Pharmacogenomic Profile of Amazonian Amerindians
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Population
2.2. Exome Library Preparation
2.3. Read Calling and Processing
2.4. Selection of PGx Biomarkers
2.5. Bioinformatic and Statistical Analyses
3. Results
4. Discussion
4.1. General Data Found in the Amazonian Amerindian Population
4.1.1. IFNL4
4.1.2. DPYD
4.1.3. GSTT1
4.1.4. MTHFR
4.1.5. TYMS
4.1.6. CYP2D6
4.2. Comparative Analyses between Variants Found in the Amazon Amerindians and the Five Continental Populations from ExAC Database
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- World Health Organization; Quality Assurance and Safety of Medicines Team. Safety of Medicines: A Guide to Detecting and Reporting Adverse Drug Reactions: Why Health Professionals Need to Take Action 2002; WHO/EDM/QSM/2002.2; World Health Organization: Geneva, Switzerland, 2002. [Google Scholar]
- Cacabelos, R.; Cacabelos, N.; Carril, J.C. The Role of Pharmacogenomics in Adverse Drug Reactions. Expert Rev. Clin. Pharmacol. 2019, 12, 407–442. [Google Scholar] [CrossRef] [PubMed]
- Kozyra, M.; Ingelman-Sundberg, M.; Lauschke, V.M. Rare Genetic Variants in Cellular Transporters, Metabolic Enzymes, and Nuclear Receptors Can Be Important Determinants of Interindividual Differences in Drug Response. Genet. Med. 2017, 19, 20–29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, Z.W.; Chen, X.W.; Sneed, K.B.; Yang, Y.X.; Zhang, X.; He, Z.X.; Chow, K.; Yang, T.; Duan, W.; Zhou, S.F. Clinical Association between Pharmacogenomics and Adverse Drug Reactions. Drugs 2015, 75, 589–631. [Google Scholar] [CrossRef] [PubMed]
- Malki, M.A.; Pearson, E.R. Drug-Drug-Gene Interactions and Adverse Drug Reactions. Pharm. J. 2020, 20, 355–366. [Google Scholar] [CrossRef] [Green Version]
- Verstegen, R.H.J.; Ito, S. The Future of Precision Medicine. Clin. Pharmacol. Ther. 2019, 106, 903–906. [Google Scholar] [CrossRef]
- Huddart, R.; Fohner, A.E.; Whirl-Carrillo, M.; Wojcik, G.L.; Gignoux, C.R.; Popejoy, A.B.; Bustamante, C.D.; Altman, R.B.; Klein, T.E. Standardized Biogeographic Grouping System for Annotating Populations in Pharmacogenetic Research. Clin. Pharmacol. Ther. 2019, 105, 1256–1262. [Google Scholar] [CrossRef]
- Suarez-Kurtz, G.; de Araújo, G.S. Pharmacogenetic Differentiation across Latin America. Pharmacogenomics 2022, 23, 225–233. [Google Scholar] [CrossRef]
- Maroñas, O.; Latorre, A.; Dopazo, J.; Pirmohamed, M.; Rodríguez-Antona, C.; Siest, G.; Carracedo, Á.; Llerena, A. Progress in Pharmacogenetics: Consortiums and New Strategies. Drug Metab. Pers. Ther. 2016, 31, 17–23. [Google Scholar] [CrossRef]
- Popejoy, A.B. Diversity in Precision Medicine and Pharmacogenetics: Methodological and Conceptual Considerations for Broadening Participation. Pharm. Pers. Med. 2019, 12, 257–271. [Google Scholar] [CrossRef] [Green Version]
- Amorim, C.E.G.; Wang, S.; Marrero, A.R.; Salzano, F.M.; Ruiz-Linares, A.; Bortolini, M.C. X-Chromosomal Genetic Diversity and Linkage Disequilibrium Patterns in Amerindians and Non-Amerindian Populations. Am. J. Hum. Biol. 2011, 23, 299–304. [Google Scholar] [CrossRef]
