Long Noncoding RNAs Responding to Ethanol Stress in Yeast Seem Associated with Protein Synthesis and Membrane Integrity
Abstract
1. Introduction
2. Material and Methods
2.1. Yeast Strains
2.2. Stress Induction, Gene Expression, Western Blot, and Analysis of the Hi-C Database
2.3. Molecular Docking
2.4. Flow Cytometry
3. Results
3.1. Rationale
3.2. Analysis of SEY6210 WT and SEY6210 Transcr_9136∆ Mutant
3.3. Analysis of BY4742 WT and BY4742 Transcr_10027∆ Mutant
4. Total Protein Yield Quantification
5. Discussion
5.1. The Action of LncRNAs on Translation
5.2. Transcr_10027 and PB Formation
5.3. Transcr_9136 Seems to Work on Cell Membrane Integrity
6. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Stanley, D.; Bandara, A.; Fraser, S.; Chambers, P.J.; Stanley, G.A. The Ethanol Stress Response and Ethanol Tolerance of Saccharomyces Cerevisiae. J. Appl. Microbiol. 2010, 109, 13–24. [Google Scholar] [CrossRef]
- Lewis, J.A.; Elkon, I.M.; McGee, M.A.; Higbee, A.J.; Gasch, A.P. Exploiting Natural Variation in Saccharomyces Cerevisiae to Identify Genes for Increased Ethanol Resistance. Genetics 2010, 186, 1197–1205. [Google Scholar] [CrossRef] [PubMed]
- Hiriart, E.; Verdel, A. Long Noncoding RNA-Based Chromatin Control of Germ Cell Differentiation: A Yeast Perspective. Chromosome Res. 2013, 21, 653–663. [Google Scholar] [CrossRef] [PubMed]
- Yamashita, A.; Shichino, Y.; Yamamoto, M. The Long Non-Coding RNA World in Yeasts. Biochim. Et Biophys. Acta Gene Regul. Mech. 2016, 1859, 147–154. [Google Scholar] [CrossRef] [PubMed]
- Parker, S.; Fraczek, M.G.; Wu, J.; Shamsah, S.; Manousaki, A.; Dungrattanalert, K.; de Almeida, R.A.; Invernizzi, E.; Burgis, T.; Omara, W.; et al. Large-Scale Profiling of Noncoding RNA Function in Yeast. PLoS Genet. 2018, 14, e1007253. [Google Scholar] [CrossRef] [PubMed]
- Novačić, A.; Vučenović, I.; Primig, M.; Stuparević, I. Non-Coding RNAs as Cell Wall Regulators in Saccharomyces Cerevisiae. Crit. Rev. Microbiol. 2020, 46, 15–25. [Google Scholar] [CrossRef] [PubMed]
- Senmatsu, S.; Hirota, K. Roles of lncRNA Transcription as a Novel Regulator of Chromosomal Function. Genes Genet. Syst. 2020, 95, 213–223. [Google Scholar] [CrossRef] [PubMed]
- Wolf, I.R.; Marques, L.F.; de Almeida, L.F.; Lázari, L.C.; de Moraes, L.N.; Cardoso, L.H.; Alves, C.C.d.O.; Nakajima, R.T.; Schnepper, A.P.; Golim, M.d.A.; et al. Integrative Analysis of the Ethanol Tolerance of Saccharomyces Cerevisiae. Int. J. Mol. Sci. 2023, 24, 5646. [Google Scholar] [CrossRef]
- Xu, K.; Qin, L.; Bai, W.; Wang, X.; Li, F.; Ren, S.; Gao, X.; Chen, B.; Tong, Y.; Li, J.; et al. Multilevel Defense System (MDS) Relieves Multiple Stresses for Economically Boosting Ethanol Production of Industrial Saccharomyces Cerevisiae. ACS Energy Lett. 2020, 5, 572–582. [Google Scholar] [CrossRef]
