Mineral Composition and Photochemical Reactivity of Suspended Particulate Matters in the Euphotic Zones of China’s Nearshore and Estuarine Regions

Abstract

In the estuary and nearshore environments, suspended particulate matter (SPM) plays a particularly important role. This article presents a study on the suspended particulate matter and microbial communities in the euphotic zone of China’s nearshore and estuarine regions. The study used various analytical techniques, including ICP-OES, SR-XRD, confocal Raman microscopy, ESEM, and EDX, to investigate the spatial distribution and elemental and mineral compositions of the suspended particulate matters. The study found that semiconducting minerals, such as iron oxide, sulfide minerals (hematite, goethite, and pyrrhotite), and titanium oxide minerals (rutile and anatase), were widely present in the suspended particulate matter. This discovery highlights the photochemical activity of suspended particulate matter in the euphotic zone. Furthermore, a correlation analysis of microbial communities revealed that the content of suspended particulate matter was positively correlated with denitrifying bacteria and metal-reducing bacteria in seawater. This study provides valuable insight into the ecosystem dynamics and biogeochemical cycling of estuaries and coastal seas, which are critical for sustaining the biodiversity and productivity of these ecosystems.

1. Introduction

The euphotic zone is a critical part of the oceanic ecosystem. It traditionally referring to the depth at which 1% of the surface photosynthetically active radiation (λ = 400–700 nm) is retained. This definition was proposed by Ryther, who implied that no significant photosynthesis could take place below this depth [1]. The critical depth, as defined by Sverdrup [2], is also often used to describe the euphotic zone when the surface ocean is vertically mixed. However, this analysis applies mainly to spring biomass increases in the North Atlantic, including zooplankton feeding and sinking losses. More recently, Marra et al. [3] found that the bottom of the euphotic layer was consistently deeper than the conventionally assumed “1% light depth”.

Estuaries and coastal seas are crucial ecosystems with high levels of biodiversity and productivity. The physical, chemical, and biological conditions in these environments are highly variable, which leads to uncertainty in the production, consumption, and transformation of organic matter. A substantial amount of organic matter from the land and sea mixes in the estuary area, making estuarine carbon cycles an important research topic in the study of oceanic carbon budgets and global carbon cycling [4]. As a critical component of these ecosystems, suspended particulate matter, consisting of mineral particles and other organic matter suspended in water, plays a significant role in the storage, transport, and recovery of chemical elements in the marine environment [5]. The resuspension, deposition, and generation of particulate matter [6], along with their high reactivity, make them crucial in estuaries and near-seas [5,7]. Compared to terrestrial mineral particles, marine suspended particles exhibit unique characteristics, such as small particle sizes ranging between 1–10 μm, which are challenging to observe in-depth using ordinary optical microscopes and necessitate modern precision instruments for research. The mineral structures of marine suspended particles are often flawed, resulting in unstable chemical composition and incomplete form. Additionally, sampling marine suspended particulate matter poses difficulties, requiring complex pretreatment due to their small sample volume. As a result, accurately identifying and characterizing marine suspended particulate matter is challenging. Consequently, most international research focuses on the biogeochemistry of suspended particulate matter, with limited research specifically on marine suspended particulate matter minerals.

Marine suspended particulate matter comprises biological, rock, mineral, and organic debris, with the main sources being terrestrial and biogenic; it is also authigenic in seawater and can be found in the resuspension of seabed surface sediments [8]. The main components of terrigenous materials are quartz, mica, potassium feldspar, plagioclase, and clay minerals, including montmorillonite, chlorite, illite, and kaolinite, with some from aeolian processes [9].The research on suspended particulate matter in coastal and estuarine areas has been concentrated in the 1980–2010s, with the main focus on the elemental composition of suspended particles, the sources of the elements comprising the particles, and the distribution characteristics of organic matter in the particles. Many studies have mentioned the presence of iron, manganese, and titanium elements in suspended particles, but these have not been thoroughly investigated. Sun et al. [8] found that minerals such as hematite and ilmenite were present in suspended matter in the East Pacific and Southwest Indian Ocean. However, the semiconducting properties of these minerals produced under sunlight stimulation have long been overlooked. Most of the iron–titanium oxides and sulfide minerals in suspended particles have semiconducting properties, and can undergo mineral photocatalytic processes under sunlight stimulation [10]. The band gap widths of iron oxide minerals are between 2.0–2.5 eV, while those of manganese oxide minerals are between 1.0–1.8 eV, both of which have good visible light response capabilities [10]. In nature, the visible light wavelength range is 80–780 nm, accounting for 45%–50% of the solar spectrum. Iron oxide and manganese oxide minerals can produce highly reactive hole-electron pairs under sunlight stimulation, promoting redox reactions.