- Rodrigues, J.C.G.; Fernandes, M.R.; Guerreiro, J.F.; da Costa da Silva, A.L.; Ribeiro-dos-Santos, Â.; Santos, S.; dos Santos, N.P.C. Polymorphisms of ADME-Related Genes and Their Implications for Drug Safety and Efficacy in Amazonian Amerindians. Sci. Rep. 2019, 9, 7201. [Google Scholar] [CrossRef] [PubMed]
- Fernandes, M.R.; Rodrigues, J.C.G.; Maroñas, O.; Pellicer, A.L.; Cruz, R.; Guerreiro, J.F.; Burbano, R.M.R.; de Assumpção, P.P.; Ribeiro-Dos-santos, A.; dos Santos, S.E.B.; et al. Genetic Diversity of Drug-Related Genes in Native Americans of the Brazilian Amazon. Pharm. Pers. Med. 2021, 14, 117. [Google Scholar] [CrossRef] [PubMed]
- de Andrade Ramos, B.R.; Mendes, N.D.; Tanikawa, A.A.; Amador, M.A.T.; dos Santos, N.P.C.; dos Santos, S.E.B.; Castelli, E.C.; Witkin, S.S.; da Silva, M.G. Ancestry Informative Markers and Selected Single Nucleotide Polymorphisms in Immunoregulatory Genes on Preterm Labor and Preterm Premature Rupture of Membranes: A Case Control Study. BMC Pregnancy Childbirth 2016, 16, 30. [Google Scholar] [CrossRef] [Green Version]
- Ribeiro-dos-Santos, A.M.; Vidal, A.F.; Vinasco-Sandoval, T.; Guerreiro, J.; Santos, S.; Ribeiro-dos-Santos, Â.; de Souza, S.J. Exome Sequencing of Native Populations From the Amazon Reveals Patterns on the Peopling of South America. Front. Genet. 2020, 11, 548507. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, J.C.G.; de Souza, T.P.; Pastana, L.F.; dos Santos, A.M.R.; Fernandes, M.R.; Pinto, P.; Wanderley, A.V.; de Souza, S.J.; Kroll, J.E.; Pereira, A.L.; et al. Identification of NUDT15 Gene Variants in Amazonian Amerindians and Admixed Individuals from Northern Brazil. PLoS ONE 2020, 15, e0231651. [Google Scholar] [CrossRef] [Green Version]
- Whirl-Carrillo, M.; Huddart, R.; Gong, L.; Sangkuhl, K.; Thorn, C.F.; Whaley, R.; Klein, T.E. An Evidence-Based Framework for Evaluating Pharmacogenomics Knowledge for Personalized Medicine. Clin. Pharmacol. Ther. 2021, 110, 563–572. [Google Scholar] [CrossRef]
- Relling, M.V.; Klein, T.E. CPIC: Clinical Pharmacogenetics Implementation Consortium of the Pharmacogenomics Research Network. Clin. Pharmacol. Ther. 2011, 89, 464–467. [Google Scholar] [CrossRef]
- Lê, S.; Josse, J.; Husson, F. FactoMineR: An R Package for Multivariate Analysis. J. Stat. Softw. 2008, 25, 1–18. [Google Scholar] [CrossRef] [Green Version]
- Giorgi, F.M.; Ceraolo, C.; Mercatelli, D. The R Language: An Engine for Bioinformatics and Data Science. Life 2022, 12, 648. [Google Scholar] [CrossRef]
- Dubois, P.F.; Hinsen, K.; Hugunin, J. Numerical Python. Comput. Phys. 1998, 10, 262. [Google Scholar] [CrossRef] [Green Version]
