Anaerobic Bioreduction of Jarosites and Biofilm Formation by a Natural Microbial Consortium
Round 1
Reviewer 1 Report
It would have be useful to have pH and Eh data to understand the FeII FeIII redox
The XRD data is quite noisy, Was it possible to collect data with lower signal to noise and quantitative analysis performed
line 377 space required before a
How does the EPS interact with the mineral surface?
kinetic studies are mentions but no rates were determined. Was it possible to do so?
Author Response
It would have be useful to have pH and Eh data to understand the FeII FeIII redox
Our response
The pH value decreased at the initial stage and later remained constant around pH 6.5. The initial decrease can be explained by the formation of organic acids during the microbial oxidation of carbon sources, and by the precipitation of insoluble Fe(II) iron compounds leading to protons production.
The redox potential decreased due to the reduction process, as a consequence of the increase of Fe(II) concentration and the decrease of Fe(III) in the medium.
The XRD data is quite noisy, Was it possible to collect data with lower signal to noise and quantitative analysis performed
Our response
The noise of the X ray difractograms was caused by the mineral matrix and the small size of the particles generated by the microorganisms.
line 377 space required before a
Our response
The change has been now introduced.
How does the EPS interact with the mineral surface?
Our response
EPS are constituted by polysaccharides, protein, lipids and nucleic acids containing carboxyl, phosphoryl, amino, and hydroxyl on functional groups which can bind mineral surfaces.
Author Response File: 
Author Response.docx
Reviewer 2 Report
Microbial Fe(III) reduction was investigated with the aim to bioremediate jarosite impacted waters. The paper is well presented but needs a minor revision.
Line 13-14: It may be not appropriate to state ".....reduction of structural Fe(III) in the mineral was observed.". It is thought that reductive dissolution of Fe(III) minerals proceeds via two-steps, where chemical equilibrium between Fe(III) solid <-> Fe(III) soluble is "pulled" towards right by microbial reduction of soluble Fe(III) to soluble Fe(II) (See Barrie Johnson's papers). Please consider revision.
Line 101: "The microorganisms were" --> "The microorganism was"
"ferrous iron" and "Fe(II)" mixed. "ferric iron" and "Fe(III)" mixed. Please be consistent throughout the manuscript.
"composed by" --> "composed OF" (appears a few times in the manuscript)
Line 220-221: Please correct the grammar.
Author Response
Microbial Fe(III) reduction was investigated with the aim to bioremediate jarosite impacted waters. The paper is well presented but needs a minor revision.
Line 13-14: It may be not appropriate to state ".....reduction of structural Fe(III) in the mineral was observed.". It is thought that reductive dissolution of Fe(III) minerals proceeds via two-steps, where chemical equilibrium between Fe(III) solid <-> Fe(III) soluble is "pulled" towards right by microbial reduction of soluble Fe(III) to soluble Fe(II) (See Barrie Johnson's papers). Please consider revision.
Our response:
The sentence has been modified following the reviewer´s suggestion.
Line 101: "The microorganisms were" --> "The microorganism was"
Our response:
The mistake has been corrected.
"ferrous iron" and "Fe(II)" mixed. "ferric iron" and "Fe(III)" mixed. Please be consistent throughout the manuscript.
Our response:
Authors have changed ferrous and ferric iron in order to be consistent throughtout the manuscript.
"composed by" --> "composed OF" (appears a few times in the manuscript)
Our response:
The mistake has been corrected in the manuscript.
Line 220-221: Please correct the grammar.
Our response:
Grammar has been carefully reviewed.
Author Response File: Author Response.docx
Reviewer 3 Report
Review: Minerals Anaerobic bio reduction for jarosites and biofilm formation by a natural consortium
General:
Title: the title does say natural consortium ….! One has to assume microbes?
Methods and Material: samples collected at the edge of an open pit lake of an abandoned mine.
One has to assume that this is water. possibly with jarosites floating on top? what was the pH and Eh of the water /jarosite sample.
And sediments were collected with box corer… at which depth and to which depth into the sediment and what and what were the same parameters of the sediment.
Principally there would be different conditions and hence different microbial activity.
What motivated you to prepare a medium adjusted to pH 7, when likely jarosites present would have formed in an acid iron sulphate rich mined area.
If you go into google scholar and request pH/Eh diagrams for jarosites you will see that these two parameters are very important to determine in which area they are stable, such that a biofilm can grow on them.
Even if you have included these parameters in the supplemental data, they are lacking in the manuscript.