This study focuses on the systematic collection and characterization of suspended particulate matter samples from the euphotic zone of China’s nearshore and estuarine regions. This research involves investigating their spatial distribution and their elemental and mineral compositions, with particular attention paid to the contents and components of semiconducting minerals. Furthermore, this study evaluates the photoelectrochemical properties of suspended particulate matter through the preparation of mineral electrodes. In addition, the study sequences the microbial communities in the euphotic zone of seawater to explore the regulatory effect of suspended particulate matter on microbial community composition.

2. Materials and Methods

2.1. Sampling

During the Open Cruises of Chinese Offshore Oceanography Research, conducted by the Institute of Oceanology, Chinese Academy of Sciences (IOCAS) in November 2018 and November 2019, seawater salinity data were collected in the Yellow Sea using a SBE911 CTD (conductivity, temperature, and depth) sonde, and 4 or 5 seawater samples were collected between the near-surface water layer (2 m below the surface) and the near-bottom water layer (3 m above the seabed). A total of 89 suspended particle samples were obtained during a series of cruises between November and December of 2018 and 2019 in the Yellow Sea, respectively, and 17 suspended particle samples were collected in the Yangtze Estuary during the November–December 2019 cruise. Eleven suspended particle samples were collected in the Hangzhou Bay and Pearl River Estuary in November 2018 (Figure 1).

2.2. Mineralogical Characterization of SPM

Seawater samples were filtered onboard through filter membranes with a mesh diameter of 0.45 μm, washed with distilled water for 3 times, dried at 60 °C, and then weighed with an electronic analytical balance. The concentration of suspended particulate matters was calculated from the final sediment weight and the filtered water volumes.

The suspended mineral particles in the marine environment were analyzed using SR-XRD patterns collected by the beamline BL14B1 of Shanghai Synchrotron Radiation Facility (SSRF) at a wavelength of 0.6887  Å, and the semiquantitative contents were calculated using the method suggested by Mao et al. [9]. Inductively coupled plasma optical emission spectroscopy (ICP-OES, iCAP7200 DUO) was employed to measure the element concentrations in each sample. The samples were digested with a mixture of hydrofluoric acid and nitric acid, then heated on a hot plate prior to ICP-OES analysis. The results of ICP-OES were corrected by the Yttrium internal standard (IS) to improve the accuracy and precision (RSD < 0.3%). Confocal Raman microscopy (Renishaw inVia Reflex, Wotton-under-Edge, Gloucestershire, UK) was used to measure the Fe and Ti mineral samples, equipped with a 532  nm laser with 10% laser intensity and a 50× objective. The scanning range was 100~1340 cm⁻¹, with 1 cm⁻¹ of spectral resolution. The micro-morphologies of the suspended particulate matters were observed by an environmental scanning electron microscope (ESEM) (Quanta EFG 450, FEI Company, Hillsboro, OR, USA). The ESEM was operated at an accelerating voltage of 15 kV.

2.3. Photoelectrochemical Characterization of SPM

The mineral electrode, on fluorine-doped tin oxide (FTO), was prepared by mixing 0.01 g of accurately weighed suspended mineral powder with 0.5 mL anhydrous ethanol and 15 μL 5% Nafion solution (Dupont, Wilmington, DE. USA) to prevent shedding. The mixture was added dropwise onto the conductive side of the FTO electrode, with an effective area of 1.0  cm × 1.0  cm, and irradiated under the infrared lamp for 5 min. Hematite, rutile, and anatase electrodes were also made in the same way. The FTO electrode was cleaned with acetone, anhydrous ethanol, and deionized water separately for 30 min before use.

