Mesenchymal Stem Cell-Conditioned Medium Modulates Apoptotic and Stress-Related Gene Expression, Ameliorates Maturation and Allows for the Development of Immature Human Oocytes after Artificial Activation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Design
2.2. Oocyte Collection
2.3. Vitrification
2.4. Thawing
2.5. In Vitro Maturation Media
2.6. MSC Isolation and Culture
2.7. Artificial Oocyte Activation
2.8. Scoring of Parthenote Embryos
2.9. RNA Extraction and cDNA Synthesis
2.10. qRT-PCR
2.11. Statistical Analysis
3. Results
Oocyte Maturation after IVM
4. Discussion
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Ferreira, E.M.; Vireque, A.A.; Adona, P.R.; Ferriani, R.A.; Navarro, P.A. Prematuration of bovine oocytes with butyrolactone I reversibly arrests meiosis without increasing meiotic abnormalities after in vitro maturation. Eur. J. Obstet. Gynecol. Reprod. Biol. 2009, 145, 76–80. [Google Scholar] [CrossRef] [PubMed]
- Chian, R.; Tan, S. Maturational and developmental competence of cumulus-free immature human oocytes derived from stimulated and intracytoplasmic sperm injection cycles. Reprod. Biomed. Online 2002, 5, 125–132. [Google Scholar] [CrossRef]
- Al-Hasani, S.; Ozmen, B.; Koutlaki, N.; Schoepper, B.; Diedrich, K.; Schultze-Mosgau, A. Three years of routine vitrification of human zygotes: Is it still fair to advocate slow-rate freezing? Reprod. Biomed. Online 2007, 14, 288–293. [Google Scholar] [CrossRef]
- Coticchio, G.; Bonu, M.; Borini, A.; Flamigni, C. Oocyte cryopreservation: A biological perspective. Eur. J. Obstet. Gynecol. Reprod. Biol. 2004, 115, S2–S7. [Google Scholar] [CrossRef] [PubMed]
- Somfai, T.; Ozawa, M.; Noguchi, J.; Kaneko, H.; Karja, N.W.K.; Farhudin, M.; Dinnyés, A.; Nagai, T.; Kikuchi, K. Developmental competence of in vitro-fertilized porcine oocytes after in vitro maturation and solid surface vitrification: Effect of cryopreservation on oocyte antioxidative system and cell cycle stage. Cryobiology 2007, 55, 115–126. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Jia, G.-H.; Lu, X.-L.; Zhang, G.; Tian, K.-Y.; Li, J.-T.; Zhang, J.-M. In vitro maturation of oocytes is not a risk factor for adult metabolic syndrome of mouse offspring. Eur. J. Obstet. Gynecol. Reprod. Biol. 2014, 174, 96–99. [Google Scholar] [CrossRef] [PubMed]
- Eppig, J.J.; O’Brien, M.J.; Pendola, F.L.; Watanabe, S. Factors affecting the developmental competence of mouse oocytes grown in vitro: Follicle-stimulating hormone and insulin. Biol. Reprod. 1998, 59, 1445–1453. [Google Scholar] [CrossRef] [PubMed]
- Sutton, M.; Gilchrist, R.; Thompson, J. Effects of in-vivo and in-vitro environments on the metabolism of the cumulus–oocyte complex and its influence on oocyte developmental capacity. Hum. Reprod. Update 2003, 9, 35–48. [Google Scholar] [CrossRef] [PubMed]
- Rougier, N.; Werb, Z. Minireview: Parthenogenesis in mammals. Mol. Reprod. Dev. 2001, 59, 468–474. [Google Scholar] [CrossRef] [PubMed]
- Prapas, Y.; Petousis, S.; Panagiotidis, Y.; Gullo, G.; Kasapi, L.; Papadeothodorou, A.; Prapas, N. Injection of embryo culture supernatant to the endometrial cavity does not affect outcomes in IVF/ICSI or oocyte donation cycles: A randomized clinical trial. Eur. J. Obstet. Gynecol. Reprod. Biol. 2012, 162, 169–173. [Google Scholar] [CrossRef] [PubMed]
- Lange-Consiglio, A.; Perrini, C.; Esposti, P.; Cremonesi, F. improvement of in vitro canine oocyte maturation by oviductal secretome. Reprod. Fertil. Dev. 2017, 29, 202–203. [Google Scholar] [CrossRef]
- Dong, L.; Hao, H.; Liu, J.; Ti, D.; Tong, C.; Hou, Q.; Li, M.; Zheng, J.; Liu, G.; Fu, X. A Conditioned medium of umbilical cord mesenchymal stem cells overexpressing Wnt7a promotes wound repair and regeneration of hair follicles in mice. Stem Cells Int. 2017, 2017, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Aggarwal, S.; Pittenger, M.F. Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood 2005, 105, 1815–1822. [Google Scholar] [CrossRef] [PubMed]
- Ma, W.; Zhang, D.; Hou, Y.; Li, Y.-H.; Sun, Q.-Y.; Sun, X.-F.; Wang, W.-H. Reduced expression of MAD2, BCL2, and MAP kinase activity in pig oocytes after in vitro aging are associated with defects in sister chromatid segregation during meiosis II and embryo fragmentation after activation 1. Biol. Reprod. 2005, 72, 373–383. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Sun, Q.-Y. Evaluation of oocyte quality: Morphological, cellular and molecular predictors. Reprod. Fertil. Dev. 2006, 19, 1–12. [Google Scholar] [CrossRef]
- Rao, B.S.; Mahesh, Y.U.; Charan, K.V.; Suman, K.; Sekhar, N.; Shivaji, S. Effect of vitrification on meiotic maturation and expression of genes in immature goat cumulus oocyte complexes. Cryobiology 2012, 64, 176–184. [Google Scholar] [CrossRef] [PubMed]
- Pechenino, A.S.; Brown, T.R. Superoxide dismutase in the prostate lobes of aging Brown Norway rats. Prostate 2006, 66, 522–535. [Google Scholar] [CrossRef] [PubMed]
- Eggert-Kruse, W.; Neuer, A.; Clussmann, C.; Boit, R.; Geissler, W.; Rohr, G.; Strowitzki, T. Seminal antibodies to human 60kD heat shock protein (HSP 60) in male partners of subfertile couples. Hum. Reprod. 2002, 17, 726–735. [Google Scholar] [CrossRef] [PubMed]
- Lim, J.-H.; Park, S.-Y.; Yoon, S.-H.; Yang, S.-H.; Chian, R.-C. Combination of natural cycle IVF with IVM as infertility treatment. In In-Vitro Maturation of Human Oocytes: Basic Science to Clinical Application; Informa Healthcare Press: London, UK, 2007; pp. 353–360. [Google Scholar]
- Cao, Y.-X.; Chian, R.-C. Fertility preservation with immature and in vitro matured oocytes. Semin. Reprod. Med. 2009, 27, 456–464. [Google Scholar] [CrossRef] [PubMed]
- Mota, G.B.; e Silva, I.O.; de Souza, D.K.; Tuany, F.; Pereira, M.M.; Camargo, L.S.; e Silva, A.A. Insulin influences developmental competence of bovine oocytes cultured in α-MEM plus follicle-simulating hormone. Zygote 2015, 23, 563–572. [Google Scholar] [CrossRef] [PubMed]
- Parekkadan, B.; Van Poll, D.; Suganuma, K.; Carter, E.A.; Berthiaume, F.; Tilles, A.W.; Yarmush, M.L. Mesenchymal stem cell-derived molecules reverse fulminant hepatic failure. PLoS ONE 2007, 2, e941. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Salehinejad, P.; Alitheen, N.B.; Ali, A.M.; Omar, A.R.; Moshrefi, M.; Motamedi, B.; Nematollahi-Mahani, S.N. Neural differentiation of human umbilical cord matrix-derived mesenchymal cells under special culture conditions. Cytotechnology 2015, 67, 449–460. [Google Scholar] [CrossRef] [PubMed]
- Ling, B.; Feng, D.; Zhou, Y.; Gao, T.; Wei, H.; Tian, Z. Effect of conditioned medium of mesenchymal stem cells on the in vitro maturation and subsequent development of mouse oocyte. Braz. J. Med. Biol. Res. 2008, 41, 978–985. [Google Scholar] [CrossRef] [PubMed]
- De Fried, E.P.; Ross, P.; Zang, G.; Divita, A.; Cunniff, K.; Denaday, F.; Salamone, D.; Kiessling, A.; Cibelli, J. Human parthenogenetic blastocysts derived from noninseminated cryopreserved human oocytes. Fertil. Steril. 2008, 89, 943–947. [Google Scholar] [CrossRef] [PubMed]
- Nasr-Esfahani, M.H.; Salehi, M.; Razavi, S.; Mardani, M.; Bahramian, H.; Steger, K.; Oreizi, F. Effect of protamine-2 deficiency on ICSI outcome. Reprod. Biomed. Online 2004, 9, 652–658. [Google Scholar] [CrossRef]
- Zuccotti, M.; Boiani, M.; Ponce, R.; Guizzardi, S.; Scandroglio, R.; Garagna, S.; Redi, C.A. Mouse Xist expression begins at zygotic genome activation and is timed by a zygotic clock. Mol. Reprod. Dev. 2002, 61, 14–20. [Google Scholar] [CrossRef] [PubMed]
- Devreker, F.; Englert, Y. In vitro development and metabolism of the human embryo up to the blastocyst stage. Eur. J. Obstet. Gynecol. Reprod. Biol. 2000, 92, 51–56. [Google Scholar] [CrossRef]
- Wei, J.-H.; Yuan, X.-Y.; Zhang, J.-M.; Wei, J.-Q. Caspase activity and oxidative stress of granulosa cells are associated with the viability and developmental potential of vitrified immature oocytes. Eur. J. Obstet. Gynecol. Reprod. Biol. 2016, 198, 22–26. [Google Scholar] [CrossRef] [PubMed]
- Ros, G.; Buschiazzo, J.; Mucci, N.; Kaiser, G.; Cesari, A.; Alberio, R. Combined epidermal growth factor and hyaluronic acid supplementation of in vitro maturation medium and its impact on bovine oocyte proteome and competence. Theriogenology 2015, 83, 874–880. [Google Scholar] [CrossRef] [PubMed]
- Shahedi, A.; Hosseini, A.; Khalili, M.A.; Norouzian, M.; Salehi, M.; Piriaei, A.; Nottola, S.A. The effect of vitrification on ultrastructure of human in vitro matured germinal vesicle oocytes. Eur. J. Obstet. Gynecol. Reprod. Biol. 2013, 167, 69–75. [Google Scholar] [CrossRef] [PubMed]
- Trounson, A.; Wood, C.; Kausche, A. In vitro maturation and the fertilization and developmental competence of oocytes recovered from untreated polycystic ovarian patients. Fertil. Steril. 1994, 62, 353–362. [Google Scholar] [CrossRef]
- Cobo, A.; Kuwayama, M.; Pérez, S.; Ruiz, A.; Pellicer, A.; Remohí, J. Comparison of concomitant outcome achieved with fresh and cryopreserved donor oocytes vitrified by the Cryotop method. Fertil. Steril. 2008, 89, 1657–1664. [Google Scholar] [CrossRef] [PubMed]
- Chung, H.M.; Hong, S.W.; Lim, J.M.; Lee, S.H.; Cha, W.T.; Ko, J.J.; Han, S.Y.; Choi, D.H.; Cha, K.Y. In vitro blastocyst formation of human oocytes obtained from unstimulated and stimulated cycles after vitrification at various maturational stages. Fertil. Steril. 2000, 73, 545–551. [Google Scholar] [CrossRef]
- Peters, V.M.; Spray, D.C.; Mendez-Otero, R. Effect of mesenchymal stem cells and mouse embryonic fibroblasts on the development of preimplantation mouse embryos. In Vitro Cell. Dev. Biol. Anim. 2016, 52, 497–506. [Google Scholar]