- Li, R.; Xiong, G.; Yuan, S.; Wu, Z.; Miao, Y.; Weng, P. Investigating the Underlying Mechanism of Saccharomyces Cerevisiae in Response to Ethanol Stress Employing RNA-Seq Analysis. World J. Microbiol. Biotechnol. 2017, 33, 206. [Google Scholar] [CrossRef]
- Awasthi, A.; Nain, V.; Srikanth, C.V.; Puria, R. A Regulatory Circuit between lncRNA and TOR Directs Amino Acid Uptake in Yeast. Biochim. Et Biophys. Acta—Mol. Cell Res. 2020, 1867, 118680. [Google Scholar] [CrossRef] [PubMed]
- van Werven, F.J.; Neuert, G.; Hendrick, N.; Lardenois, A.; Buratowski, S.; van Oudenaarden, A.; Primig, M.; Amon, A. Transcription of Two Long Noncoding RNAs Mediates Mating-Type Control of Gametogenesis in Budding Yeast. Cell 2012, 150, 1170–1181. [Google Scholar] [CrossRef] [PubMed]
- Balarezo-Cisneros, L.N.; Parker, S.; Fraczek, M.G.; Timouma, S.; Wang, P.; O’Keefe, R.T.; Millar, C.B.; Delneri, D.; OKeefe, R.T.; Millar, C.B.; et al. Functional and Transcriptional Profiling of Non-Coding RNAs in Yeast Reveal Context-Dependent Phenotypes and in Trans Effects on the Protein Regulatory Network. PLoS Genet. 2021, 17, e1008761. [Google Scholar] [CrossRef] [PubMed]
- Galipon, J.; Miki, A.; Oda, A.; Inada, T.; Ohta, K. Stress-Induced lncRNAs Evade Nuclear Degradation and Enter the Translational Machinery. Genes Cells 2013, 18, 353–368. [Google Scholar] [CrossRef]
- Haft, R.J.F.; Keating, D.H.; Schwaegler, T.; Schwalbach, M.S.; Vinokur, J.; Tremaine, M.; Peters, J.M.; Kotlajich, M.V.; Pohlmann, E.L.; Ong, I.M.; et al. Correcting Direct Effects of Ethanol on Translation and Transcription Machinery Confers Ethanol Tolerance in Bacteria. Proc. Natl. Acad. Sci. USA 2014, 111, E2576–E2585. [Google Scholar] [CrossRef] [PubMed]
- Grousl, T.; Vojtova, J.; Hasek, J.; Vomastek, T. Yeast Stress Granules at a Glance. Yeast 2022, 39, 247–261. [Google Scholar] [CrossRef] [PubMed]
- Youn, J.Y.; Dyakov, B.J.A.; Zhang, J.; Knight, J.D.R.; Vernon, R.M.; Forman-Kay, J.D.; Gingras, A.C. Properties of Stress Granule and P-Body Proteomes. Mol. Cell 2019, 76, 286–294. [Google Scholar] [CrossRef] [PubMed]
- Ivanov, P.; Kedersha, N.; Anderson, P. Stress Granules and Processing Bodies in Translational Control. Cold Spring Harb. Perspect. Biol. 2019, 11, a032813. [Google Scholar] [CrossRef]
- Kershaw, C.J.; Nelson, M.G.; Lui, J.; Bates, C.P.; Jennings, M.D.; Hubbard, S.J.; Ashe, M.P.; Grant, C.M. Integrated Multi-Omics Reveals Common Properties Underlying Stress Granule and P-Body Formation. RNA Biol. 2021, 18, 655–673. [Google Scholar] [CrossRef] [PubMed]
- Eulalio, A.; Behm-Ansmant, I.; Izaurralde, E. P Bodies: At the Crossroads of Post-Transcriptional Pathways. Nat. Rev. Mol. Cell Biol. 2007, 8, 9–22. [Google Scholar] [CrossRef]
- Roy, R.; Rajyaguru, P.I. Stress Granules and P-Bodies: An Insight into mRNA Translational Control and Decay. Proc. Indian Natl. Sci. Acad. 2018, 97, 49239. [Google Scholar] [CrossRef]