An electrochemical three-electrode system, consisting of a mineral electrode for the working electrode, a 213-type platinum electrode (1.0  cm × 1.0  cm) for the auxiliary electrode, and a 232-type saturated calomel electrode (SCE) for the reference electrode, was used. The circular light and dark conditions were achieved by an external LED with a working wavelength from 400 to 700  nm, and the light illumination intensity was 110  mW·cm⁻² in the backlighting method, as measured by the FGH-1 photosynthetic radiometer (Beijing Normal University Photoelectric Instrument Factory, Beijing, China). Linear sweep voltammetry (LSV) was performed in 0.1  M Na₂SO₄ within a potential range from 0.5 to 1.2  V at a scan rate of 5  mV s⁻¹. The photocurrent–time response of the mineral electrodes was determined by an electrochemical workstation (CHI 760E, Shanghai Chenhua Instrument, Shanghai, China) at a constant potential of 1.2 V within 540 s at an interval of 0.1 s.

2.4. DNA Extraction and Sequencing

Seawater DNA was extracted using the PowerSoil DNA Isolation Kit (MoBio Laboratories, Carlsbad, CA, USA), following the manual. The purity and quality of the genomic DNA were checked on 1% agarose gels and a NanoDrop spectrophotometer (Thermo Scientific, Waltham, MA, USA). The V3-4 hypervariable region of the bacterial 16S rRNA gene was amplified with the primers 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) [11]. For each soil sample, an 8-digit barcode sequence was added to the 5′ end of the forward and reverse primers (provided by Allwegene Company, Beijing, China). The PCR was carried out on a Mastercycler Gradient (Eppendorf, Hamburg, Germany) using 25 μL reaction volumes containing 12.5 μL KAPA 2G Robust Hot Start Ready Mix, 1 µL forward primer (5 µM), 1 µL reverse primer (5 µM), 5 µL DNA (total template quantity: 30 ng), and 5.5 µL H₂O. Cycling parameters were 95 °C for 5 min, followed by 28 cycles of 95 °C for 45 s, 55 °C for 50 s, and 72 °C for 45 s, with a final extension at 72 °C for 10 min. The PCR products were purified using a Agencourt AMPure XP Kit. Deep sequencing was performed on the Miseq platform at Allwegene Company (Beijing, China). After the run, image analysis, base calling, and error estimation were performed using the Illumina Analysis Pipeline, version 2.6.

The raw data were initially screened, and sequences were removed from consideration if they were shorter than 230 bp, had a low quality score (≤20), contained ambiguous bases, or did not exactly match the primer sequences and barcode tags. Qualified reads were separated using the sample-specific barcode sequences and trimmed with the Illumina Analysis Pipeline, version 2.6. Then, the dataset was analyzed using QIIME 2. All sequences were submitted to NCBI under SRA Accession No. PRJNA953440. The sequences were clustered into operational taxonomic units (OTUs) at a similarity level of 97% [12] to generate rarefaction curves and to calculate the richness and diversity indices. The SILVA Classifier tool was used to classify all sequences into different taxonomic groups. To examine the similarity between different samples, clustering analyses and PCA were used based on the OTU information from each sample using R [13]. The evolution distances between microbial communities from each sample were calculated using the Bray–Curtis algorithms.

3. Results

3.1. Spatial Distribution of SPM

The spatial distribution of suspended particulate matter (SPM) in the South Yellow Sea–Yangtze River Estuary–Hangzhou Bay area is presented in Figure 2. The Yangtze River Estuary exhibited higher SPM content compared to other areas, owing to the substantial terrestrial input. The average SPM content in the surface layer and bottom layer ranged from 150–300 mg/L and 400–500 mg/L to 250 mg/L and 450 mg/L, respectively. In contrast, the Hangzhou Bay area demonstrated a relatively weak terrestrial input capacity from the Qiantang River, leading to an SPM content of 100–130 mg/L and an average of 110 mg/L. The South Yellow Sea region showed a negative correlation between the distance to the land and the SPM content, indicating higher values near the coast and lower values in the outer sea. Moreover, the content of SPM was lower than 20 mg/L for stations more than 100 km away from the land. The bottom layer’s content was higher than the surface layer’s content due to seabed sediment resuspension, as was observed at all stations. The maximum SPM content occurred at stations 3400-1 and 3400-2, with the surface and bottom layers reaching 150 mg/L and 300 mg/L, respectively. The high content of SPM in this area may be linked to the resuspension of bottom sediments in the radiation sand ridge group in the South Yellow Sea. Overall, the content of SPM in the euphotic layer exhibited a decreasing trend from the estuary to the offshore area.

3.2. Element Composition of SPM

The ICP-OES results revealed the distribution characteristics of transition metal elements in suspended particulate matter in several regions, including the North Yellow Sea, South Yellow Sea, Yangtze Estuary, Hangzhou Bay, and Pearl River Estuary (Table S1). The results showed that among the transition metal elements, Fe had the highest content in suspended particles, with average values of 41.74 mg/g, 40.09 mg/g, 45.15 mg/g, and 40.68 mg/g in the South Yellow Sea, Yangtze Estuary, Hangzhou Bay, and Pearl River Estuary, respectively. The Ti content was an order of magnitude lower content than that of Fe, with average values of 4.212 mg/g, 4.304 mg/g, 4.156 mg/g, and 4.488 mg/g in the above regions. Mn had the lowest content among the three elements, with average values of 1.075 mg/g, 1.119 mg/g, 1.064 mg/g, and 1.060 mg/g in the South Yellow Sea, Yangtze Estuary, Hangzhou Bay, and Pearl River Estuary, respectively. The low content of Mn may be attributed to the photoreduction of manganese oxides in the light-transmitting layer system, which makes Mn more present in seawater than in particles.

The distribution of Fe, Mn, and Ti displayed clear characteristics of terrigenous clasts, with high content along the coast and low content on the continental shelf. The concentration of these elements decreased rapidly from the coast to the outer sea near the Yangtze River estuary, but the rate of decrease slowed down after reaching the C-6 station outside due to the reduced influence of diluted water from the Yangtze River. Additionally, a distribution pattern that was low in the surface layer and high in the bottom layer was observed. The input of terrestrial sources contributed significantly to the studied elements.

In contrast, the distribution characteristics of particulate P content between 1.022 mg/g and 1.244 mg/g displayed a more obvious biogenic influence, with the highest value near the Zhoushan fishing ground along the Zhejiang coast and in the Yellow Sea, where primary productivity was high. The concentration of particulate P was also higher in the cold-water mass area, but lower in the coastal waters of the Yellow Sea.

With regards to the total amount, all elements except P displayed similar distribution trends, with the highest value in the Yangtze River Estuary, as well as significantly higher nearshore content compared to that in the middle of the Yellow Sea and the continental shelf. The total amount of most elements gradually decreased from the vertical coast to the outer sea in the nearshore waters, reflecting that the concentration of metal elements in suspended particulate matter in the nearshore sea area is mainly affected by land-based input. In contrast, from the Yellow Sea continental shelf to the continental slope area, where the impact of terrestrial sources is relatively small, the change in the metal content in particulate matter was relatively small and displayed a relatively uniform plane distribution.

3.3. Mineral Characterization of SPM

The X-ray diffraction (XRD) results indicated that the mineral composition of suspended particulate matter in the Yellow Sea, Yangtze River Estuary, Pearl River Estuary, and Hangzhou Bay regions exhibited certain similarities (Figure 3a). The primary minerals in the suspended particulate matter from these four regions were quartz, feldspar, mica, calcite, and clay minerals. The average content of quartz in suspended particulate matter was 52% in the Yellow Sea region, 43% in the Yangtze River estuary region, 42% in the Hangzhou Bay region, and 41% in the Pearl River estuary region. The average content of feldspar was 11%, 22%, 30%, and 23%, while that of mica was 22%, 27%, 21%, and 20%, respectively. The average content of calcite was 3% in all four regions.

These results suggest that as suspended particulate matter travels from the estuary to the nearshore regions, the proportion of stable quartz increases, while the proportions of less stable feldspar, mica, and clay minerals decrease. The changes in the proportion of calcite may be related to the material exchange between suspended particulate matter and sea floor surface sediment.

X-ray diffraction analysis of suspended particulate matter samples from five sites in the Yangtze River Estuary exhibited a similar trend (Figure 3b). The C-1 to C-5 samples were located on the axis extension line of the Yangtze River Estuary, with increasing distance from the estuary. The results showed that the proportion of quartz in suspended particulate matter increased while the proportions of feldspar, mica, and clay minerals decreased from C-1 to C-5.

Raman spectra (Figure 4) revealed that 2 A_1g vibration modes (226 cm⁻¹, 494 cm⁻¹) and 3 E_g vibration modes (298 cm⁻¹, 409 cm⁻¹, 614 cm⁻¹) contained Fe-O bending vibration peaks and O-Fe-O stretching vibration peaks, indicating the presence of hematite [14]. Indicating the anatase phase were 3 E_g vibrational modes (145 cm⁻¹, 199 cm⁻¹, 636 cm⁻¹), 1 B_1g vibrational mode (395 cm⁻¹), and 1 A_1g vibrational mode (515 cm⁻¹) [15]. Indicating the rutile phase were 1 B_1g vibration mode (146 cm⁻¹), 1 E_g vibration mode (444 cm⁻¹), and 1 A_1g vibration mode (610 cm⁻¹) [16]. The peaks at 211 cm⁻¹, 271 cm⁻¹, 380 cm⁻¹, 472 cm⁻¹ and 154 cm⁻¹, 210 cm⁻¹, 276 cm⁻¹, 387 cm⁻¹, and 625 cm⁻¹ indicate the phases of goethite [14] and brookite [17], respectively.

SEM microphotographs and EDX spectra suggest that the suspended particulate matter in the Yellow Sea region (Figure 5) contains a relatively large amount of hematite, most of which is in the form of flakes, which is due to long-distance transportation. Radial goethite can be found in the nearshore station, and the goethite spontaneously transforms into hematite with the progression of time and the increase in transportation distance. Pyrrhotite was discovered to exist in offshore suspended particles, although it is generally believed to appear only in oceanic suspended matter near the hydrothermal areas of the seabed.

The confocal Raman microscopy, scanning electron microscopy, and energy-dispersive X-ray spectroscopy (Figure 5, Figure S1) results supported the presence of typical titanium oxide and iron oxide semiconducting minerals with various micro- and nanoparticle sizes in suspended particles in the euphotic zones of the Yellow Sea, Yangtze River Estuary, Hangzhou Bay, and Pearl River Estuary.

3.4. Photoelectrochemical Characterization of SPM

The results of the linear sweep voltammetry test are presented in Figure 6a, indicating that the suspended particulate matter electrodes collected from the Yangtze River Estuary and the Yellow Sea exhibited significant photocurrents in the range of 0.5~1.2 V. Specifically, compared with the dark current, the photocurrent of the suspended particulate matter electrodes from the Yangtze River Estuary and the Yellow Sea increased, on average, by 80% and 65%, respectively, with the most efficient boost observed at a potential of 1.0 V.

To further explore the photoelectric properties of suspended particles under different conditions, current–time (I-t) curves were generated under visible light irradiation (Figure 6b). The results showed that the suspended particle electrode generated the highest photocurrent of about 3.0 μA, which is 87% higher than that of the dark condition and 210% higher than that of the blank FTO electrode. In comparison, the average photocurrent of the acid-treated particle electrode was 1.2 μA, 20% higher than that in the dark condition, 60% lower than that of the untreated suspended particulate matter electrode, and much lower than the dark current value of the untreated suspended particulate matter mineral electrode. This suggests that semiconducting minerals such as metal oxides and sulfides play a significant role in the photoelectric activity of suspended particles. The appearance of a photocurrent indicated a strong synchronization with the illumination process, and the current decreased rapidly to the initial state after the illumination disappeared, indicating good repeatability.

To investigate the visible light reactivity of suspended particulate matter in different regions, representative samples from each region were selected to make mineral electrodes, and current–time tests were carried out under the same system (Figure 6c). The results show that the suspended particulate matter in the Yangtze River Estuary exhibited the best reactivity, with the highest photocurrent being about 3.0 μA, which is 87% higher than that of the dark condition and 200% higher than that of the blank FTO electrode. The average photocurrents of suspended particulate mineral electrodes in the Yellow Sea, Hangzhou Bay, and Pearl River Estuary areas were 2.2 μA, 2.1 μA, and 1.9 μA, respectively, 29%, 31%, and 36% higher than the dark current, respectively. These findings suggest that suspended particulate matter in the estuary area exhibits better photoelectric activity than that in the coastal area, which is consistent with the changing trend of semiconducting mineral content.

