  35. Qi, C.; Chang, J.; Zhu, Y.; Yeldandi, A.V.; Rao, S.M.; Zhu, Y.J. Identification of protein arginine methyltransferase 2 as a coactivator for estrogen receptor alpha. J. Biol. Chem. 2002, 277, 28624–28630. [Google Scholar] [CrossRef] [PubMed]
  36. Tee, W.W.; Pardo, M.; Theunissen, T.W.; Yu, L.; Choudhary, J.S.; Hajkova, P.; Surani, M.A. Prmt5 is essential for early mouse development and acts in the cytoplasm to maintain ES cell pluripotency. Genes Dev. 2010, 24, 2772–2777. [Google Scholar] [CrossRef] [PubMed]
  37. Yadav, N.; Lee, J.; Kim, J.; Shen, J.; Hu, M.C.T.; Aldaz, C.M.; Bedford, M.T. Specific protein methylation defects and gene expression perturbations in coactivator-associated arginine methyltransferase 1-deficient mice. Proc. Natl. Acad. Sci. USA 2003, 100, 6464–6468. [Google Scholar] [CrossRef] [PubMed]
  38. Hashimoto, M.; Murata, K.; Ishida, J.; Kanou, A.; Kasuya, Y.; Fukamizu, A. Severe Hypomyelination and Developmental Defects Are Caused in Mice Lacking Protein Arginine Methyltransferase 1 (PRMT1) in the Central Nervous System. J. Biol. Chem. 2016, 291, 2237–2245. [Google Scholar] [CrossRef] [PubMed]
  39. Wu, W.; Zhan, J.; Tang, X.; Li, T.; Duan, S. Characterization and identification of pork flavor compounds and their precursors in Chinese indigenous pig breeds by volatile profiling and multivariate analysis. Food Chem. 2022, 385, 132543. [Google Scholar] [CrossRef]
  40. Wu, X.; Zhang, Y. TET-mediated active DNA demethylation: Mechanism, function and beyond. Nat. Rev. Genet. 2017, 18, 517–534. [Google Scholar] [CrossRef]
  41. Alarcón, C.R.; Goodarzi, H.; Lee, H.; Liu, X.; Tavazoie, S.; Tavazoie, S.F. HNRNPA2B1 Is a Mediator of m(6)A-Dependent Nuclear RNA Processing Events. Cell 2015, 162, 1299–1308. [Google Scholar] [CrossRef] [PubMed]
  42. Zhao, X.; Yang, Y.; Sun, B.F.; Shi, Y.; Yang, X.; Xiao, W.; Hao, Y.-J.; Ping, X.-L.; Chen, Y.-S.; Wang, W.-J.; et al. FTO-dependent demethylation of N6-methyladenosine regulates mRNA splicing and is required for adipogenesis. Cell Res. 2014, 24, 1403–1419. [Google Scholar] [CrossRef] [PubMed]
  43. Serrote, C.M.L.; Reiniger, L.R.S.; Silva, K.B.; Rabaiolli, S.M.D.S.; Stefanel, C.M. Determining the Polymorphism Information Content of a molecular marker. Gene 2020, 726, 144175. [Google Scholar] [CrossRef]
  44. Slatkin, M. Linkage disequilibrium—Understanding the evolutionary past and mapping the medical future. Nat. Rev. Genet. 2008, 9, 477–485. [Google Scholar] [CrossRef]
  45. Ardlie, K.G.; Kruglyak, L.; Seielstad, M. Patterns of linkage disequilibrium in the human genome. Nat. Rev. Genet. 2002, 3, 299–309, Erratum in Nat. Rev. Genet. 2002, 3, 566. [Google Scholar] [CrossRef] [PubMed]
  46. Andrade, A.C.B.; Viana, J.M.S.; Pereira, H.D.; Pinto, V.B.; Silva, F.F. Linkage disequilibrium and haplotype block patterns in popcorn populations. PLoS ONE 2019, 14, e0219417. [Google Scholar] [CrossRef] [PubMed]
  47. Luo, M.; Li, Y.; Guo, H.; Lin, S.; Chen, J.; Ma, Q.; Gu, Y.; Jiang, Z.; Gui, Y. Protein Arginine Methyltransferase 6 Involved in Germ Cell Viability during Spermatogenesis and Down-Regulated by the Androgen Receptor. Int. J. Mol. Sci. 2015, 16, 29467–29481. [Google Scholar] [CrossRef]