- Bridges, M.C.; Daulagala, A.C.; Kourtidis, A. LNCcation: LncRNA Localization and Function. J. Cell Biol. 2021, 220, e202009045. [Google Scholar] [CrossRef] [PubMed]
- Pitchiaya, S.; Mourao, M.D.A.; Jalihal, A.P.; Xiao, L.; Jiang, X.; Chinnaiyan, A.M.; Schnell, S.; Walter, N.G. Dynamic Recruitment of Single RNAs to Processing Bodies Depends on RNA Functionality. Mol. Cell 2019, 74, 521–533.e6. [Google Scholar] [CrossRef] [PubMed]
- Namkoong, S.; Ho, A.; Woo, Y.M.; Kwak, H.; Lee, J.H. Systematic Characterization of Stress-Induced RNA Granulation. Mol. Cell 2018, 70, 175–187.e8. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Cao, L.; Thorne, R.F.; Zhang, X.D.; Li, J.; Shao, F.; Zhang, L.; Wu, M. LncRNA GIRGL Drives CAPRIN1-Mediated Phase Separation to Suppress Glutaminase-1 Translation under Glutamine Deprivation. Sci. Adv. 2021, 7, eabe5708. [Google Scholar] [CrossRef]
- Schnepper, A.P.; Marques, L.F.; Wolf, I.R.; Kubo, A.M.S.; Valente, G.T. Potential Global Cis and Trans Regulation of lncRNAs in Saccharomyces Cerevisiae Subjected to Ethanol Stress. Gene 2024, 920, 148521. [Google Scholar] [CrossRef] [PubMed]
- Lázari, L.C.; Wolf, I.R.; Schnepper, A.P.; Valente, G.T. LncRNAs of Saccharomyces Cerevisiae Bypass the Cell Cycle Arrest Imposed by Ethanol Stress. PLoS Comput. Biol. 2022, 18, e1010081. [Google Scholar] [CrossRef]
- Vaudano, E.; Noti, O.; Costantini, A.; Garcia-Moruno, E. Identification of Reference Genes Suitable for Normalization of RT-qPCR Expression Data in Saccharomyces Cerevisiae during Alcoholic Fermentation. Biotechnol. Lett. 2011, 33, 1593–1599. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Bradford, M. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
- Nilsson, D.; Sunnerhagen, P. Cellular Stress Induces Cytoplasmic RNA Granules in Fission Yeast. RNA 2011, 17, 120–133. [Google Scholar] [CrossRef] [PubMed]
- Park, K.; Lee, Y.S.; Jung, D.; Kim, J. Roles of eIF4E-Binding Protein Caf20 in Ste12 Translation and P-Body Formation in Yeast. J. Microbiol. 2018, 56, 744–747. [Google Scholar] [CrossRef] [PubMed]
- Rzeczkowski, K.; Beuerlein, K.; Müller, H.; Dittrich-Breiholz, O.; Schneider, H.; Kettner-Buhrow, D.; Holtmann, H.; Kracht, M. C-Jun N-Terminal Kinase Phosphorylates DCP1a to Control Formation of P Bodies. J. Cell Biol. 2011, 194, 581–596. [Google Scholar] [CrossRef] [PubMed]
- Schalbetter, S.A.; Fudenberg, G.; Baxter, J.; Pollard, K.S.; Neale, M.J. Principles of Meiotic Chromosome Assembly Revealed in S. Cerevisiae. Nat. Commun. 2019, 10, 4795. [Google Scholar] [CrossRef]
- Yan, Y.; Zhang, D.; Zhou, P.; Li, B.; Huang, S.-Y. HDOCK: A Web Server for Protein–Protein and Protein–DNA/RNA Docking Based on a Hybrid Strategy. Nucleic Acids Res. 2017, 45, W365–W373. [Google Scholar] [CrossRef] [PubMed]
- Senmatsu, S.; Asada, R.; Abe, T.; Hoffman, C.S.; Ohta, K.; Hirota, K. lncRNA Transcriptional Initiation Induces Chromatin Remodeling within a Limited Range in the Fission Yeast Fbp1 Promoter. Sci. Rep. 2019, 9, 299. [Google Scholar] [CrossRef] [PubMed]
- Kopp, F.; Mendell, J.T. Functional Classification and Experimental Dissection of Long Noncoding RNAs. Cell 2018, 172, 393–407. [Google Scholar] [CrossRef] [PubMed]
- Tudisca, V.; Recouvreux, V.; Moreno, S.; Boy-Marcotte, E.; Jacquet, M.; Portela, P. Differential Localization to Cytoplasm, Nucleus or P-Bodies of Yeast PKA Subunits under Different Growth Conditions. Eur. J. Cell Biol. 2010, 89, 339–348. [Google Scholar] [CrossRef]
- Buchan, J.R.; Muhlrad, D.; Parker, R. P Bodies Promote Stress Granule Assembly in Saccharomyces Cerevisiae. J. Cell Biol. 2008, 183, 441–455. [Google Scholar] [CrossRef]
- Ferraiuolo, M.A.; Basak, S.; Dostie, J.; Murray, E.L.; Schoenberg, D.R.; Sonenberg, N. A Role for the eIF4E-Binding Protein 4E-T in P-Body Formation and mRNA Decay. J. Cell Biol. 2005, 170, 913–924. [Google Scholar] [CrossRef] [PubMed]
- Nissan, T.; Parker, R. Analyzing P-Bodies in Saccharomyces Cerevisiae. Methods Enzym. 2008, 448, 507–520. [Google Scholar] [CrossRef]
- Higgins, D.A.; Young, M.K.M.; Tremaine, M.; Sardi, M.; Fletcher, J.M.; Agnew, M.; Liu, L.; Dickinson, Q.; Peris, D.; Wrobel, R.L.; et al. Natural Variation in the Multidrug Efflux Pump SGE1 Underlies Ionic Liquid Tolerance in Yeast. Genetics 2018, 210, 219–234. [Google Scholar] [CrossRef]
- Horsey, E.W.; Jakovljevic, J.; Miles, T.D.; Harnpicharnchai, P.; Woolford, J.L. Role of the Yeast Rrp1 Protein in the Dynamics of Pre-Ribosome Maturation. RNA 2004, 10, 813–827. [Google Scholar] [CrossRef] [PubMed]
- Dlakić, M. The Ribosomal Subunit Assembly Line. Genome Biol. 2005, 6, 234. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Yardımcı, G.G.; Ozadam, H.; Sauria, M.E.G.; Ursu, O.; Yan, K.-K.; Yang, T.; Chakraborty, A.; Kaul, A.; Lajoie, B.R.; Song, F.; et al. Measuring the Reproducibility and Quality of Hi-C Data. Genome Biol. 2019, 20, 57. [Google Scholar] [CrossRef] [PubMed]
- Yan, Y.; Tao, H.; He, J.; Huang, S.-Y. The HDOCK Server for Integrated Protein–Protein Docking. Nat. Protoc. 2020, 15, 1829–1852. [Google Scholar] [CrossRef]
- Tkach, J.M.; Yimit, A.; Lee, A.Y.; Riffle, M.; Costanzo, M.; Jaschob, D.; Hendry, J.A.; Ou, J.; Moffat, J.; Boone, C.; et al. Dissecting DNA Damage Response Pathways by Analysing Protein Localization and Abundance Changes during DNA Replication Stress. Nat. Cell Biol. 2012, 14, 966–976. [Google Scholar] [CrossRef]
- Parker, R. RNA Degradation in Saccharomyces Cerevisae. Genetics 2012, 191, 671–702. [Google Scholar] [CrossRef] [PubMed]
- Abramova, N.; Sertil, O.; Mehta, S.; Lowry, C.V. Reciprocal Regulation of Anaerobic and Aerobic Cell Wall Mannoprotein Gene Expression in Saccharomyces Cerevisiae. J. Bacteriol. 2001, 183, 2881–2887. [Google Scholar] [CrossRef]
- Knoll, L.J.; Johnson, D.R.; Gordon, J.I. Biochemical Studies of Three Saccharomyces Cerevisiae Acyl-CoA Synthetases, Faa1p, Faa2p, and Faa3p. J. Biol. Chem. 1994, 269, 16348–16356. [Google Scholar] [CrossRef]
- Udom, N.; Chansongkrow, P.; Charoensawan, V.; Auesukaree, C. Coordination of the Cell Wall Integrity and High-Osmolarity Glycerol Pathways in Response to Ethanol Stress in Saccharomyces Cerevisiae. Appl. Environ. Microbiol. 2019, 85, e00551-19. [Google Scholar] [CrossRef]
- Chi, Z.; Arneborg, N. Relationship between Lipid Composition, Frequency of Ethanol-induced Respiratory Deficient Mutants, and Ethanol Tolerance in Saccharomyces Cerevisiae. J. Appl. Microbiol. 1999, 86, 1047–1052. [Google Scholar] [CrossRef]
- Uemura, H. Synthesis and Production of Unsaturated and Polyunsaturated Fatty Acids in Yeast: Current State and Perspectives. Appl. Microbiol. Biotechnol. 2012, 95, 1–12. [Google Scholar] [CrossRef]
- Anderson, M.J.; Barker, S.L.; Boone, C.; Measday, V. Identification of RCN1 and RSA3 as Ethanol-Tolerant Genes in Saccharomyces Cerevisiae Using a High Copy Barcoded Library. FEMS Yeast Res. 2012, 12, 48–60. [Google Scholar] [CrossRef]
- Fujii, K.; Kitabatake, M.; Sakata, T.; Ohno, M. 40S Subunit Dissociation and Proteasome-Dependent RNA Degradation in Nonfunctional 25S rRNA Decay. EMBO J. 2012, 31, 2579–2589. [Google Scholar] [CrossRef]
- Penzo, M.; Montanaro, L.; Treré, D.; Derenzini, M. The Ribosome Biogenesis—Cancer Connection. Cells 2019, 8, 55. [Google Scholar] [CrossRef] [PubMed]
- Sharma, S.; Hartmann, J.D.; Watzinger, P.; Klepper, A.; Peifer, C.; Kötter, P.; Lafontaine, D.L.J.; Entian, K.-D. A Single N1-Methyladenosine on the Large Ribosomal Subunit rRNA Impacts Locally Its Structure and the Translation of Key Metabolic Enzymes. Sci. Rep. 2018, 8, 11904. [Google Scholar] [CrossRef] [PubMed]
- Peña, C.; Hurt, E.; Panse, V.G. Eukaryotic Ribosome Assembly, Transport and Quality Control. Nat. Struct. Mol. Biol. 2017, 24, 689–699. [Google Scholar] [CrossRef] [PubMed]
- Szajwaj, M.; Wawiórka, L.; Molestak, E.; Michalec-Wawiórka, B.; Mołoń, M.; Wojda, I.; Tchórzewski, M. The Influence of Ricin-Mediated rRNA Depurination on the Translational Machinery in Vivo—New Insight into Ricin Toxicity. Biochim. Et Biophys. Acta (BBA)—Mol. Cell Res. 2019, 1866, 118554. [Google Scholar] [CrossRef] [PubMed]
- Verma, G.; Bowen, A.; Gheibi, S.; Hamilton, A.; Muthukumar, S.; Cataldo, L.R.; Asplund, O.; Esguerra, J.; Karagiannopoulos, A.; Lyons, C.; et al. Ribosomal Biogenesis Regulator DIMT1 Controls β-Cell Protein Synthesis, Mitochondrial Function, and Insulin Secretion. J. Biol. Chem. 2022, 298, 101692. [Google Scholar] [CrossRef]
- Buchan, J.R.; Yoon, J.H.; Parker, R. Stress-Specific Composition, Assembly and Kinetics of Stress Granules in Saccharomyces Cerevisiae. J. Cell Sci. 2011, 124, 228–239. [Google Scholar] [CrossRef]
- Wang, J.; Tan, J.; Qi, Q.; Yang, L.; Wang, Y.; Zhang, C.; Hu, L.; Chen, H.; Fang, X. MiR-487b-3p Suppresses the Proliferation and Differentiation of Myoblasts by Targeting IRS1 in Skeletal Muscle Myogenesis. Int. J. Biol. Sci. 2018, 14, 760–774. [Google Scholar] [CrossRef] [PubMed]
- Jain, S.; Parker, R. The Discovery and Analysis of P Bodies. Adv. Exp. Med. Biol. 2013, 768, 23–43. [Google Scholar] [CrossRef]
- Ramachandran, V.; Shah, K.H.; Herman, P.K. The cAMP-Dependent Protein Kinase Signaling Pathway Is a Key Regulator of P Body Foci Formation. Mol. Cell 2011, 43, 973–981. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Schmich, F.; Srivatsa, S.; Weidner, J.; Beerenwinkel, N.; Spang, A. Context-Dependent Deposition and Regulation of mRNAs in P-Bodies. eLife 2018, 7, e29815. [Google Scholar] [CrossRef] [PubMed]
- van Leeuwen, W.; Rabouille, C. Cellular Stress Leads to the Formation of Membraneless Stress Assemblies in Eukaryotic Cells. Traffic 2019, 20, 623–638. [Google Scholar] [CrossRef] [PubMed]
- Shah, K.H.; Zhang, B.; Ramachandran, V.; Herman, P.K. Processing Body and Stress Granule Assembly Occur by Independent and Differentially Regulated Pathways in Saccharomyces Cerevisiae. Genetics 2013, 193, 109–123. [Google Scholar] [CrossRef] [PubMed]
- Thapa, P.; Shanmugam, N.; Pokrzywa, W. Ubiquitin Signaling Regulates RNA Biogenesis, Processing, and Metabolism. BioEssays 2020, 42, 1900171. [Google Scholar] [CrossRef] [PubMed]
- Romagnoli, A.; D’Agostino, M.; Ardiccioni, C.; Maracci, C.; Motta, S.; La Teana, A.; Di Marino, D. Control of the eIF4E Activity: Structural Insights and Pharmacological Implications. Cell. Mol. Life Sci. 2021, 78, 6869–6885. [Google Scholar] [CrossRef] [PubMed]
- Gregio, A.P.B.; Cano, V.P.S.; Avaca, J.S.; Valentini, S.R.; Zanelli, C.F. eIF5A Has a Function in the Elongation Step of Translation in Yeast. Biochem. Biophys. Res. Commun. 2009, 380, 785–790. [Google Scholar] [CrossRef]
- Cassani, C.; Vertemara, J.; Bassani, M.; Marsella, A.; Tisi, R.; Zampella, G.; Longhese, M.P. The ATP-Bound Conformation of the Mre11–Rad50 Complex Is Essential for Tel1/ATM Activation. Nucleic Acids Res. 2019, 47, 3550–3567. [Google Scholar] [CrossRef] [PubMed]
- Hailemariam, S.; Kumar, S.; Burgers, P.M. Activation of Tel1ATM Kinase Requires Rad50 ATPase and Long Nucleosome-Free DNA but No DNA Ends. J. Biol. Chem. 2019, 294, 10120–10130. [Google Scholar] [CrossRef] [PubMed]
- Nakada, D.; Matsumoto, K.; Sugimoto, K. ATM-Related Tel1 Associates with Double-Strand Breaks through an Xrs2-Dependent Mechanism. Genes Dev. 2003, 17, 1957–1962. [Google Scholar] [CrossRef] [PubMed]
- Mitchell, S.F.; Jain, S.; She, M.; Parker, R. Global Analysis of Yeast mRNPs. Nat. Struct. Mol. Biol. 2013, 20, 127–133. [Google Scholar] [CrossRef] [PubMed]
- Teixeira, D.; Parker, R. Analysis of P-Body Assembly in Saccharomyces Cerevisiae. Mol. Biol. Cell 2007, 18, 2274–2287. [Google Scholar] [CrossRef] [PubMed]