The photoelectrochemical properties of semiconducting minerals in suspended particles were further studied by comparison with artificially synthesized semiconducting mineral electrodes (Figure 6d). The photocurrent results generated by the suspended particle electrode, hematite electrode, rutile electrode, anatase electrode, and blank FTO electrode under visible light irradiation are shown in the Figure. Hematite exhibited the highest photocurrent under visible light, with an average value of about 3.5 μA, an increase of 100% compared with the average dark current. In contrast, the anatase and rutile electrodes had a large band gap, and the main absorption band was located in the ultraviolet region, with a relatively low growth rate of the photocurrent at 36% and 15%, respectively. Although the content of iron oxide minerals, such as hematite, in the suspended particles was low, they could still produce an obvious photocurrent, about 85% of the photocurrent of synthetic hematite. This may be due to the formation of heterogeneous junctions between iron oxide and titanium oxide minerals, which can effectively separate photogenerated electrons and holes and improve their transfer efficiency.

3.5. Microbial Community Composition of Euphotic Zone

Following the analysis of 62 samples, a total of 59,134 operational taxonomic units (OTUs) were identified. The Shannon index and Pielou’s evenness index were used to evaluate the species diversity and distribution of the bacterial community across the Yangtze Estuary, Pearl River Estuary, Hangzhou Bay, and Yellow Sea (Figure 7). The results indicate a gradual increase in species diversity and evenness from the estuary to the ocean. This is consistent with the higher content of suspended particulate matter and terrigenous matter in the estuary compared to the coastal waters, resulting in lower α-diversity. A comparison of the obtained sequences with the SILVA database revealed the 10 most abundant phyla to be Proteobacteria, Actinobacteria, Bacteroidetes, Cyanobacteria, Chloroflexi, Firmicutes, Acidobacteria, Nitrospirae, Verrucomicrobia, and Planctomycetes. Of these, Proteobacteria was the most dominant phylum across all regions (Figure 8a). Notably, the composition of the bacterial community in the Pearl River Estuary significantly differed from that of the other regions at the phylum level, indicating a unique microbial community in this area.

3.6. Influence of Environmental Variables on Microbial Community Diversity

Principal component analysis (PCA) is a powerful technique that allows high-dimensional data to be converted into simpler structures, revealing the underlying patterns in the data. By analyzing the OTU composition of different samples, PCA can highlight the differences between samples. PCA uses variance decomposition, which reflects differences in multiple sets of data on a two-dimensional coordinate graph, with the coordinate axes representing the two eigenvalues that reflect the maximum variance. The PCA results of the bacterial community samples in the Yellow Sea, Yangtze Estuary, Hangzhou Bay, and Pearl River Estuary are presented in Figure 9. The results show that samples taken from different depths within the same area clustered together, indicating that the differences in the sample communities at different depths in the same area were small. The Yangtze River Estuary, Hangzhou Bay, and Pearl River Estuary communities are adjacent to each other and far from the bacterial communities of the Yellow Sea region, indicating large differences in the composition of bacterial communities in estuaries and coastal areas.

To explore the factors affecting microbial community changes, canonical correspondence analysis (CCA) and redundancy analysis (RDA) were used to analyze the correlation between the microbial community data and its corresponding environmental factors. The nine environmental factors used for CCA ranking at the OTU level explained 55.10% of the species distribution of the South Yellow Sea community. The first two axes of the CCA accounted for 52.71% of the species–environment relationship, with CCA1 mainly reflecting temperature, turbidity, and changes in nitrogen content with correlation coefficients of −0.876, 0.804, and 0.580, respectively, which demonstrates their greater impact on the microbial community (Figure 10).