- Cingolani, P.; Platts, A.; Wang, L.L.; Coon, M.; Nguyen, T.; Wang, L.; Land, S.J.; Lu, X.; Ruden, D.M. A Program for Annotating and Predicting the Effects of Single Nucleotide Polymorphisms, SnpEff: SNPs in the Genome of Drosophila Melanogaster Strain W1118; Iso-2; Iso-3. Fly 2012, 6, 80–92. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pastana, L.F.; Silva, T.A.; Gellen, L.P.A.; Vieira, G.M.; de Assunção, L.A.; Leitão, L.P.C.; da Silva, N.M.; Coelho, R.d.C.C.; de Alcântara, A.L.; Vinagre, L.W.M.S.; et al. The Genomic Profile Associated with Risk of Severe Forms of COVID-19 in Amazonian Native American Populations. J. Pers. Med. 2022, 12, 554. [Google Scholar] [CrossRef] [PubMed]
- da Costa, G.E.; Fernandes, G.L.; Rodrigues, J.C.G.; da Leal, D.F.; Pastana, L.F.; Pereira, E.E.B.; Assumpção, P.P.; Burbano, R.M.R.; dos Santos, S.E.B.; Guerreiro, J.F.; et al. Exome Evaluation of Autism-Associated Genes in Amazon American Populations. Genes 2022, 13, 368. [Google Scholar] [CrossRef] [PubMed]
- Dobbin, E.A.F.; Medeiros, J.A.G.; Costa, M.S.C.R.; Rodrigues, J.C.G.; Guerreiro, J.F.; Kroll, J.E.; de Souza, S.J.; de Assumpção, P.P.; Ribeiro-Dos-santos, Â.; dos Santos, S.E.B.; et al. Identification of Variants (Rs11571707, Rs144848, and Rs11571769) in the BRCA2 Gene Associated with Hereditary Breast Cancer in Indigenous Populations of the Brazilian Amazon. Genes 2021, 12, 142. [Google Scholar] [CrossRef] [PubMed]
- de Carvalho, D.C.; Wanderley, A.V.; dos Santos, A.M.R.; Moreira, F.C.; de Sá, R.B.A.; Fernandes, M.R.; Modesto, A.A.C.; de Souza, T.P.; Cohen-Paes, A.; Leitão, L.P.C.; et al. Characterization of Pharmacogenetic Markers Related to Acute Lymphoblastic Leukemia Toxicity in Amazonian Native Americans Population. Sci. Rep. 2020, 10, 10292. [Google Scholar] [CrossRef]
- Fernandes, V.C.; Pretti, M.A.M.; Tsuneto, L.T.; Petzl-Erler, M.L.; Suarez-Kurtz, G. Single Nucleotide Variants as Proxies for HLA-A*31:01 in Native American Populations. Front. Pharmacol. 2022, 13, 849136. [Google Scholar] [CrossRef]
- Moreira, R.G.; Saraiva-Duarte, J.M.; Pereira, A.C.; Sosa-Macias, M.; Galaviz-Hernandez, C.; Santolalla, M.L.; Magalhães, W.C.S.; Zolini, C.; Leal, T.P.; Balázs, Z.; et al. Population Genetics of PDE4B (Phosphodiesterase-4B) in Neglected Native Americans: Implications for Cancer Pharmacogenetics. Clin. Transl. Sci. 2022. online version of record. [Google Scholar] [CrossRef]
- Amstutz, U.; Henricks, L.M.; Offer, S.M.; Barbarino, J.; Schellens, J.H.M.; Swen, J.J.; Klein, T.E.; McLeod, H.L.; Caudle, K.E.; Diasio, R.B.; et al. Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for Dihydropyrimidine Dehydrogenase Genotype and Fluoropyrimidine Dosing: 2017 Update. Clin. Pharmacol. Ther. 2018, 103, 210–216. [Google Scholar] [CrossRef]
- Johnson, J.A.; Caudle, K.E.; Gong, L.; Whirl-Carrillo, M.; Stein, C.M.; Scott, S.A.; Lee, M.T.; Gage, B.F.; Kimmel, S.E.; Perera, M.A.; et al. Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for Pharmacogenetics-Guided Warfarin Dosing: 2017 Update. Clin. Pharmacol. Ther. 2017, 102, 397–404. [Google Scholar] [CrossRef] [Green Version]
- Relling, M.V.; Schwab, M.; Whirl-Carrillo, M.; Suarez-Kurtz, G.; Pui, C.H.; Stein, C.M.; Moyer, A.M.; Evans, W.E.; Klein, T.E.; Antillon-Klussmann, F.G.; et al. Clinical Pharmacogenetics Implementation Consortium Guideline for Thiopurine Dosing Based on TPMT and NUDT15 Genotypes: 2018 Update. Clin. Pharmacol. Ther. 2019, 105, 1095–1105. [Google Scholar] [CrossRef] [Green Version]