  48. Yu, Z.; Chen, T.; Hébert, J.; Li, E.; Richard, S. A mouse PRMT1 null allele defines an essential role for arginine methylation in genome maintenance and cell proliferation. Mol. Cell. Biol. 2009, 29, 2982–2996, Erratum in Mol. Cell. Biol. 2017, 37, e00298-17. [Google Scholar] [CrossRef]
  49. Wan, Y.; Qu, K.; Ouyang, Z.; Kertesz, M.; Li, J.; Tibshirani, R.; Makino, D.L.; Nutter, R.C.; Segal, E.; Chang, H.Y. Genome-wide measurement of RNA folding energies. Mol. Cell 2012, 48, 169–181. [Google Scholar] [CrossRef]
Genes 15 01061 g001
Figure 1. Agarose electrophoresis of PCR products of pig METTL23 gene, M, DL 2000 DNA marker; 1–3, P1 amplification product; 4–6, P2 amplification product; 7–9, P3 amplification product; 10–12, P4 amplification product.
Figure 1. Agarose electrophoresis of PCR products of pig METTL23 gene, M, DL 2000 DNA marker; 1–3, P1 amplification product; 4–6, P2 amplification product; 7–9, P3 amplification product; 10–12, P4 amplification product.
Genes 15 01061 g001
Genes 15 01061 g002
Figure 2. Sequencing alignment results of three SNPs in the METTL23 gene.
Figure 2. Sequencing alignment results of three SNPs in the METTL23 gene.
Genes 15 01061 g002
Genes 15 01061 g003
Figure 3. Comparison of secondary structure of mRNA of three haplotypes of METTL23 genes.
Figure 3. Comparison of secondary structure of mRNA of three haplotypes of METTL23 genes.
Genes 15 01061 g003
Table 1. Primer information used for PCR.
Table 1. Primer information used for PCR.
PrimersPrimer Sequences (5′→3′)Amplified FragmentTm/°C
P1F1TGCTGGGCACTCAGTAATTGTg.4804918~g.4805287
369bp/Exon2		60
R1AGACGCCACCAGTCCTGTTA
P2F2AAGCCATTCACCAAGACCCGg.4806377~g.4806725
348bp/Exon3		60
R2TCCATTGCATCGCTGGCTAA
P3F3TGCCTGGAAATCTGTCAGCGg.4806523~g.4806891
368bp/Exon4		60
R3ACACCAGTAAGGCTTCAGTTGAG
P4F4ACTCAACTGAAGCCTTACTGGTg.4806869~g.4807185
316bp/Exon5		60
R4AGCATTGACGCTGTCCTGAA
Table 2. Population genetic information of three SNPs.
Table 2. Population genetic information of three SNPs.
SNP LociGenotype FrequencyAllele FrequencyPICχ2
g.4804958
G > T		GG (93)
0.408		GT (89)
0.390		TT (46)
0.202		G
0.603		T
0.397		0.3647.774 (0.02)
g.4805082
C > T		CC (150)
0.658		CT (70)
0.307		TT (8)
0.035		C
0.811		T
0.189		0.2590.002 (0.99)
g.4806821
A > G		AA (103)
0.452		AG (87)
0.382		GG (38)
0.167		A
0.642		G
0.357		0.3546.537 (0.03)
PIC is the polymorphic information content, χ2-HWE is the genotype Hardy–Weinberg equilibrium, χ(2)2 − 0.05 = 5.991, and χ(2)2 − 0.01 = 9.210.
Table 3. Linkage disequilibrium analysis of three SNPs.
Table 3. Linkage disequilibrium analysis of three SNPs.
SNP Locig.4804958 G > Tg.4805082 C > Tg.4806821 A > G
g.4804958 G > T-1.0000.513
g.4805082 C > T0.141-1.000
g.4806821 A > G0.1280.290-
Table 4. Analysis of haplotype and diplotype of three SNPs.
Table 4. Analysis of haplotype and diplotype of three SNPs.
SNPsg.4804958 G > Tg.4805082 C > Tg.4806821 A > GFrequency
HaplotypesH1 (181)TCA0.397
H2 (112)GCA0.246
H3 (86)GTG0.189
H4 (77)GCG0.169
DiplotypesH1H1 (46)TTCCAA0.202
H1H2 (38)GTCCAA0.167
H1H3 (26)GTCTAG0.114
H1H4 (25)GTCCAG0.110
H2H2 (19)GGCCAA0.104
H2H3 (20)GGCTAG0.088
H2H4 (16)GGCCAG0.070
H3H3 (8)GGTTGG0.035
H3H4 (24)GGCTGG0.105
H4H4 (6)GGCCGG0.026
Table 5. Association analysis of SNPs in METTL23 gene and reproductive traits in Kele pigs.
Table 5. Association analysis of SNPs in METTL23 gene and reproductive traits in Kele pigs.
