A New Function of the DRD1 Gene: GnRH Secretion Regulation in Sheep Hypothalamic Neurons
Abstract
:1. Introduction
2. Materials and Methods
2.1. Samples
Ethics Statement
2.2. Primer Design for RT-qPCR and mRNA Expression Analysis
2.3. Immunohistochemical Determination of the Distribution of the DRD1 Protein
2.4. Design and Screening of siRNA DRD1 Interference Fragments
2.5. Constructing the Overexpression Vector pEGFP-C2-DRD1
2.6. Transfection of Plasmids into Hypothalamic Neurons
2.7. qRT-PCR Detection of the Impact of DRD1 on Genes Involved in Oestrus-Related Pathways
2.8. DRD1 Protein Expression Using a Cellular Immunofluorescence Assay
2.9. Measurement of GnRH Release
2.10. Statistical Analysis
3. Results
3.1. DRD1 Expression in the Kazakh Ewe Hypothalamic–Pituitary–Ovarian Gonadal Axis
3.2. Immunohistochemistry of the Hypothalamus, Pituitary, and Ovaries
3.3. Isolation, Culture, and Identification of Primary Hypothalamic Neurons
3.4. Construction and Validation of Recombinant Plasmids
3.5. Analysis of DRD1 mRNA Expression in Sheep Hypothalamic Neurons
3.6. Analysis of DRD1 Protein Expression
3.7. Recombinant Plasmid Transfection into Sheep Hypothalamic Neurons
3.8. Effect of DRD1 on GnRH Secretion
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Almeya:, A.; Milnerbc, T.A.; Brakea, W.G. Estrogen receptors in the central nervous system and their implication for dopamine-dependent cognition in females. Horm. Behav. 2015, 74, 125–138. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Li, S.J.; Li, C.; Feng, Y.P.; Peng, X.L.; Gong, Y.Z. Molecular cloning, expression profile, polymorphism and the genetic effects of the dopamine D1 receptor gene on duck reproductive traits. Mol. Biol. Rep. 2012, 39, 9239–9246. [Google Scholar] [CrossRef] [PubMed]
- Bai, Y.; Zhang, Y.; Chen, X.; Li, J.; Zhang, X.; He, Q.; Yang, H. Polymorphism and bioinformatics analysis of DRD1 gene in Congjiang pigs. J. Agric. Biotechnol. 2017, 36, 570–574. [Google Scholar]
- Chaiseha, Y.; Youngren, O.; Al-Zailaie, K.; El Halawani, M. Expression of D1 and D2 dopamine receptors in the hypothalamus and pituitary during the turkey reproductive cycle: Colocalization with vasoactive intestinal peptide. Neuroendocrinology 2003, 77, 105–118. [Google Scholar] [CrossRef]
- Sartsoongnoen, N.; Kosonsiriluk, S.; Prakobsaeng, N.; Songserm, T.; Rozenboim, I.; Halawani, M.E.; Chaiseha, Y. The dopaminergic system in the brain of the native Thai chicken, Gallus domesticus: Localization and differential expression across the reproductive cycle. Gen. Comp. Endocrinol. 2008, 159, 107–115. [Google Scholar] [CrossRef]
- Hall, T.R.; Chadwick, A. Dopaminergic inhibition of prolactin release from pituitary glands of the domestic fowl incubated in vitro. J. Endocrinol. 1984, 103, 63–69. [Google Scholar] [CrossRef]
- Millam, J.R.; Burke, W.H.; El Halawani, M.E.; Ogren, L.A. Preventing broodiness in turkey hens with a dopamine receptor blocking agent. Poultry Science. 1980, 59, 1126–1131. [Google Scholar] [CrossRef]
- Zhang, B.; Wei, S.G.; Fan, Q.R.; Li, W.H.; Li, S.B. Analysis and Identification of Reproductive Patterns of DRD1 Gene Knockout Mice. J. Domest. Anim. Ecol. 2015, 12–15. [Google Scholar]
- Zhai, M.J. Screening, Validation and Micro-Evolution Analysis of Seasonal Estrus Related Genes in Sheep Using miRNA-mRNA Library. Ph.D. Thesis, Shihezi University, Shihezi, China, 2019. [Google Scholar]
- Maha, O.H. Simplified protocol modification of TRIzol method for Extraction of high-quality RNA yield from RNase-rich rat pancreas. Process Biochem. 2023, 130, 464–471. [Google Scholar]
- Zhai, M.; Zhao, Z.; Yang, M.; Liang, Y.; Liang, H.; Xie, Y.; Han, J. The effect of GNAQ methylation on GnRH secretion in sheep hypothalamic neurons. J. Cell. Biochem. 2019, 120, 19396–19405. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Vandesompele, J.; Preter, K.D.; Pattyn, F.; Poppe, B.; Roy, N.V.; Paepe, A.D.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, 7. [Google Scholar] [CrossRef] [PubMed]
- Jiang, P.; Xia, L.; Jin, Z.; Ali, S.; Wang, M.; Li, X.; Yang, R.; Fang, X.; Zhao, Z. New function of the CD44 gene: Lipid metabolism regulation in bovine mammary epithelial cells. J. Dairy Sci. 2020, 103, 6661–6671. [Google Scholar] [CrossRef] [PubMed]
- Irvine, C.H.G. The Nonpregnant Mare: A Review of Some Current Research and of the Last 25 Years of Endocrinology. Biol. Reprod. 1995, 52, 343–360. [Google Scholar] [CrossRef]
- Wang, D.; Li, N.; Tian, L.; Ren, F.; Li, Z.; Chen, Y.; Liu, L.; Hu, X.; Zhang, X.; Song, Y.; et al. Dynamic expressions of hypothalamic genes regulate seasonal breeding in a natural rodent population. Mol. Ecol. 2019, 28, 3508–3522. [Google Scholar] [CrossRef]
- Li, Z.; Guo, R.; Gu, Z.; Wang, X.; Wang, Y.; Xu, H.; Wang, C.; Liu, X. Identification of a promoter element mediating kisspeptin-induced increases in GnRH gene expression in sheep. Gene 2019, 699, 1–7. [Google Scholar] [CrossRef]
- Stojanovic, T.; Orlova, M.; Sialana, F.J.; Höger, H.; Stuchlik, S.; Milenkovic, I.; Aradska, J.; Lubec, G. Validation of dopamine receptor DRD1 and DRD2 antibodies using receptor deficient mice. Amino Acids 2017, 49, 1101–1109. [Google Scholar] [CrossRef]
- Golden, S.A.; Jin, M.; Heins, C.; Venniro, M.; Michaelides, M.; Shaham, Y. Nucleus accumbens Drd1-expressing neurons control aggression self-administration and aggression seeking in mice. J. Neurosci. 2019, 39, 2482–2496. [Google Scholar] [CrossRef]
- Hare, B.D.; Shinohara, R.; Liu, R.J.; Pothula, S.; DiLeone, R.J.; Duman, R.S. Optogenetic stimulation of medial prefrontal cortex Drd1 neurons produces rapid and long-lasting antidepressant effects. Nat. Commun. 2019, 10, 233. [Google Scholar] [CrossRef]
- Tempfli, K.; Konrád, S.; Gaál, K.K.; Pongrácz, L.; Papp, Á.B. Prolactin, dopamine receptor D1 and Spot14α polymorphisms affect production traits of Hungarian Yellow hens. Livest. Sci. 2015, 174, 26–30. [Google Scholar] [CrossRef]
- Xu, H.; Shen, X.; Zhou, M.; Fang, M.; Zeng, H.; Nie, Q.; Zhang, X. The genetic effects of the dopamine D1 receptor gene on chicken egg production and broodiness traits. BMC Genet. 2010, 11, 17. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Zhao, Z.S.; Chen, J.B. Identification and analysis of microRNAs-mRNAs pairs associated with nutritional status in seasonal sheep. Biochem. Biophys. Res. Commun. 2018, 499, 321–327. [Google Scholar] [CrossRef] [PubMed]
- Zhu, M.; Zhang, H.; Yang, H.; Zhao, Z.; Blair, H.T.; Liang, H.; Wu, P.; Yu, Q. Targeting GNAQ in hypothalamic nerve cells to regulate seasonal estrus in sheep. Theriogenology 2022, 181, 79–88. [Google Scholar] [CrossRef] [PubMed]
- Fulton, S.; Alquier, T. Lipid signalling in the mesolimbic dopamine pathway. Neuropsychopharmacology 2018, 44, 221–222. [Google Scholar] [CrossRef]
- Wise, R.; Robble, M. Dopamine and Addiction. Annu. Rev. Psychol. 2020, 71, 79. [Google Scholar] [CrossRef]
- Schmid, S.G.; Malle, M.G.; Claus, J.C. The dopamine transporter antiports potassium to increase the uptake of dopamine. Nat. Commun. 2022, 13, 1–12. [Google Scholar] [CrossRef]
- Liu, X.X.; Liu, J.W. Biosensors and sensors for dopamine detection. View 2021, 2, 20200102. [Google Scholar] [CrossRef]
- Rangasamy, S.B.; Dasarathi, S.; Pahan, P.; Jana, M.; Pahan, K. Low-Dose Aspirin Upregulates Tyrosine Hydroxylase and Increases Dopamine Production in Dopaminergic Neurons: Implications for Parkinson’s Disease. J. Neuroimmune Pharmacol. 2019, 14, 173–187. [Google Scholar] [CrossRef]
- Fink, G.; Smith, G.C.; McMasster, R.; Osborne, L.W.; Chiappa, S.A. The catecholamine-containing tubero-infundibular system and the control of luteinizing hormone release in the rabbit. Brain Res. 1975, 89, 71–80. [Google Scholar] [CrossRef]
- Papka, R.E.; Cotton, J.P.; Traurig, H.H. Comparative distribution of neuropeptide tyrosine-, vasoactive intestinal polypeptide-, substance P-immunoreactive, acetylcholinesterase-positive and noradrenergic nerves in the reproductive tract of the female rat. Cell Tissue Res. 1985, 242, 475–490. [Google Scholar] [CrossRef]
- Whitehead, S.A.; Lacey, M. Protein tyrosine kinase activity of lavendustin A and the phytoestrogen genistein on progesterone synthesis in cultured rat ovarian cells. Fertil. Steril. 2000, 73, 613–619. [Google Scholar] [CrossRef] [PubMed]
- Bernard, V.; Bouilly, J.; Kramer, P.; Carré, N.; Schlumberger, M.; Visser, J.A.; Young, J.; Binart, N. The Tyrosine Kinase Inhibitor Sunitinib Affects Ovulation but Not Ovarian Reserve in Mouse: A Preclinical Study. PLoS ONE 2016, 11, e0152872. [Google Scholar] [CrossRef] [PubMed]
- Roby, K.F.; Son, D.S.; Taylor, C.C.; Montgomery-Rice, V.; Kirchoff, J.; Tang, S.; Terranova, P.F. Alterations in reproductive function in Src tyrosine kinase knockout mice. Endocrine 2005, 26, 169–176. [Google Scholar] [CrossRef] [PubMed]
- Nan, Y.; Zhai M.J., Z.; Zhu, M.T.; Wang, M.Y.; Shao, Y.Y.; Zhao, Z.S. Effects of different levels of tyrosine on GnRH secretion from sheep hypothalamic neurons. Chin. J. Anim. Sci. 2021, 7, 151–154. [Google Scholar]
Primer Name | Primer Sequence (5′–3′) | Tm/°C | Length (bp) |
---|---|---|---|
DRD1 (ENSOARG00020020572) | TCGCCCAGAAACAAATACGG AGAAAGGGAGCCAGCAACAC | 54 | 207 |
β-actin (ENSOARG00020008714) | AGAGCAAGAGAGGCATCC TCGTTGTAGAAGGTGTGGT | 50–68 | 108 |
siRNA | siRNA Sequence (5′-3′) |
---|---|
siRNA-DRD1-1 | GCAUUCUCACAGCCUGUUUTT AAACAGGCUGUGAGAAUGCTT |
siRNA-DRD1-2 | CCGCUACAGGUAACGGAAATT UUUCCGUUACCUGUAGCGGTT |
siRNA-DRD1-3 | GGGCUAAUUCCUCCUUGAATT UUCAAGGAGGAAUUAGCCCTT |
Primer Name | Primer Sequence (5′–3′) | Size/bp | Tm/°C |
---|---|---|---|
TUBA4A (NC_019468.2) | GAGGATGCCGCTAACAAC CAGTGAGGTGAAGCCAGAG | 168 | 55 |
Noggin (NM_001163055.2) | TGCCGAGCGAGATCAAAGC CAGGTCGTTCCACGCATACAG | 146 | 59 |
Primer Name | Primer Sequence (5′–3′) | Tm/°C | Length (bp) |
---|---|---|---|
DRD1 (ENSOARG00020020572) | TCGCCCAGAAACAAATACGG AGAAAGGGAGCCAGCAACAC | 54 | 207 |
GnAQ (ENSOARG00020004509) | GAGAACCGAATGGAGGAAAG GAAATAGTCAACTAGGTGGGAAT | 54 | 144 |
ITPR1 (ENSOARG00020012519) | GTCCGCCACCAGTTCAA CCTCTGCTGCTAAATAATGC | 54 | 134 |
PLCB1 (ENSOARG00020023836) | TTTTCCGAATTTGGTGC GGCGAGGCTGTTGTTAG | 54 | 171 |
PRKCB (ENSOARG00020025105) | GATCGAACTACACGGAACG TAGAGGCTCAGTGGTAAAGAAT | 54 | 203 |
β-actin [13] (ENSOARG00020008714) | AGAGCAAGAGAGGCATCC TCGTTGTAGAAGGTGTGGT | 50-68 | 108 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhai, M.; Cao, S.; Liang, H.; Xie, Y.; Zhao, Z. A New Function of the DRD1 Gene: GnRH Secretion Regulation in Sheep Hypothalamic Neurons. Genes 2025, 16, 273. https://doi.org/10.3390/genes16030273
Zhai M, Cao S, Liang H, Xie Y, Zhao Z. A New Function of the DRD1 Gene: GnRH Secretion Regulation in Sheep Hypothalamic Neurons. Genes. 2025; 16(3):273. https://doi.org/10.3390/genes16030273
Chicago/Turabian StyleZhai, Manjun, Shaoqi Cao, Huihui Liang, Yifan Xie, and Zongsheng Zhao. 2025. "A New Function of the DRD1 Gene: GnRH Secretion Regulation in Sheep Hypothalamic Neurons" Genes 16, no. 3: 273. https://doi.org/10.3390/genes16030273
APA StyleZhai, M., Cao, S., Liang, H., Xie, Y., & Zhao, Z. (2025). A New Function of the DRD1 Gene: GnRH Secretion Regulation in Sheep Hypothalamic Neurons. Genes, 16(3), 273. https://doi.org/10.3390/genes16030273