- Fang, M.Z.; Jackson, S.S.; O’Brien, T.R. IFNL4: Notable Variants and Associated Phenotypes. Gene 2020, 730, 144289. [Google Scholar] [CrossRef] [PubMed]
- Muir, A.; Gong, L.; Johnson, S.; Lee, M.; Williams, M.; Klein, T.; Caudle, K.; Nelson, D. Clinical Pharmacogenetics Implementation Consortium (CPIC) Guidelines for IFNL3 (IL28B) Genotype and PEG Interferon-α–Based Regimens. Clin. Pharmacol. Ther. 2013, 95, 141–146. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Frias, M.; Rivero-Juárez, A.; López-López, P.; Rivero, A. Pharmacogenetics and the Treatment of HIV-/HCV-Coinfected Patients. Pharmacogenomics 2018, 19, 979–995. [Google Scholar] [CrossRef] [PubMed]
- Amstutz, U.; Froehlich, T.K.; Largiadèr, C.R. Dihydropyrimidine Dehydrogenase Gene as a Major Predictor of Severe 5-Fluorouracil Toxicity. Pharmacogenomics 2011, 12, 1321–1336. [Google Scholar] [CrossRef] [PubMed]
- Boisdron-Celle, M.; Capitain, O.; Faroux, R.; Borg, C.; Metges, J.P.; Galais, M.P.; Kaassis, M.; Bennouna, J.; Bouhier-Leporrier, K.; Francois, E.; et al. Prevention of 5-Fluorouracil-Induced Early Severe Toxicity by Pre-Therapeutic Dihydropyrimidine Dehydrogenase Deficiency Screening: Assessment of a Multiparametric Approach. Semin. Oncol. 2017, 44, 13–23. [Google Scholar] [CrossRef] [PubMed]
- Kassogue, Y.; Diakite, B.; Kassogue, O.; Konate, I.; Tamboura, K.; Diarra, Z.; Dehbi, H.; Nadifi, S.; Bougadari Traore, C.; Dao, S.; et al. Genetic Polymorphism of Drug Metabolism Enzymes (GSTM1, GSTT1 and GSTP1) in the Healthy Malian Population. Mol. Biol. Rep. 2020, 47, 393–400. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nakanishi, G.; Bertagnolli, L.S.; Pita-Oliveira, M.; Scudeler, M.M.; Torres-Loureiro, S.; Almeida-Dantas, T.; Alves, M.L.C.; Cirino, H.S.; Rodrigues-Soares, F. GSTM1 and GSTT1 Polymorphisms in Healthy Volunteers—A Worldwide Systematic Review. Drug Metab. Rev. 2022, 54, 37–45. [Google Scholar] [CrossRef]
- Prysyazhnyuk, V.; Bobkovych, K.; Sydorchuk, L.; Dzuryak, V.; Sydorchuk, R.; Prysiazhniuk, I.; Buzdugan, I.; Prysyazhnyuk, P. Glutathione-S-Transferases Genes-Promising Predictors of Hepatic Dysfunction. World J. Hepatol. 2021, 13, 620. [Google Scholar] [CrossRef]
- Hu, X.-Y.; Huang, X.-Y.; Ma, J.; Zuo, Y.; Luo, N.-B.; Lai, S.-L.; Su, D.-K. GSTT1 and GSTM1 Polymorphisms Predict Treatment Outcome for Breast Cancer: A Systematic Review and Meta-Analysis. Tumour Biol. 2016, 37, 151–162. [Google Scholar] [CrossRef]
- Xiao, Q.; Deng, D.; Li, H.; Ye, F.; Huang, L.; Zhang, B.; Ye, B.; Mo, Z.; Yang, X.; Liu, Z. GSTT1 and GSTM1 Polymorphisms Predict Treatment Outcome for Acute Myeloid Leukemia: A Systematic Review and Meta-Analysis. Ann. Hematol. 2014, 93, 1381–1390. [Google Scholar] [CrossRef]
- Liew, S.C.; Gupta, E. das Methylenetetrahydrofolate Reductase (MTHFR) C677T Polymorphism: Epidemiology, Metabolism and the Associated Diseases. Eur. J. Med. Genet. 2015, 58, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Giletti, A.; Esperon, P. Genetic Markers in Methotrexate Treatments. Pharm. J. 2018, 18, 689–703. [Google Scholar] [CrossRef]
- Xie, P.; Mo, J.L.; Liu, J.H.; Li, X.; Tan, L.M.; Zhang, W.; Zhou, H.H.; Liu, Z.Q. Pharmacogenomics of 5-Fluorouracil in Colorectal Cancer: Review and Update. Cell Oncol. 2020, 43, 989–1001. [Google Scholar] [CrossRef] [PubMed]
- Song, Z.; Hu, Y.; Liu, S.; Jiang, D.; Yi, Z.; Benjamin, M.M.; Zhao, R. The Role of Genetic Polymorphisms in High-Dose Methotrexate Toxicity and Response in Hematological Malignancies: A Systematic Review and Meta-Analysis. Front. Pharmacol. 2021, 12, 757464. [Google Scholar] [CrossRef] [PubMed]
- Campbell, J.M.; Bateman, E.; Peters, M.D.J.; Bowen, J.M.; Keefe, D.M.; Stephenson, M.D. Fluoropyrimidine and Platinum Toxicity Pharmacogenetics: An Umbrella Review of Systematic Reviews and Meta-Analyses. Pharmacogenomics 2016, 17, 435–451. [Google Scholar] [CrossRef] [PubMed]
- Zhong, L.; He, X.; Zhang, Y.; Chuan, J.L.; Chen, M.; Zhu, S.M.; Peng, Q. Relevance of Methylenetetrahydrofolate Reductase Gene Variants C677T and A1298C with Response to Fluoropyrimidine-Based Chemotherapy in Colorectal Cancer: A Systematic Review and Meta-Analysis. Oncotarget 2018, 9, 31291–31301. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fernandes, M.R.; Rodrigues, J.C.G.; Dobbin, E.A.F.; Pastana, L.F.; da Costa, D.F.; Barra, W.F.; Modesto, A.A.C.; de Assumpção, P.B.; da Costa Silva, A.L.; dos Santos, S.E.B.; et al. Influence of FPGS, ABCC4, SLC29A1, and MTHFR Genes on the Pharmacogenomics of Fluoropyrimidines in Patients with Gastrointestinal Cancer from the Brazilian Amazon. Cancer Chemother. Pharmacol. 2021, 88, 837–844. [Google Scholar] [CrossRef] [PubMed]
- Matsusaka, S.; Lenz, H.J. Pharmacogenomics of Fluorouracil-Based Chemotherapy Toxicity. Expert Opin. Drug Metab. Toxicol. 2015, 11, 811–821. [Google Scholar] [CrossRef]
- Peters, G.J.; Smid, K.; Meijer, E.; van Groeningen, C.J.; Leon, L.G. Role of Genomic Factors beyond Thymidylate Synthase in the Prediction of Response to 5-Fluorouracil. Nucleosides Nucleotides Nucleic Acids 2016, 35, 595–603. [Google Scholar] [CrossRef]
- Luo, Y.; Yang, Z.; Chen, Y.; Lu, X.; Quan, Y. Genomic and Immunological Features of Microsatellite Instability in Colon Cancer. Gene 2021, 781, 145534. [Google Scholar] [CrossRef]
- Blondy, S.; David, V.; Verdier, M.; Mathonnet, M.; Perraud, A.; Christou, N. 5-Fluorouracil Resistance Mechanisms in Colorectal Cancer: From Classical Pathways to Promising Processes. Cancer Sci. 2020, 111, 3142. [Google Scholar] [CrossRef] [PubMed]
- Soo, R.A.; Syn, N.; Lee, S.C.; Wang, L.; Lim, X.Y.; Loh, M.; Tan, S.H.; Zee, Y.K.; Wong, A.L.A.; Chuah, B.; et al. Pharmacogenetics-Guided Phase I Study of Capecitabine on an Intermittent Schedule in Patients with Advanced or Metastatic Solid Tumours. Sci. Rep. 2016, 6, 27826. [Google Scholar] [CrossRef] [PubMed]
- Zhou, S.F. Polymorphism of Human Cytochrome P450 2D6 and Its Clinical Significance: Part II. Clin. Pharmacokinet. 2009, 48, 761–804. [Google Scholar] [CrossRef] [PubMed]