SNP LociGenotypePiglets Born AliveLitter Birth Weight/kgAverage Birth Weight/kgNumber of Weaned PigletsWeaning Litter Weight/kgWeaning Weight/kg
g.4804958
G > T		GG (93)9.473 ± 2.224 a9.299 ± 3.154 a1.074 ± 0.2217.484 ± 2.130 a39.459 ± 14.083 a5.257 ± 1.102
GT (89)8.653 ± 2.667 ab8.277 ± 2.614 ab1.070 ± 0.2486.776 ± 2.477 ab38.206 ± 13.462 a5.794 ± 1.310
TT (46)7.568 ± 2.534b6.403 ± 2.736 b1.021 ± 0.2385.405 ± 2.327 b32.360 ± 15.524 b5.808 ± 1.301
g.4805082
C > T		CC (150)8.887 ± 2.5748.375 ± 3.1711.044 ± 0.2436.773 ± 2.42537.941 ± 15.4945.590 ± 1.301
CT (70)8.714 ± 2.5838.489 ± 2.8611.095 ± 0.2216.986 ± 2.47038.016 ± 11.8525.622 ± 1.117
TT (8)8.250 ± 1.9097.806 ± 0.8951.175 ± 0.1656.875 ± 1.80832.363 ± 4.8004.838 ± 0.605
g.4806821
A > G		AA (103)8.659 ± 2.3027.585 ± 2.563 b1.002 ± 0.248 b6.365 ± 2.23035.362 ± 16.1195.475 ± 1.396
AG (87)8.807 ± 2.4178.612 ± 3.085 ab1.082 ± 0.220 ab6.952 ± 2.31638.831 ± 12.4025.689 ± 1.228
GG (38)9.1033 ± 3.0479.223 ± 3.289 a1.125 ± 0.221 a7.367 ± 2.66339.708 ± 13.4155.567 ± 0.976
Different lowercase letters in the same column indicate significant (p < 0.05).
Table 6. Association of three SNPs in the METTL23 gene with reproductive traits in Kele pigs.
Table 6. Association of three SNPs in the METTL23 gene with reproductive traits in Kele pigs.
DiplotypesPiglets Born AliveLitter Birth Weight/kgAverage Birth Weight/kgNumber of Weaned PigletsWeaning Litter Weight/kgWeaning Weight/kg
H1H1 (46)7.643 ± 2.792 c6.271 ± 2.050 d0.984 ± 0.235 b5.750 ± 2.102 c33.221 ± 13.936 c5.638 ± 0.683 ab
H1H2 (38)9.053 ± 1.930 b7.780 ± 2.673 cd0.982 ± 0.258 b6.605 ± 2.531 bc38.170 ± 17.678 bc5.776 ± 1.414 a
H1H3 (26)7.231 ± 2.386 c7.254 ± 2.491 cd1.233 ± 0.182 a5.461 ± 1.330 c34.508 ± 9.192 c6.482 ± 1.812 a
H1H4 (25)8.600 ± 2.769 b8.153 ± 2.424 c1.003 ± 0.157 ab7.120 ± 2.297 b36.588 ± 9.163 bc5.315 ± 0.913 b
H2H2 (19)9.368 ± 1.707 b9.128 ± 2.092 c1.071 ± 0.246 ab6.796 ± 1.584 bc32.900 ± 15.766 c4.632 ± 1.818 c
H2H3 (20)9.200 ± 1.056 b8.707 ± 2.566 c1.033 ± 0.270 ab7.450 ± 1.145 b40.882 ± 7.540 b5.497 ± 0.626 abc
H2H4 (16)10.750 ± 2.145 b11.325 ± 2.702 b1.114 ± 0.210 ab8.750 ± 1.949 ab48.431 ± 12.846 b5.507 ± 0.553 abc
H3H3 (8)8.250 ± 1.909 b7.806 ± 0.895 cd1.175 ± 0.165 ab6.875 ± 1.808 bc31.362 ± 4.800 c4.838 ± 0.605 c
H3H4 (24)8.583 ± 2.430 b8.265 ± 3.447 c1.069 ± 0.173 ab6.875 ± 2.863 bc35.231 ± 14.263 c5.342 ± 0.969 abc
H4H4 (6)12.500 ± 2.739 a12.533 ± 5.352 a0.997 ± 0.249 b9.667 ± 0.817 a57.933 ± 8.364 a5.983 ± 0.591 a
Different lowercase letters in the same column indicate significant (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sun, J.; Wang, C.; Wu, Y.; Xiang, J.; Zhang, Y. Association Analysis of METTL23 Gene Polymorphisms with Reproductive Traits in Kele Pigs. Genes 2024, 15, 1061. https://doi.org/10.3390/genes15081061

AMA Style

Sun J, Wang C, Wu Y, Xiang J, Zhang Y. Association Analysis of METTL23 Gene Polymorphisms with Reproductive Traits in Kele Pigs. Genes. 2024; 15(8):1061. https://doi.org/10.3390/genes15081061

Chicago/Turabian Style

Sun, Jie, Chunyuan Wang, Yan Wu, Jin Xiang, and Yiyu Zhang. 2024. "Association Analysis of METTL23 Gene Polymorphisms with Reproductive Traits in Kele Pigs" Genes 15, no. 8: 1061. https://doi.org/10.3390/genes15081061

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop