The Association Between Promoter Tandem Repeat Polymorphism (pVNTR) and CYP2C9 Gene Expression in Human Liver Samples
Abstract
:1. Introduction
2. Materials and Methods
2.1. Human Liver Samples
2.2. DNA and RNA Extraction
2.3. Genotyping
2.4. Gene Expression Quantification
2.5. Statistical Analysis
3. Results
3.1. Demographics Information of Liver Donors
3.2. The Genotype and Allele Frequencies of pVNTR, CYP2C9*2, CYP2C9*3, CYP2C9*8, and rs12777823
3.3. The Association Between pVNTR-S and CYP2C9 Gene Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gray, I.C.; Nobile, C.; Muresu, R.; Ford, S.; Spurr, N.K. A 2.4-megabase physical map spanning the CYP2C gene cluster on chromosome 10q24. Genomics 1995, 28, 328–332. [Google Scholar] [CrossRef]
- Goldstein, J.A. Clinical relevance of genetic polymorphisms in the human CYP2C subfamily. Br. J. Clin. Pharmacol. 2001, 52, 349–355. [Google Scholar] [CrossRef] [PubMed]
- Johnson, J.A.; Caudle, K.E.; Gong, L.; Whirl-Carrillo, M.; Stein, C.M.; Scott, S.A.; Lee, M.T.; Gage, B.F.; Kimmel, S.E.; Perera, M.A.; et al. Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for Pharmacogenetics-Guided Warfarin Dosing: 2017 Update. Clin. Pharmacol. Ther. 2017, 102, 397–404. [Google Scholar] [CrossRef]
- Wang, D.; Jiang, Z.; Shen, Z.; Wang, H.; Wang, B.; Shou, W.; Zheng, H.; Chu, X.; Shi, J.; Huang, W. Functional evaluation of genetic and environmental regulators of p450 mRNA levels. PLoS ONE 2011, 6, e24900. [Google Scholar] [CrossRef] [PubMed]
- Perera, M.A.; Cavallari, L.H.; Limdi, N.A.; Gamazon, E.R.; Konkashbaev, A.; Daneshjou, R.; Pluzhnikov, A.; Crawford, D.C.; Wang, J.; Liu, N.; et al. Genetic variants associated with warfarin dose in African-American individuals: A genome-wide association study. Lancet 2013, 382, 790–796. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Goldstein, J.A. The transcriptional regulation of the human CYP2C genes. Curr. Drug Metab. 2009, 10, 567–578. [Google Scholar] [CrossRef]
- Collins, J.M.; Wang, D. Co-expression of drug metabolizing cytochrome P450 enzymes and estrogen receptor α (ESR1) in human liver: Racial differences and the regulatory role of ESR1. Drug Metab. Pers. Ther. 2021, 36, 205–214. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Sun, X.; Gong, Y.; Gawronski, B.E.; Langaee, T.Y.; Shahin, M.H.; Khalifa, S.I.; Johnson, J.A. CYP2C9 promoter variable number tandem repeat polymorphism regulates mRNA expression in human livers. Drug Metab. Dispos. 2012, 40, 884–891. [Google Scholar] [CrossRef]
- Dorado, P.; Santos-Diaz, G.; Gutierrez-Martin, Y.; Suarez-Santisteban, M.A. Frequency of CYP2C9 Promoter Variable Number Tandem Repeat Polymorphism in a Spanish Population: Linkage Disequilibrium with CYP2C9*3 Allele. J. Pers. Med. 2022, 12, 782. [Google Scholar] [CrossRef] [PubMed]
- Al-Eitan, L.N.; Almasri, A.Y.; Al-Habahbeh, S.O. Impact of a variable number tandem repeat in the CYP2C9 promoter on warfarin sensitivity and responsiveness in Jordanians with cardiovascular disease. Pharmgenom. Pers. Med. 2019, 12, 15–22. [Google Scholar] [CrossRef]
- Collins, J.M.; Lester, H.; Shabnaz, S.; Wang, D. A frequent CYP2D6 variant promotes skipping of exon 3 and reduces CYP2D6 protein expression in human liver samples. Front. Pharmacol. 2023, 14, 1186540. [Google Scholar] [CrossRef] [PubMed]
- Zanger, U.M.; Schwab, M. Cytochrome P450 enzymes in drug metabolism: Regulation of gene expression, enzyme activities, and impact of genetic variation. Pharmacol. Ther. 2013, 138, 103–141. [Google Scholar] [CrossRef] [PubMed]
- Sherry, S.T.; Ward, M.H.; Kholodov, M.; Baker, J.; Phan, L.; Smigielski, E.M.; Sirotkin, K. dbSNP: The NCBI database of genetic variation. Nucleic Acids Res. 2001, 29, 308–311. [Google Scholar] [CrossRef] [PubMed]
- Rettie, A.E.; Wienkers, L.C.; Gonzalez, F.J.; Trager, W.F.; Korzekwa, K.R. Impaired (S)-warfarin metabolism catalysed by the R144C allelic variant of CYP2C9. Pharmacogenetics 1994, 4, 39–42. [Google Scholar] [CrossRef] [PubMed]
- Sullivan-Klose, T.H.; Ghanayem, B.I.; Bell, D.A.; Zhang, Z.Y.; Kaminsky, L.S.; Shenfield, G.M.; Miners, J.O.; Birkett, D.J.; Goldstein, J.A. The role of the CYP2C9-Leu359 allelic variant in the tolbutamide polymorphism. Pharmacogenetics 1996, 6, 341–349. [Google Scholar] [CrossRef] [PubMed]
- Blaisdell, J.; Jorge-Nebert, L.F.; Coulter, S.; Ferguson, S.S.; Lee, S.J.; Chanas, B.; Xi, T.; Mohrenweiser, H.; Ghanayem, B.; Goldstein, J.A. Discovery of new potentially defective alleles of human CYP2C9. Pharmacogenetics 2004, 14, 527–537. [Google Scholar] [CrossRef]
- Sawaya, S.; Bagshaw, A.; Buschiazzo, E.; Kumar, P.; Chowdhury, S.; Black, M.A.; Gemmell, N. Microsatellite tandem repeats are abundant in human promoters and are associated with regulatory elements. PLoS ONE 2013, 8, e54710. [Google Scholar] [CrossRef] [PubMed]
- Quilez, J.; Guilmatre, A.; Garg, P.; Highnam, G.; Gymrek, M.; Erlich, Y.; Joshi, R.S.; Mittelman, D.; Sharp, A.J. Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans. Nucleic Acids Res. 2016, 44, 3750–3762. [Google Scholar] [CrossRef]
- Chintalaphani, S.R.; Pineda, S.S.; Deveson, I.W.; Kumar, K.R. An update on the neurological short tandem repeat expansion disorders and the emergence of long-read sequencing diagnostics. Acta Neuropathol. Commun. 2021, 9, 98. [Google Scholar] [CrossRef]
- Reisz-Porszasz, S.; Probst, M.R.; Fukunaga, B.N.; Hankinson, O. Identification of functional domains of the aryl hydrocarbon receptor nuclear translocator protein (ARNT). Mol. Cell. Biol. 1994, 14, 6075–6086. [Google Scholar] [CrossRef]
- Semenza, G.L. Regulation of mammalian O2 homeostasis by hypoxia-inducible factor 1. Annu. Rev. Cell Dev. Biol. 1999, 15, 551–578. [Google Scholar] [CrossRef] [PubMed]