2.2 Preparation of minerals
You have in the title natural consortium her you indicate it was pure cultures of Sufolobus metallicus DSM-6482. It is somewhat confusing … and certainly does not fit with the title? Well these microbes where cultured at pH 1.8 and a thermophilic culture.
You did PCR amplification and all the other analytical tools to identify the microbes but throughout the manuscript no names are mentioned. If you just go and look at some fundamentals of microbes with iron, as for example the abstract copied. It is an extremely complex area and depending on the conditions of the solution the microbes change their activity.
The difficulty arises with the fact that iron reduction and iron oxidation yield either hydrogen or hydroxyl ions and these reactions would change the conditions in the media. The attached publication by Bernhard Dold outlines the basics of jarosites and their reactions. These appear to be ignored in this work. Virtually on every page jarosite are mentioned.
Specifics:
It is difficult to justify the statements about biofilms studies: on page 3 -14 lines 78 to 79, particularly as Flemming et al are quoted, which outlines beautifully what biofilms are.
Page 5 of 14: line 192: the statement: However, Fe II did not remain in solution. well may be the pH had changed.
Page 6 -14 line 232 Nevertheless most of the Fe II was somehow precipitated.
Page 7 of 14 line 238 to 239: the authors state reference 29 which used the solution below on Pseudomonas… a drastically different setting as the silver in a jarosite. Was silver actually released from the jarosites to exert its toxic effect?
Quoted below from ref 29
“Methods
Chemicals
AgNO3, chlorhexidine digluconate, 20% (w/v), HNO3, ~70% (w/w) were purchased from Sigma-Aldrich. Chemicals for the preparation of the neutralization solution: sodium thioglycolate, sodium thiosulfate, lecithin, were purchased from Acros Organics; Tween 80 (polyethylene glycol sorbitan monooleate) was purchased from Fluka.”
Figure 3, c and d have different axis
Page 11 and 12 of 14 your conclusion is generally correct, but they are not supported by the data you provided.
It may be possible that due to my understanding of jarosites and iron chemistry, (although not as well as B. Dold, the author of the attached article) I miss the point of the authors work. But chemistry is dominant, and jarosites are highly varied unstable minerals hence not very suitable for remediation of mine drainage.
Send to
Nat Rev Microbiol. 2006 Oct;4(10):752-64.
Microorganisms pumping iron: anaerobic microbial iron oxidation and reduction.
Weber KA1, Achenbach LA, Coates JD.
Author information
Abstract
Iron (Fe) has long been a recognized physiological requirement for life, yet for many microorganisms that persist in water, soils and sediments, its role extends well beyond that of a nutritional necessity. Fe (II) can function as an electron source for iron-oxidizing microorganisms under both oxic and anoxic conditions and Fe (III) can function as a terminal electron acceptor under anoxic conditions for iron-reducing microorganisms. Given that iron is the fourth most abundant element in the Earth's crust, iron redox reactions have the potential to support substantial microbial populations in soil and sedimentary environments. As such, biological iron apportionment has been described as one of the most ancient forms of microbial metabolism on Earth, and as a conceivable extraterrestrial metabolism on other iron-mineral-rich planets such as Mars. Furthermore, the metabolic versatility of the microorganisms involved in these reactions has resulted in the development of biotechnological applications to remediate contaminated environments and harvest energy.
Comments for author File: Comments.zip
Author Response
Reviewer 3
General:
Title: the title does say natural consortium ….! One has to assume microbes?
Our response:
The title has been modified to clarify this point.
Methods and Material: samples collected at the edge of an open pit lake of an abandoned mine.
One has to assume that this is water possibly with jarosites floating on top? what was the pH and Eh of the water /jarosite sample.
Our response:
The pH value of the open pit lake waters was 3-3.5. The Eh was not measured in situ. There were no jarosites floating on top.
And sediments were collected with box corer… at which depth and to which depth into the sediment and what and what were the same parameters of the sediment.
Our response:
The sediments were collected at a depth of 30 cm to 45 cm.
Principally there would be different conditions and hence different microbial activity.
What motivated you to prepare a medium adjusted to pH 7, when likely jarosites present would have formed in an acid iron sulphate rich mined area.
Our response:
The screening stage was centered on anaerobic iron reducing microorganisms with wider biotechnological applications.
If you go into google scholar and request pH/Eh diagrams for jarosites you will see that these two parameters are very important to determine in which area they are stable, such that a biofilm can grow on them.
Even if you have included these parameters in the supplemental data, they are lacking in the manuscript.
Our response:
Jarosites are synthesized at acidic pH and oxidizing conditions; however, these minerals are stable in a wide range of pH values.ñ
2.2 Preparation of minerals
You have in the title natural consortium her you indicate it was pure cultures of Sufolobus metallicus DSM-6482. It is somewhat confusing … and certainly does not fit with the title? Well these microbes where cultured at pH 1.8 and a thermophilic culture.
Our response:
Sufolobus metallicus DSM-6482 is a collection strain used only for synthesizing the jarosites. These jarosites were later used as Fe(III) source.
You did PCR amplification and all the other analytical tools to identify the microbes but throughout the manuscript no names are mentioned. If you just go and look at some fundamentals of microbes with iron, as for example the abstract copied. It is an extremely complex area and depending on the conditions of the solution the microbes change their activity.
Our response:
DGGE results have been included as supplementary information.
The difficulty arises with the fact that iron reduction and iron oxidation yield either hydrogen or hydroxyl ions and these reactions would change the conditions in the media. The attached publication by Bernhard Dold outlines the basics of jarosites and their reactions. These appear to be ignored in this work. Virtually on every page jarosite are mentioned.
Our response:
Authors thank to the reviewer the attachment. Oxidizing conditions and pH can strongly affect the jarosite formation. However, the conversion of jarosite to goethite is relatively unfavorable (Brown, 1971): KFe3(SO4)2(OH)6 → 3FeOOH + K+ +2SO42− + 3H+ and this decomposition route is unlikely, at least for K-, Na-, and NH4+ -jarosites.
Specifics:
It is difficult to justify the statements about biofilms studies: on page 3 -14 lines 78 to 79, particularly as Flemming et al are quoted, which outlines beautifully what biofilms are.
Our response
Authors tried to improve the sentence including other characteristic of biofilms.
Page 5 of 14: line 192: the statement: However, Fe II did not remain in solution. well may be the pH had changed.
Our response:
pH and Eh diagrams during the bioreduction process have been included in supplementary information. pH decreased slightly; however, the Fe(II) precipitation was caused by the transformation of citrate (chelator) and the formation of CO2 that led to siderite precipitation.
Page 6 -14 line 232 Nevertheless most of the Fe II was somehow precipitated.
Our response:
The sentence has been deleted.
Page 7 of 14 line 238 to 239: the authors state reference 29 which used the solution below on Pseudomonas… a drastically different setting as the silver in a jarosite. Was silver actually released from the jarosites to exert its toxic effect?
Quoted below from ref 29
“Methods
Chemicals
AgNO3, chlorhexidine digluconate, 20% (w/v), HNO3, ~70% (w/w) were purchased from Sigma-Aldrich. Chemicals for the preparation of the neutralization solution: sodium thioglycolate, sodium thiosulfate, lecithin, were purchased from Acros Organics; Tween 80 (polyethylene glycol sorbitan monooleate) was purchased from Fluka.”
Our response
It is thought that reductive dissolution of Fe(III) minerals proceeds via two-steps, where chemical equilibrium between Fe(III) solid <-> Fe(III) soluble is "pulled" towards right by microbial reduction of soluble Fe(III) to soluble Fe(II) (See Barrie Johnson's papers): In consequence, silver ions are released exerting the toxic effect. Nevertheless, not only silver ions in solution but also silver-bearing solids possess an antibacterial effect.
Figure 3, c and d have different axis
Our response:
Y axes in Figure 3 are counts. The intensity of the peaks is different and this is the reason for the differences.
Page 11 and 12 of 14 your conclusion is generally correct, but they are not supported by the data you provided.
Our response:
Authors tried to improve the manuscript in order to support the conlcusions.
It may be possible that due to my understanding of jarosites and iron chemistry, (although not as well as B. Dold, the author of the attached article) I miss the point of the authors work. But chemistry is dominant, and jarosites are highly varied unstable minerals hence not very suitable for remediation of mine drainage.
Our response
Jarosites can be dissolved at very acid pH values; however, as we explained previously, they are stable at wide range of conditions.
Reviewer 4 Report
The manuscript written by Castro et al has a great potential, but in such shape and form I cannot endorse it for publication. I would encourage the authors to review it again and add missing materials and methods (they are simply too modest) and results (DGGE, identification etc), and do a better literature review. I have a feeling that the authors did much more, but did not include everything in the manuscript. Therefor, certain sentences and sections do not make sense (missing results!).
Minor remarks:
L 12-14 - the sentences could be joined
L 18 - "specie" - typo (same is in conclusions)
L62 - responsible FOR infections
L 76 - please define CLSM. X-ray hyphenated?
L82-85 - map would be appreciated. What was the "depth" of the sediments?
L90 - THE pH?
L91 - how long did you purge it for? I guess colon should not be subscript.
L97 - space after comma
L102-105 and throughout - please use non-dividing space between a value and a unit
L104-105-how did you collect jarosite? details missing
L119 - were the gases in the same ratio as above? please clarify
L147-space before unit
L152-what material were the filters made out of?
L154-details (reference?) of coating missing
L158- an opening statement would be appreciated (just let the reader know that you used CLSM for DNA and lectin binding assay
L164-186- which company? Which protocol? details missing
Materials and Methods - DGGE details missing. Or were you talking about the previous research in L 181-188? Clarification and results missing.
Figure 1 - it is very hard to distinguish which is which. Colors?
Throughout - please unify the symbol for liter (l or L?)
L209-212 - I am not sure if it is my computer or sight, but the font is not uniform (I guess this could be fixed later)
reaction 1 - is this a speculation or based on your results? please clarify.
Figure 2 - hard to distinguish.
L243 - please unify the symbol for time (h or hours?)
L250 - the reaction speed was higher? the reaction was faster?
L285 - no space before the full stop.
Figure 3 - please define the y axis
L294 - changes in water chemistry - what does this refer to? Please clarify.
L309 - identification missing in Materials and Methods (details). Did you isolate a pure culture? Details missing.
L319 - "the biodiversity...was reduced" - There is something missing. I don't see any section describing biodiversity analyses or results.
Figure 343- I don't see figure 7.
Author Response
The manuscript written by Castro et al has a great potential, but in such shape and form I cannot endorse it for publication. I would encourage the authors to review it again and add missing materials and methods (they are simply too modest) and results (DGGE, identification etc), and do a better literature review. I have a feeling that the authors did much more, but did not include everything in the manuscript. Therefore, certain sentences and sections do not make sense (missing results!).
Minor remarks:
L 12-14 - the sentences could be joined.
Our response
The sentences have been modified.
L 18 - "specie" - typo (same is in conclusions)
Our response
The typing error has been corrected.
L62 - responsible FOR infections
Our response:
The mistake has been corrected
L 76 - please define CLSM. X-ray hyphenated?
Our response
Confocal laser scanning microscopy. The definition has been introduced in the text
L82-85 - map would be appreciated. What was the "depth" of the sediments?
Our response
A map has been included as supplementary information.Samples were collected at 30 cm and to 1125px.
L90 - THE pH?
Our response
The mistake was corrected.
L91 - how long did you purge it for? I guess colon should not be subscript.
Our response
Bubbling time has been included in methods. Colon is not subscript in the manuscript.
L97 - space after comma
Our response
Space has been introduced.
L102-105 and throughout - please use non-dividing space between a value and a unit
Our response
The manuscript has been corrected following reviewer´s suggestion.
L104-105-how did you collect jarosite? details missing
Our response
Jarosites were filtered through a 0.45 µm pore size filters. Details are now included in the manuscript.
L119 - were the gases in the same ratio as above? please clarify
Our response
Yes, gases are in the same ratio. The gas composition has been included in the text.
L147-space before unit
Our response
Now there is a space before unit.
L152-what material were the filters made out of?
Our response
Nylon filters were used.
L154-details (reference?) of coating missing
Our response
Samples were coated for 2 minutes and 40 seconds at a Quorum Q150R S equipment.
L158- an opening statement would be appreciated (just let the reader know that you used CLSM for DNA and lectin binding assay
Our response
The opening statement has been included following the reviewer´s suggestion.
L164-186- which company? Which protocol? details missing
Our response
Most of the companies are already cited. Nucleid acids stains are also from Invitrogen. The name has been included. The protocol of DNA staining was also included.
Materials and Methods - DGGE details missing. Or were you talking about the previous research in L 181-188? Clarification and results missing.
Our response:
DGGE details are missing because they are referred in the manuscript (Reference 19). In addition, DGGE results have been included in the supplementary information.
Figure 1 - it is very hard to distinguish which is which. Colors?
Our response
Different symbols were used to identify the experiments. Colors are avoided due to printing problems.
Throughout - please unify the symbol for liter (l or L?)
Our response
The symbols were unified throughout the manuscript.
L209-212 - I am not sure if it is my computer or sight, but the font is not uniform (I guess this could be fixed later)
Our response
That should be an editing mistake. Authors have changed the font to unify the manuscript.
reaction 1 - is this a speculation or based on your results? please clarify.
The reaction is based in the evolution of the concentrations of citrate, lactate and acetate during the bioreduction process and the formation of siderite (ferrous carbonate).
Figure 2 - hard to distinguish.
Our response
Different symbols were used to identify the experiments.
L243 - please unify the symbol for time (h or hours?)
Our response
The symbol has been unified.
L250 - the reaction speed was higher? the reaction was faster?
Our response
The sentence was modified following reviewer´s suggestion.
L285 - no space before the full stop.
Our response
The typing mistake was corrected.
Figure 3 - please define the y axis
Our response
Y axes are counts. Axis titles have been included in the figure.
L294 - changes in water chemistry - what does this refer to? Please clarify.
Our response
The sentence has been clarified making reference to pH, Eh and composition.
L309 - identification missing in Materials and Methods (details). Did you isolate a pure culture? Details missing.
Our response
Identification was performed in the Biotechnology Centre of the Universidad Católica del Norte (Chile) and the procedure was referred (reference 19).
L319 - "the biodiversity...was reduced" - There is something missing. I don't see any section describing biodiversity analyses or results.
Our response
DGGE results have been introduced as supplementary information.
Figure 343- I don't see figure 7.
Our response
Figure 7 does not exist. The text has been modified.
Author Response File: Author Response.docx
Round 2
Reviewer 3 Report
The notes with the replies are made in red. Comments are also added to the manuscript. It is recommended that you stick only to your results, either you work with microbial cultures or your consortium or differentiate the two approaches clearly. It remains confusing in the present state.
Comments for author File: Comments.zip
Author Response
Website 1971 : https://link.springer.com/article/10.1007/BF00208032
https://www.youtube.com/watch?v=-jvMDKlksis&feature=youtu.be
1:
Author's Notes
Reviewer 3
General:
Title: the title does say natural consortium ….! One has to assume microbes?
Our response:
The title has been modified to clarify this point. Okay, corrected now
Methods and Material: samples collected at the edge of an open pit lake of an abandoned mine.
One has to assume that this is water possibly with jarosites floating on top? what was the pH and Eh of the water /jarosite sample.
Our response:
The pH value of the open pit lake waters was 3-3.5. The Eh was not measured in situ. There were no jarosites floating on top.
And sediments were collected with box corer… at which depth and to which depth into the sediment and what and what were the same parameters of the sediment.
Our response:
The sediments were collected at a depth of 30 cm to 45 cm.
Principally there would be different conditions and hence different microbial activity. What motivated you to do that, if you study jarosites , text …
What motivated you to prepare a medium adjusted to pH 7, when likely jarosites present would have formed in an acid iron sulphate rich mined area. Not replied to and very essential to produce any significant results.
Our response:
The screening stage was centered on anaerobic iron reducing microorganisms with wider biotechnological applications. This does not reply to my question, pH of medium ?
Our response:
SRB could be used to remediate acid mine drainage as the sulfate in the AMD can be consumed by the SRB, the sulfide produced can precipitate dissolved metals and the bicarbonate produced can increase the pH of the drainage solution. However, the pH optimum for growth of SRB is between pH 5–9.
If you go into google scholar and request pH/Eh diagrams for jarosites you will see that these two parameters are very important to determine in which area they are stable, such that a biofilm can grow on them.
Even if you have included these parameters in the supplemental data, they are lacking in the manuscript.
Our response:
Jarosites are synthesized at acidic pH and oxidizing conditions; however, these minerals are stable in a wide range of pH values.
2.2 Preparation of minerals
You have in the title natural consortium here you indicate it was pure cultures of Sufolobus metallicus DSM-6482. It is somewhat confusing … and certainly does not fit with the title? Well these microbes where cultured at pH 1.8 and a thermophilic culture.
Our response:
Sufolobus metallicus DSM-6482 is a collection strain used only for synthesizing the jarosites. These jarosites were later used as Fe(III) source. This may well be , but in the text you talk about a consortium and you have collected sediments and water.. so it remains quite confusing..
You did PCR amplification and all the other analytical tools to identify the microbes but throughout the manuscript no names are mentioned. If you just go and look at some fundamentals of microbes with iron, as for example the abstract copied. It is an extremely complex area and depending on the conditions of the solution the microbes change their activity.
Our response:
DGGE results have been included as supplementary information.
The difficulty arises with the fact that iron reduction and iron oxidation yield either hydrogen or hydroxyl ions and these reactions would change the conditions in the media. Not addressed The attached publication by Bernhard Dold outlines the basics of jarosites and their reactions. These appear to be ignored in this work. Virtually on every page jarosite are mentioned.
Our response:
Authors thank to the reviewer the attachment. Oxidizing conditions and pH can strongly affect the jarosite formation. However, the conversion of jarosite to goethite is relatively unfavorable (Brown, 1971): KFe3(SO4)2(OH)6 → 3FeOOH + K+ +2SO42− + 3H+ and this decomposition route is unlikely, at least for K-, Na-, and NH4+ -jarosites.
The alterations of the jarosite mineral is also brought about by changing environment, including changes in pH and Eh, you say that yourself highlighted above, but you do not document these changes . .
Our response:
Changes in pH and Eh are documented in the attached supplementary information.
Specifics:
It is difficult to justify the statements about biofilms studies: on page 3 -14 lines 78 to 79, particularly as Flemming et al are quoted, which outlines beautifully what biofilms are.
Not replied to , this is all in the introduction and actually does not need to be there
Our response
Authors tried to improve the sentence including other characteristic of biofilms.
Page 5 of 14: line 192: the statement: However, Fe II did not remain in solution. well may be the pH had changed. Now line 202 and still no indication what the pH was or its changes.
Our response:
pH and Eh diagrams during the bioreduction process have been included in supplementary information. pH decreased slightly; however, the Fe(II) precipitation was caused by the transformation of citrate (chelator) and the formation of CO2 that led to siderite precipitation.
This is nice but it is not documented properly in the manuscript
Our response:
Changes in pH and Eh are documented in the attached supplementary information. Supplementary information is now referred in the manuscript.
Page 7 of 14 line 238 to 239: the authors state reference 29 which used the solution below on Pseudomonas… a drastically different setting as the silver in a jarosite. Was silver actually released from the jarosites to exert its toxic effect? Not replied to
Quoted below from ref 29
“Methods
Chemicals
AgNO3, chlorhexidine digluconate, 20% (w/v), HNO3, ~70% (w/w) were purchased from Sigma-Aldrich. Chemicals for the preparation of the neutralization solution: sodium thioglycolate, sodium thiosulfate, lecithin, were purchased from Acros Organics; Tween 80 (polyethylene glycol sorbitan monooleate) was purchased from Fluka.”
Our response
It is thought that reductive dissolution of Fe(III) minerals proceeds via two-steps, where chemical equilibrium between Fe(III) solid <-> Fe(III) soluble is "pulled" towards right by microbial reduction of soluble Fe(III) to soluble Fe(II) (See Barrie Johnson's papers): In consequence, silver ions are released exerting the toxic effect. Nevertheless, not only silver ions in solution but also silver-bearing solids possess an antibacterial effect. Well have you actually quantified the bacterial population or the microbial activity measured to state that there is a toxic effect ? you can quote Barry if you have measured or quantified in your system such a toxic effect .,
Figure 3, c and d have different axis
Our response:
Y axes in Figure 3 are counts. The intensity of the peaks is different and this is the reason for the differences. Yes so you adjust the scale if you want to compare properly the results.
Page 11 and 12 of 14 your conclusion is generally correct, but they are not supported by the data you provided.
Our response:
Authors tried to improve the manuscript in order to support the conclusions. The changes noted in the manuscript are minor. No connection is made what should be different or new due to the work carried out.
It may be possible that due to my understanding of jarosites and iron chemistry, (although not as well as B. Dold, the author of the attached article) I miss the point of the authors work. But chemistry is dominant, and jarosites are highly varied unstable minerals hence not very suitable for remediation of mine drainage.
Our response
Jarosites can be dissolved at very acid pH values; however, as we explained previously, they are stable at wide range of conditions. Stability depends on the environmental conditions surrounding the jarosites this remains a fact.
Our response:
Taking into account the article attached, “Jarosite is shown to be stable in an acid (pH < 3) medium which is moderate to highly oxidizing (Eh--pH). It appears that the persistence of jarosite outside its stability field is due to the sluggishness of the reaction jarosite ~ goethite“. Authors performed control experiments and no changes have been observed.
Reviewer 4 Report
I reviewed the manuscript, and I cannot endorse it for publication. The authors corrected minor things, but major issues remain.
Supplementary material is not referenced in the manuscript, the figures need to be polished, certain materials and methods were not extended and updated as requested, there are still some things that do not make any sense or are extremely unclear (biodiversity, DGGE etc). I would recommend the authors to rethink the structure of the manuscript to increase scientific soundness. I still believe that this manuscript is more a draft than a mature manuscript ready for publication.
Title: suggestion to consider: "...natural microbial consortium"
L87 - How did you measure pH? Description missing.
L87 and throughout: please use non-breaking space between a value and a unit
L99 - what primers did you use? I understand the method has been previously published and developed by a company, however, a few basic info would't hurt. Sequencing of 16S - did you do clone library? Or is this part of DGGE?
L109 - non-breaking space
L176 - washed with what? how many times?