- Zanger, U.M.; Schwab, M. Cytochrome P450 Enzymes in Drug Metabolism: Regulation of Gene Expression, Enzyme Activities, and Impact of Genetic Variation. Pharmacol. Ther. 2013, 138, 103–141. [Google Scholar] [CrossRef] [PubMed]
- Crews, K.R.; Gaedigk, A.; Dunnenberger, H.M.; Leeder, J.S.; Klein, T.E.; Caudle, K.E.; Haidar, C.E.; Shen, D.D.; Callaghan, J.T.; Sadhasivam, S.; et al. Clinical Pharmacogenetics Implementation Consortium Guidelines for Cytochrome P450 2D6 Genotype and Codeine Therapy: 2014 Update. Clin. Pharmacol. Ther. 2014, 95, 376–382. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hicks, J.K.; Bishop, J.R.; Sangkuhl, K.; Muller, D.J.; Ji, Y.; Leckband, S.G.; Leeder, J.S.; Graham, R.L.; Chiulli, D.L.; LLerena, A.; et al. Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6 and CYP2C19 Genotypes and Dosing of Selective Serotonin Reuptake Inhibitors. Clin. Pharmacol. Ther. 2015, 98, 127–134. [Google Scholar] [CrossRef] [Green Version]
- Hicks, J.K.; Sangkuhl, K.; Swen, J.J.; Ellingrod, V.L.; Müller, D.J.; Shimoda, K.; Bishop, J.R.; Kharasch, E.D.; Skaar, T.C.; Gaedigk, A.; et al. Clinical Pharmacogenetics Implementation Consortium Guideline (CPIC) for CYP2D6 and CYP2C19 Genotypes and Dosing of Tricyclic Antidepressants: 2016 Update. Clin. Pharmacol. Ther. 2017, 102, 37–44. [Google Scholar] [CrossRef] [Green Version]
- Bell, G.C.; Caudle, K.E.; Whirl-Carrillo, M.; Gordon, R.J.; Hikino, K.; Prows, C.A.; Gaedigk, A.; Agundez, J.A.G.; Sadhasivam, S.; Klein, T.E.; et al. Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6 Genotype and Use of Ondansetron and Tropisetron. Clin. Pharmacol. Ther. 2017, 102, 213–218. [Google Scholar] [CrossRef] [Green Version]
- Goetz, M.P.; Sangkuhl, K.; Guchelaar, H.-J.; Schwab, M.; Province, M.; Whirl-Carrillo, M.; Symmans, W.F.; Mcleod, H.L.; Ratain, M.J.; Zembutsu, H.; et al. Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6 and Tamoxifen Therapy. Clin. Pharmacol. Ther. 2014, 103, 770–777. [Google Scholar] [CrossRef] [Green Version]
- Brown, J.T.; Bishop, J.R.; Sangkuhl, K.; Nurmi, E.L.; Mueller, D.J.; Dinh, J.C.; Gaedigk, A.; Klein, T.E.; Caudle, K.E.; Mccracken, J.T.; et al. Clinical Pharmacogenetics Implementation Consortium Guideline for Cytochrome P450 (CYP)2D6 Genotype and Atomoxetine Therapy. Clin. Pharmacol. Ther. 2019, 106, 94–102. [Google Scholar] [CrossRef] [Green Version]
- Hoffecker, J.F.; Elias, S.A.; O’Rourke, D.H.; Scott, G.R.; Bigelow, N.H. Beringia and the Global Dispersal of Modern Humans. Evol. Anthropol. 2016, 25, 64–78. [Google Scholar] [CrossRef] [PubMed]
- Reich, D.; Patterson, N.; Campbell, D.; Tandon, A.; Mazieres, S.; Ray, N.; Parra, M.V.; Rojas, W.; Duque, C.; Mesa, N.; et al. Reconstructing Native American Population History. Nature 2012, 488, 370–374. [Google Scholar] [CrossRef] [PubMed]