- Ema, M.; Taya, S.; Yokotani, N.; Sogawa, K.; Matsuda, Y.; Fujii-Kuriyama, Y. A novel bHLH-PAS factor with close sequence similarity to hypoxia-inducible factor 1alpha regulates the VEGF expression and is potentially involved in lung and vascular development. Proc. Natl. Acad. Sci. USA 1997, 94, 4273–4278. [Google Scholar] [CrossRef] [PubMed]
- Mandl, M.; Lieberum, M.K.; Depping, R. A HIF-1α-driven feed-forward loop augments HIF signalling in Hep3B cells by upregulation of ARNT. Cell Death Dis. 2016, 7, e2284. [Google Scholar] [CrossRef]
- Scott, C.; Cha, K.; Rao, R.; Liddle, C.; George, J.; Gunton, J.E. Hepatocyte-specific deletion of ARNT (aryl hydrocarbon Receptor Nuclear Translocator) results in altered fibrotic gene expression in the thioacetamide model of liver injury. PLoS ONE 2015, 10, e0121650. [Google Scholar] [CrossRef] [PubMed]
PCR Primers | Primer Sequence | PCR Conditions |
---|---|---|
pVNTR | F: FAM-AGGGAACCAGAGAAGAAGGACA R: CCATCTCTGTCTTTTCATCTCATTC | JumpStart 2X PCR Mix. Denature at 95 °C for 3 min, then 40 cycles of [95 °C × 15 s 60 °C × 30 s, 72 °C × 1 min], followed by 72 °C × 10 min. |
CYP2C9*2 & *8 | F: GGTGCTGCATGGATATGAAGCA R: TCAAACCCCCGCTTCACAT | ToughMix 2X PCR Mix. 40 cycles of [98 °C × 10 s, 60 °C × 5 s, 68 °C × 1 s], followed by 68 °C for 3 min. |
CYP2C9*3 | F: ACTTACCCATGCCCCTTTGT R: ACCCGGTGATGGTAGAGGTT | JumpStart 2X PCR Mix. Denatured at 95 °C for 3 min, then 40 cycles of [95 °C × 15 s, 60 °C × 30 s, 72 °C × 1 min], followed by 72 °C for 10 min. |
SNapShot primers | Primer sequence | SNapShot assay condition |
CYP2C9*2 a | GGGAAGAGGAGCATTGAGGAC | SNapShot reagent. 30 cycles of [95 °C × 10 s, 55 °C × 5 s, 60 °C × 30 s]. |
CYP2C9*3 a | GGTGCACGAGGTCCAGAGATAC | |
CYP2C9*8 | TCTCAACTCCTCCACAAGGCAG |
AA and EA | AA | EA | AA vs. EA, p-Value | |
---|---|---|---|---|
Number (n) | 247 | 134 | 113 | |
Age, years, median (range) | 59 (0–97) | 57 (0–97) | 63 (14–83) | 0.0366 a |
Female, n (%) | 125 (51) | 64 (48) | 61 (54) | 0.329 b |
AA and EA, n = 247 | AA, n = 134 | EA, n = 113 | |
---|---|---|---|
pVNTR | |||
Genotype Frequency, n | |||
LL | 3 | 1 | 2 |
ML | 35 | 10 | 25 |
MM | 149 | 73 | 76 |
MS | 50 | 43 | 7 |
SL | 2 | 0 | 2 |
SS | 8 | 7 | 1 |
Allele Frequency | |||
L | 0.09 | 0.04 | 0.14 |
M | 0.78 | 0.74 | 0.81 |
S | 0.14 | 0.21 | 0.05 |
CYP2C9*2 (rs1799853) | |||
Genotype Frequency, n | |||
CC | 204 | 128 | 76 |
CT | 42 | 6 | 36 |
TT | 1 | 0 | 1 |
Allele Frequency | |||
C | 0.91 | 0.98 | 0.83 |
T | 0.09 | 0.02 | 0.17 |
CYP2C9*3 (rs1057910) | |||
Genotype Frequency, n | |||
A A | 236 | 131 | 105 |
A C | 11 | 3 | 8 |
Allele Frequency | |||
A | 0.98 | 0.99 | 0.96 |
C | 0.02 | 0.01 | 0.04 |
CYP2C8*8 (rs7900194) | |||
Genotype Frequency, n | |||
C C | 239 | 126 | 113 |
C T | 8 | 8 | 0 |
Allele Frequency | |||
C | 0.98 | 0.97 | 1.00 |
T | 0.02 | 0.03 | 0.00 |
rs12777823 | |||
Genotype Frequency | |||
G G | 153 | 68 | 85 |
G A | 94 | 66 | 28 |
Allele Frequency | |||
G | 0.81 | 0.75 | 0.88 |
A | 0.19 | 0.25 | 0.12 |