- Acton, B.; Jurisicova, A.; Jurisica, I.; Casper, R. Alterations in mitochondrial membrane potential during preimplantation stages of mouse and human embryo development. Mol. Hum. Reprod. 2004, 10, 23–32. [Google Scholar] [CrossRef] [PubMed]
- Magli, M.C.; Gianaroli, L.; Ferraretti, A.P.; Lappi, M.; Ruberti, A.; Farfalli, V. Embryo morphology and development are dependent on the chromosomal complement. Fertil. Steril. 2007, 87, 534–541. [Google Scholar] [CrossRef] [PubMed]
- Yang, M.Y.; Rajamahendran, R. Expression of Bcl-2 and Bax proteins in relation to quality of bovine oocytes and embryos produced in vitro. Anim. Reprod. Sci. 2002, 70, 159–169. [Google Scholar] [CrossRef]
- Zhang, G.-M.; Gu, C.-H.; Zhang, Y.-L.; Sun, H.-Y.; Qian, W.-P.; Zhou, Z.-R.; Wan, Y.-J.; Jia, R.-X.; Wang, L.-Z.; Wang, F. Age-associated changes in gene expression of goat oocytes. Theriogenology 2013, 80, 328–336. [Google Scholar] [CrossRef] [PubMed]
- Leon, J.; Acuña-Castroviejo, D.; Escames, G.; Tan, D.X.; Reiter, R.J. Melatonin mitigates mitochondrial malfunction. J. Pineal Res. 2005, 38, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Tatemoto, H.; Muto, N.; Sunagawa, I.; Shinjo, A.; Nakada, T. Protection of porcine oocytes against cell damage caused by oxidative stress during in vitro maturation: Role of superoxide dismutase activity in porcine follicular fluid. Biol. Reprod. 2004, 71, 1150–1157. [Google Scholar] [CrossRef] [PubMed]
- Dong, Z.; Wolfer, D.P.; Lipp, H.-P.; Büeler, H. Hsp70 gene transfer by adeno-associated virus inhibits MPTP-induced nigrostriatal degeneration in the mouse model of Parkinson disease. Mol. Ther. 2005, 11, 80–88. [Google Scholar] [CrossRef] [PubMed]
- Boonkusol, D.; Gal, A.B.; Bodo, S.; Gorhony, B.; Kitiyanant, Y.; Dinnyes, A. Gene expression profiles and in vitro development following vitrification of pronuclear and 8-cell stage mouse embryos. Mol. Reprod. Dev. 2006, 73, 700–708. [Google Scholar] [CrossRef] [PubMed]
- Succu, S.; Bebbere, D.; Bogliolo, L.; Ariu, F.; Fois, S.; Leoni, G.G.; Berlinguer, F.; Naitana, S.; Ledda, S. Vitrification of in vitro matured ovine oocytes affects in vitro pre-implantation development and mRNA abundance. Mol. Reprod. Dev. 2008, 75, 538–546. [Google Scholar] [CrossRef] [PubMed]
- Molina, I.; Gómez, J.; Balasch, S.; Pellicer, N.; Novella-Maestre, E. Osmotic-shock produced by vitrification solutions improves immature human oocytes in vitro maturation. Reprod. Biol. Endocrinol. 2016, 14, 27. [Google Scholar] [CrossRef] [PubMed]
- Cummins, J. The role of mitochondria in the establishment of oocyte functional competence. Eur. J. Obstet. Gynecol. Reprod. Biol. 2004, 115, S23–S29. [Google Scholar] [CrossRef] [PubMed]
- Mavrides, A.; Morroll, D. Bypassing the effect of zona pellucida changes on embryo formation following cryopreservation of bovine oocytes. Eur. J. Obstet. Gynecol. Reprod. Biol. 2005, 118, 66–70. [Google Scholar] [CrossRef] [PubMed]
Type of IVM | Number of IVM GV Oocyte | Arrest in GV Stage n (%) | Arrest in GVBD Stage n (%) | Number of MII Oocyte | Oocyte Maturation Rate |
---|---|---|---|---|---|
fIVMα-MEM | 62 | 7 (11.29%) | 10 (15.74%) | 45 | 72.58% |
vIVMα-MEM | 63 | 15 (23.8%) | 3 (4.76%) | 45 | 71.42% |
fIVMhUCM | 54 | 7 (12.96%) | 1 (1.85%) | 46 | 85.18% |
vIVMhUCM | 53 | 4 (7.54%) | 7 (13.2%) | 42 | 79.24% |