- Lairón-Peris, M.; Routledge, S.J.; Linney, J.A.; Alonso-del-Real, J.; Spickett, C.M.; Pitt, A.R.; Guillamón, J.M.; Barrio, E.; Goddard, A.D.; Querol, A. Lipid Composition Analysis Reveals Mechanisms of Ethanol Tolerance in the Model Yeast Saccharomyces Cerevisiae. Appl. Environ. Microbiol. 2021, 87, e00440-21. [Google Scholar] [CrossRef] [PubMed]




| Strain | Gene; Oligo Name | Sequence (5′–3′) | Tm |
|---|---|---|---|
| SEY6210 | ILT1; ILT1 F | TTATTGCGGCTGATGTTGGC | 60 °C |
| SEY6210 | ILT1; ILT1 R | GCCAAGCACCTAATGAATCG | 60 °C |
| SEY6210 | RRP1; RRP1 F | CGTCCTAGACCTCAGCAACG | 60 °C |
| SEY6210 | RRP1; RRP1 R | GGTCAACTCATCTGCAGTGCTA | 60 °C |
| SEY6210 | 27S; 27S F | AGAAGAGAGCGTCTAGGCGA | 59 °C |
| SEY6210 | 27S; 27S R | CTAAGGCAATCCCGGTTGGT | 59 °C |
| SEY6210 | 25S; 25S F | GTGAAGCGGCAAAAGCTCAA | 59 °C |
| SEY6210 | 25S; 25S R | CACACGGGATTCTCACCCTC | 59 °C |
| SEY6210 | Transcr_9136 F | CGACAGTAAAGTGAGCAAGG | 55 °C |
| SEY6210 | Transcr_9136 R | CAAACGAAGTAAGCGTAGAAAG | 54 °C |
| BY4742 | FAA3; FAA3 F | AAACGGCGGTCTCTTTCACT | 60 °C |
| BY4742 | FAA3; FAA3 R | GTTGTCCCTTGGGAGTCCAT | 60 °C |
| BY4742 | TIR3; TIR3 F | CTCCTCCTCTGCTACCTCCA | 60 °C |
| BY4742 | TIR3; TIR3 R | ACCAACACCAGCGGAGAAG | 60 °C |
| BY4742 | Transcr_10027 F | CGTCAAGAATCGGAAAGCGT | 60 °C |
| BY4742 | Transcr_10027 R | CTTGGTTAGTTTGGGTCGGC | 62 °C |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Schnepper, A.P.; Kubo, A.M.S.; Pinto, C.M.; Gomes, R.H.M.; Fioretto, M.N.; Justulin, L.A.; Braz, A.M.M.; Golim, M.d.A.; Grotto, R.M.T.; Valente, G.T. Long Noncoding RNAs Responding to Ethanol Stress in Yeast Seem Associated with Protein Synthesis and Membrane Integrity. Genes 2025, 16, 170. https://doi.org/10.3390/genes16020170
Schnepper AP, Kubo AMS, Pinto CM, Gomes RHM, Fioretto MN, Justulin LA, Braz AMM, Golim MdA, Grotto RMT, Valente GT. Long Noncoding RNAs Responding to Ethanol Stress in Yeast Seem Associated with Protein Synthesis and Membrane Integrity. Genes. 2025; 16(2):170. https://doi.org/10.3390/genes16020170
Chicago/Turabian StyleSchnepper, Amanda Piveta, Agatha M. S. Kubo, Camila Moreira Pinto, Ramon Hernany Martins Gomes, Matheus Naia Fioretto, Luís Antonio Justulin, Aline M. M. Braz, Marjorie de Assis Golim, Rejane M. T. Grotto, and Guilherme Targino Valente. 2025. "Long Noncoding RNAs Responding to Ethanol Stress in Yeast Seem Associated with Protein Synthesis and Membrane Integrity" Genes 16, no. 2: 170. https://doi.org/10.3390/genes16020170
APA StyleSchnepper, A. P., Kubo, A. M. S., Pinto, C. M., Gomes, R. H. M., Fioretto, M. N., Justulin, L. A., Braz, A. M. M., Golim, M. d. A., Grotto, R. M. T., & Valente, G. T. (2025). Long Noncoding RNAs Responding to Ethanol Stress in Yeast Seem Associated with Protein Synthesis and Membrane Integrity. Genes, 16(2), 170. https://doi.org/10.3390/genes16020170