AA, D’(r2) | ||||
CYP2C9*2 | CYP2C9*3 | CYP2C9*8 | rs12777823 | |
pVNTR-S | 0.19 (0.0002) | 0.99 (0.05) | 0.11 (0.001) | 0.53 (0.22) |
CYP2C9*2 | 1 (1) | 0.78 (0.0002) | 0.09 (0.007) | 0.41(0.001) |
CYP2C9*3 | 1(1) | 0.83 (0.0002) | 0.98 (0.004) | |
CYP2C9*8 | 1 (1) | 0.99 (0.091) | ||
EA, D’(r2) | ||||
CYP2C9*2 | CYP2C9*3 | CYP2C9*8 | rs12777823 | |
pVNTR-S | 0.99 (0.009) | 0.99 (0.79) | N.D. | 0.24 (0.02) |
CYP2C9*2 | 1 (1) | 0.98 (0.007) | N.D. | 0.99 (0.02) |
CYP2C9*3 | 1 (1) | N.D. | 0.06 (0.001) | |
CYP2C9*8 | N.D. | N.D. |
AA + EA | AA Only | EA Only | ||||
---|---|---|---|---|---|---|
Estimate ± SE (95% CI) | p Value | Estimate ± SE (95% CI) | p Value | Estimate ± SE (95% CI) | p Value | |
Without TFs | ||||||
pVNTR-S | −0.18 ± 0.08 (−0.35~−0.02) | 0.032 | −0.23 ± 0.10 (−0.44~−0.02) | 0.028 | 0.11 ± 0.14 (−0.17~0.39) | 0.450 |
CYP2C9*2 | −0.14 ± 0.11 (−0.36~0.07) | 0.185 | 0.08 ± 0.30 (−0.67~0.51) | 0.782 | −0.18 ± 0.09 (−0.36~0.01) | 0.063 |
CYP2C9*3 | −0.10 ± 0.19 (−0.49~0.28) | 0.587 | −0.68 ± 0.41 (−1.51~0.13) | 0.103 | 0.04 ± 0.18 (−0.31~0.41) | 0.799 |
CYP2C9*8 | −0.02 ± 0.23 (−0.48~0.44) | 0.931 | −0.02 ± 0.26 (−0.49~0.55) | 0.917 | N.D. | N.D. |
rs12777823 | 0.02 ± 0.08 (−0.15~0.19) | 0.786 | 0.03 ± 0.12 (−0.20~0.28) | 0.751 | 0.05 ± 0.11 (−0.15~0.27) | 0.602 |
With TFs | ||||||
pVNTR-S | −0.18 ± 0.05 (−0.28~−0.07) | 0.0007 | −0.22 ± 0.07 (−0.36~−0.08) | 0.002 | 0.02 ± 0.09 (−0.15~0.20) | 0.805 |
CYP2C9*2 | −0.03 ± 0.07 (−0.07~0.11) | 0.677 | −0.16 ± 0.20 (−0.56~0.24) | 0.431 | −0.02 ± 0.06 (−0.13~0.10) | 0.762 |
CYP2C9*3 | 0.006 ± 0.12 (−0.24~0.25) | 0.962 | −0.02± 0.29 (−0.59~0.54) | 0.923 | −0.03 ± 0.11 (−0.26~0.19) | 0.750 |
CYP2C9*8 | −0.25 ± 0.15 (−0.55~0.05) | 0.299 | −0.25 ± 0.18 (−0.61~0.10) | 0.169 | N.D. | N.D. |
rs12777823 | −0.05 ± 0.05 (−0.17~0.05) | 0.299 | −0.10 ± 0.08 (−0.26~0.06) | 0.234 | 0.04 ± 0.06 (−0.09~0.17) | 0.536 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Montalvo, A.D.; Gong, Y.; Collins, J.M.; Wang, D. The Association Between Promoter Tandem Repeat Polymorphism (pVNTR) and CYP2C9 Gene Expression in Human Liver Samples. Genes 2025, 16, 213. https://doi.org/10.3390/genes16020213
Montalvo AD, Gong Y, Collins JM, Wang D. The Association Between Promoter Tandem Repeat Polymorphism (pVNTR) and CYP2C9 Gene Expression in Human Liver Samples. Genes. 2025; 16(2):213. https://doi.org/10.3390/genes16020213
Chicago/Turabian StyleMontalvo, Abelardo D., Yan Gong, Joseph M. Collins, and Danxin Wang. 2025. "The Association Between Promoter Tandem Repeat Polymorphism (pVNTR) and CYP2C9 Gene Expression in Human Liver Samples" Genes 16, no. 2: 213. https://doi.org/10.3390/genes16020213
APA StyleMontalvo, A. D., Gong, Y., Collins, J. M., & Wang, D. (2025). The Association Between Promoter Tandem Repeat Polymorphism (pVNTR) and CYP2C9 Gene Expression in Human Liver Samples. Genes, 16(2), 213. https://doi.org/10.3390/genes16020213