p value | 0.439 | 0.534 | 0.036 | 0.091 | 0.000 |
Developmental Parameter | Group (1) fIVM in α-MEM | Group (2) vIVM in α-MEM | Group (3) fIVM in MSCs | Group (4) vIVMinMSCs | p Value |
---|---|---|---|---|---|
MII oocyte (n) | 45 | 45 | 46 | 42 | 0.091 |
Total activated oocyte (n) | 25 | 25 | 22 | 25 | 0.453 |
Degenerated of activated oocyte (n) | 6 | 11 | 2 | 3 | 0.163 |
2 Pronuclei (n) | 19 | 14 | 20 | 22 | 0.059 |
Arrest in 2–4 cell (n) | 12 | 11 | 5 | 19 | 0.063 |
Score A (2–4) | 7 | 5 | 4 | 11 | 0.243 |
Score B (2–4) | 3 | 4 | 1 | 6 | 0.238 |
Score C (2–4) | 2 | 2 | - | 2 | 0.584 |
Arrest in 4–8 cell (n) | 6 | 3 | 11 | 2 | 0.044 |
Score A (4–8) | 3 | - | 7 | 2 | 0.007 |
Score B (4–8) | 3 | 2 | 3 | - | 0.352 |
Score C (4–8) | - | 1 | 1 | - | 0.551 |
Arrest in 16 cell (n) | 1 | - | 3 | 1 | 0.357 |
Blastocyst (n) | - | - | 1 | - | 0.266 |
IVM Groups | Activated Oocyte | Degenerated Oocyte after Activation | 2–4 Cell * Formation | 4–8 Cell ** Formation | 16 Cell ** Formation | Blastocyst ** Formation |
---|---|---|---|---|---|---|
fIVMα-MEM | 25 | 6 (24%) | 19 (76%) | 7 (36.8%) | 1 (5.26%) | - |
vIVMα-MEM | 25 | 11 (44%) | 14 (56%) | 3 (21.42%) | - | - |
fIVM MSCs | 22 | 2 (9.09) | 20 (90.9%) | 15 (75%) | 4 (20%) | 1 (5%) |
vIVM MSCs | 25 | 3 (12%) | 22 (88%) | 3 (13.63%) | 1 (4.54%) | - |
Gene Name | Primer Sequence (5′–3′ Orientation) | Product Size (bp) | Gene Bank Accession No. |
---|---|---|---|
Bax | Forward: TGGACAGTAACATGGAGC | 143 | NM_001291429 |
Reverse: TGGCAAAGTAGAAAAGGG | |||
Bcl2 | Forward: TGGCCTTCTTTGAGTTCG | 108 | NM_000633 |
Reverse: TGCCGGTTCAGGTACTCAG | |||
Hsp70 | Forward: TCGTGGAGGAGTTCAAGAG | 172 | NM_005345 |
Reverse: GGTGATGGACGTGTAGAAG | |||
SOD1 | Forward: AAAGATGGTGTGGCCGATGT | 164 | NM_000454 |
Reverse: AGCCAAACGACTTCCAGCG | |||
GAPDH | Forward: GAAGGTGAAGGTCGGAGTC | 221 | NM_001289746 |
Reverse: AAGATGGTGATGGGATTTC |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Akbari, H.; Eftekhar Vaghefi, S.H.; Shahedi, A.; Habibzadeh, V.; Mirshekari, T.R.; Ganjizadegan, A.; Mollaei, H.; Ahmadi, M.; Nematollahi-Mahani, S.N. Mesenchymal Stem Cell-Conditioned Medium Modulates Apoptotic and Stress-Related Gene Expression, Ameliorates Maturation and Allows for the Development of Immature Human Oocytes after Artificial Activation. Genes 2017, 8, 371. https://doi.org/10.3390/genes8120371
Akbari H, Eftekhar Vaghefi SH, Shahedi A, Habibzadeh V, Mirshekari TR, Ganjizadegan A, Mollaei H, Ahmadi M, Nematollahi-Mahani SN. Mesenchymal Stem Cell-Conditioned Medium Modulates Apoptotic and Stress-Related Gene Expression, Ameliorates Maturation and Allows for the Development of Immature Human Oocytes after Artificial Activation. Genes. 2017; 8(12):371. https://doi.org/10.3390/genes8120371
Chicago/Turabian StyleAkbari, Hakimeh, Seyed Hassan Eftekhar Vaghefi, Abbas Shahedi, Victoria Habibzadeh, Tooraj Reza Mirshekari, Aboozar Ganjizadegan, Hamidreza Mollaei, Meysam Ahmadi, and Seyed Noureddin Nematollahi-Mahani. 2017. "Mesenchymal Stem Cell-Conditioned Medium Modulates Apoptotic and Stress-Related Gene Expression, Ameliorates Maturation and Allows for the Development of Immature Human Oocytes after Artificial Activation" Genes 8, no. 12: 371. https://doi.org/10.3390/genes8120371