RDA analysis at the genus level revealed a significant and positive correlation between the content of suspended particulate matter and denitrifying bacteria; dissimilatory metal-reducing bacteria such as Micrococcus, Ca. Portiera, Flavobacteriμm, Pseudomonas, Lactobacillus, Prevotella, Geobacter, Halomonas, Pseudoalteromonas, and Alteromonas; and sulfate-reducing bacteria such as Desulfococcus and Desulfotomaculμm. On the other hand, photosynthetic microorganisms such as Synechococcus were negatively correlated with the content of suspended particulate matter (Figure 11).

4. Discussion

Lu et al. conducted a systematic collection of soil/rock samples directly exposed to sunlight in typical terrestrial habitats such as red soil in southern China, karst in southwest China, and Gobi in northwest China [18,19,20]. This research revealed that a mineral coating composed of surface iron oxide and manganese oxide minerals often coats the surface of quartz, feldspar, and other minerals, with a thickness ranging from tens of nanometers to hundreds of microns. These iron oxide and manganese oxide mineral coatings are ubiquitous on the earth’s surface and have a direct relationship with sunlight, which constitutes another important way to utilize solar energy [21,22].

The semiconducting properties and photocatalytic effects of iron and manganese oxide minerals can directly influence the microbial community’s composition, extracellular electron transfer efficiency, and metabolic activity within a habitat. For example, the mineral coating on soil generates photoelectrons under sunlight irradiation, which can be transferred to the chemolithoautotrophic microorganism M. thermoacetica through microbial extracellular electron transfer. This process facilitates the conversion of carbon dioxide into acetic acid [23]. Moreover, it can also promote the growth and metabolic activity of chemoautotrophic microbe A. ferrooxidans, significantly enhancing its bacterial concentration, Fe²⁺ consumption rate, CO₂ absorption and conversion rate, and organic carbon growth rate [22]. The chemoheterotrophic microbe Dietzia can reduce water-soluble sodium manganese ore as an electron acceptor and release Mn²⁺, which can then combine with the water-soluble CO₃²⁻ produced by the oxidation of organic matter to form manganese carbonate minerals [24]. Through ¹³C-labeled CO₂ and HPLC-MS/MS, it has been shown that microbial acceptance of extracellular photoelectrons can promote the kinetic process of converting atmospheric CO₂ to organic carbon. The microbial transfer of electrons to excited-state semiconducting minerals can simultaneously promote the oxidation of organic carbon to inorganic carbonates and enhance cell density, providing sufficient cell surface nucleation sites for the combination of metal ions and carbonate ions. As a solid heterogeneous impurity, cells can effectively reduce the interfacial free energy and promote heterogeneous nucleation, enabling the precipitation of carbonate minerals at lower saturation indices. Therefore, the semiconducting mineral, possibly acting as a “solar film”, is closely associated with sunlight, microbes, organic matter, water, and other processes, and may play important roles in geological and microbial processes such as mineral photocatalytic energy conversion, microbial energy utilization, and atmospheric CO₂ conversion. The photocatalytic effects of semiconducting minerals in the euphotic zones of the sea and estuaries may have significant impacts on the microbial community composition and metabolic pathways, and may drive the cycling of carbon, nitrogen, and sulfur elements in marine ecosystems.

5. Conclusions

In conclusion, this study provides new insights into the characteristics of suspended particulate matter and microbial communities in the euphotic zones of nearshore and estuary regions. The suspended particulate matter content exhibited a clear land-derived detritus characteristic, with gradual decreases in content from the estuaries to the nearshore and offshore regions. The suspended particulate matter was primarily composed of minerals such as quartz, feldspar, mica, calcite, and clay, but also contained micro- and nanosized titanium and iron oxide semiconducting minerals such as hematite, rutile, goethite, and anatase. These semiconducting minerals were shown to contribute to the favorable photoelectric response activity of suspended particulate matter in the euphotic zone. The microbial community in the euphotic zone exhibited increasing species diversity and distribution uniformity from the estuaries to the open sea, with denitrifying bacteria, dissimilatory metal-reducing bacteria, and sulfate-reducing bacteria showing a positive correlation with suspended particulate matter content. Conversely, photosynthetic microorganisms displayed a negative correlation with the suspended particulate matter content. Overall, this study sheds light on the biogeochemical cycling of nearshore and estuary regions, and provides a foundation for future research in this area.