L190-194 - it is still confusing. is this part of this study or previously published study? If it is part of this study, reference your figure,
"Different symbols were used to identify the experiments. Colors are avoided due to printing problems"
I understand colors bring problems. However, keep in mind that the readers do not have perfect eyesight. In Fig1a it is impossible to differentiate triangles from squares due to error bars. It would also help if the panels were aligned, if the y-axes were of the same length, if the panels were unified (frame or w/o frame), if the font was of the same size and style etc. The figure in such shape and form looks more like a rough draft than a polished figure after major revision.
L209 - Not sure if evolution is an appropriate word. I would replace it with either metabolism or something else.
Figure 3 - what is the meaning of different colors? Honestly, colors in this figure are more problematic in printing than in Fig1.
Supplementary information - is this part of the manuscript or a separate document? If yes, please refer to the sup. tables and figures in the manuscript.
FigS1 - source? Please keep in mind that people are not fully acquainted with geography of Spain, and an inset (zoom in/out) image would be appreciated, so the reader can imagine what part of Spain (s)he is staring at.
FigS2 - please polish the figure (align, unify the symbol size etc). Should the lines be connected on all graphs?
TableS1 - the dgge result is usually a gel. Which bands are these? Numbers do not tell us anything.
L330 - This sentence was not fixed as requested. It simply does not make sense. What is initial analysis? You present (i guess) identification of certain bands (we are usure where these bands are located on the gel) or even sequences from the clone library (I cannot tell because the materials and methods were not clarified as requested) in supplementary materials. This is not biodiversity. I simply cannot accept this.
Author Response
I reviewed the manuscript, and I cannot endorse it for publication. The authors corrected minor things, but major issues remain.
Supplementary material is not referenced in the manuscript, the figures need to be polished, certain materials and methods were not extended and updated as requested, there are still some things that do not make any sense or are extremely unclear (biodiversity, DGGE etc). I would recommend the authors to rethink the structure of the manuscript to increase scientific soundness. I still believe that this manuscript is more a draft than a mature manuscript ready for publication.
Title: suggestion to consider: "...natural microbial consortium"
Our response:
The title has been modified.
L87 - How did you measure pH? Description missing.
Our response:
The pH values were measured using a pHmeter Basic20 (Crison)..
L87 and throughout: please use non-breaking space between a value and a unit
Our response:
The mistakes were corrected.
L99 - what primers did you use? I understand the method has been previously published and developed by a company, however, a few basic info would't hurt. Sequencing of 16S - did you do clone library? Or is this part of DGGE?
Our response:
The genomic DNA was used as target in the PCR to amplify the 16S rRNA gene using the bacterial universal primer set 358F-GC (5′–CCTACGGGAGGCAGCAG–3′) and 907R (5′–CCGTCAATTCMTTTGAGTTT–3′) and for Archaea 344F-GC (5′–ACGGGGYGCAGCAGGCGCGA–3′) and 915R (5′–GTGCTCCCCCGCCAATTCCT–3′).
L109 - non-breaking space
Our response:
The mistake was rectified.
L176 - washed with what? how many times?
Our response:
Samples were washed once using basal salt solution.
L190-194 - it is still confusing. is this part of this study or previously published study? If it is part of this study, reference your figure,
"Different symbols were used to identify the experiments. Colors are avoided due to printing problems"
I understand colors bring problems. However, keep in mind that the readers do not have perfect eyesight. In Fig1a it is impossible to differentiate triangles from squares due to error bars. It would also help if the panels were aligned, if the y-axes were of the same length, if the panels were unified (frame or w/o frame), if the font was of the same size and style etc. The figure in such shape and form looks more like a rough draft than a polished figure after major revision.
Our response:
Fig. 1a. has been now modified including the reviewer’s suggestions.
L209 - Not sure if evolution is an appropriate word. I would replace it with either metabolism or something else.
Our response:
Figure caption has been modified.
Figure 3 - what is the meaning of different colors? Honestly, colors in this figure are more problematic in printing than in Fig1.
Our response:
Figure 3 is now black and white and the quality of the figure has been improved.
Supplementary information - is this part of the manuscript or a separate document? If yes, please refer to the sup. tables and figures in the manuscript.
Our response:
Supplementary data have been referred in the manuscript.
FigS1 - source? Please keep in mind that people are not fully acquainted with geography of Spain, and an inset (zoom in/out) image would be appreciated, so the reader can imagine what part of Spain (s)he is staring at.
Our response:
The requiered map has been included.
FigS2 - please polish the figure (align, unify the symbol size etc). Should the lines be connected on all graphs?
Our response:
Figure S2 has been improved.
TableS1 - the dgge result is usually a gel. Which bands are these? Numbers do not tell us anything.
Our response:
Gel photographs have been included as supplementary information.
L330 - This sentence was not fixed as requested. It simply does not make sense. What is initial analysis? You present (i guess) identification of certain bands (we are usure where these bands are located on the gel) or even sequences from the clone library (I cannot tell because the materials and methods were not clarified as requested) in supplementary materials. This is not biodiversity. I simply cannot accept this.
Our response:
More details have been clarified in materials and method section. In addition, the gel photographs have been included as supplentary information.
Round 3
Reviewer 3 Report
Comments for author File: 
Comments.pdf
Author Response
Jarosites would be metastable phase and the transformation is not thermodynamically favoured
KFe3(SO4)2(OH)6 s + 3H2O l = 3Fe(OH)3 s + Kaq+ + 2SO4 aq2− + 3Haq+ log K =-18
The transformation of jarosite to oxides by hydrolysis, or simple dissolution and reprecipitation, without reduction of the Fe3+ and reoxidation of Fe2+ , may also be a slow process (e.g., van Breemen and Harmsen [1975] found jarosite remaining after dialysis with distilled water for 4 months, although dialysis with distilled water for 30 days was able to cause the transformation of natrojarosite in the study by Brady et al., 1986). Such slow kinetics may help to account for jarosite occurrence in old soils of relatively high pH, such as in Vertic Albaqualfs that presumably have formed from soils that experienced sulfuricization early in their genesis (Carson et al., 1982).
In addition, there are a lot articles in literatura where biological reduction of jarosites has been studied under similar condition and stability problems were not detected.
Ivarson, K. C., & Hallberg, R. O. (1976). Formation of mackinawite by the microbial reduction of jarosite and its application to tidal sediments. Geoderma, 16(1), 1–7.
Jones, E. J. P., Nadeau, T.-L., Voytek, M. A., and Landa, E. R. (2006) Role of microbial iron reduction in the dissolution of iron hydroxysulfate minerals, J. Geophys. Res. 111, G01012.
Gramp, J. P., Wang, H., Bigham, J. M., Jones, F. S., & Tuovinen, O. H. (2009).Biogenic Synthesis and Reduction of Fe(III)-hydroxysulfates. Geomicrobiology Journal, 26(4), 275–280.
Bingjie, O., Xiancai, L., Huan, L., Juan, L., Tingting, Z., Xiangyu, Z., Jianjun, L., and Rucheng, W. (2014) Reduction of jarosite by Shewanella oneidensis MR-1 and secondary mineralization, Geochimica et Cosmochimica Acta 124, 54-71.
Smeaton, C. M., Fryer, B. J., and Weisener, C. G. (2009) Intracellular Precipitation of Pb by Shewanella putrefaciens CN32 during the Reductive Dissolution of Pb-Jarosite, Environmental Science & Technology 43, 8086-8091.
Weisener, C. G., Babechuk, M. G., Fryer, B. J., and Maunder, C. (2008) Microbial Dissolution of Silver Jarosite: Examining Its Trace Metal Behaviour in Reduced Environments, Geomicrobiology Journal 25, 415-424.
Reviewer 4 Report
After the authors implement the following suggestions, I can endorse the manuscript for publication.
L107-110: Please include appropriate primer original reference
L186 - is basal salt solution phsiological solution? If yes, please specify. if not, please specify.
L192 and throughout - please unify the units - g/L or g L-1?
Figure 2 - The values and units on Fig2A are different than in the previous verison of the manuscuript (>1000x difference). Please make sure that the symbol for liter is the same on y-axis and in the rest of the manuscript
figS1 - please include the source of the image.
Author Response
After the authors implement the following suggestions, I can endorse the manuscript for publication.
L107-110: Please include appropriate primer original reference.
Our response:
I have modified the sentence; however, I do not fully understand the reviewer’s request.
L186 - is basal salt solution phsiological solution? If yes, please specify. if not, please specify.
Our response:
Basal salt solution is composed by medium salts without carbón sources.
L192 and throughout - please unify the units - g/L or g L-1?
Our response:
The units have been unified.
Figure 2 - The values and units on Fig2A are different than in the previous verison of the manuscuript (>1000x difference). Please make sure that the symbol for liter is the same on y-axis and in the rest of the manuscript
Our response:
I think that the reviewer alludes to figure 1. The figure was modified and present figure is correct. The symbol for liter has been changed,
figS1 - please include the source of the image.
Our response:
The figure was done by the authors using Google maps.