- Raghavan, M.; Steinrücken, M.; Harris, K.; Schiffels, S.; Rasmussen, S.; DeGiorgio, M.; Albrechtsen, A.; Valdiosera, C.; Ávila-Arcos, M.C.; Malaspinas, A.S.; et al. POPULATION GENETICS. Genomic Evidence for the Pleistocene and Recent Population History of Native Americans. Science 2015, 349, aab3884. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Skoglund, P.; Mallick, S.; Bortolini, M.C.; Chennagiri, N.; Hünemeier, T.; Petzl-Erler, M.L.; Salzano, F.M.; Patterson, N.; Reich, D. Genetic Evidence for Two Founding Populations of the Americas. Nature 2015, 525, 104–108. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moreno-Mayar, J.V.; Vinner, L.; de Barros Damgaard, P.; de La Fuente, C.; Chan, J.; Spence, J.P.; Allentoft, M.E.; Vimala, T.; Racimo, F.; Pinotti, T.; et al. Early Human Dispersals within the Americas. Science 2018, 362, eaav2621. [Google Scholar] [CrossRef] [Green Version]
- Mendes, M.; Alvim, I.; Borda, V.; Tarazona-Santos, E. The History behind the Mosaic of the Americas. Curr. Opin. Genet. Dev. 2020, 62, 72–77. [Google Scholar] [CrossRef]
- Willerslev, E.; Meltzer, D.J. Peopling of the Americas as Inferred from Ancient Genomics. Nature 2021, 594, 356–364. [Google Scholar] [CrossRef]
Characteristics | Number |
---|---|
All variants | 3.311 |
New variants | 167 |
Type | |
Single-nucleotide variant (SNV) | 2.934 |
Insertion or deletion (INDEL) | 377 |
Gene region | |
3′UTR | 188 |
5′UTR | 90 |
Exon (CDS) | 1183 |
Intragenic | 33 |
Intron | 1567 |
Others | 250 |
Consequence | |
Codon change and codon deletion | 10 |
Codon change and codon deletion + splice site region | 1 |
Codon change and codon insertion | 2 |
Codon deletion | 5 |
Codon deletion + splice site region | 1 |
Codon Insertion | 2 |
Frameshift | 53 |
Frameshift + splice site region + splice site donor | 1 |
Intragenic | 33 |
Intronic | 1567 |
Protein functional site | 82 |
Nonsynonymous | 641 |
Protein structural interaction locus | 30 |
Splice site acceptor | 3 |
Splice site donor | 8 |
Splice region | 102 |
Start codon | 1 |
Stop codon | 5 |
Synonymous | 486 |
3′UTR | 188 |
5′UTR | 90 |
SNPeff Impact | |
High | 101 |
Moderate | 672 |
Modifier | 1878 |
Low | 660 |
Chromosomal Position | Reference | Variant | Gene | Region Detailed | Impact | Minor Allele Frequency |
---|---|---|---|---|---|---|
19:39248563 | C | G | IFNL4 | NON_SYNONYMOUS_CODING | MODERATE | 0.0161 |
X:134500131 | G | T | HPRT1 | UTR_3_PRIME | MODIFIER | 0.0161 |
19:38442623 | G | T | RYR1 | INTRON | MODIFIER | 0.0161 |
X:38352846 | G | C | OTC | INTRON | MODIFIER | 0.0161 |
1:186679301 | G | A | PTGS2 | INTRON | MODIFIER | 0.0161 |
7:99778057 | T | C | CYP3A4 | SYNONYMOUS_CODING | LOW | 0.0172 |
4:20850609 | C | T | KCNIP4 | SYNONYMOUS_CODING | LOW | 0.0172 |
15:74754842 | C | A | CYP1A2 | SYNONYMOUS_CODING | LOW | 0.0172 |
X:154534297 | AC | A | G6PD | INTRON | MODIFIER | 0.0208 |
10:112951639 | TGCCC | T | TCF7L2 | INTRON | MODIFIER | 0.0250 |
9:130855098 | TAGGGG | T | ABL1 | SPLICE_SITE_REGION + INTRON | LOW | 0.0250 |
1:97098596 | T | C | DPYD | NON_SYNONYMOUS_CODING | MODERATE | 0.0313 |
2:233760783 | C | T | UGT1A4 | INTRON | MODIFIER | 0.0357 |
2:233760783 | C | T | UGT1A1 | SYNONYMOUS_CODING | LOW | 0.0357 |
22_KI270879v1_alt:278462 | C | G | GSTT1 | UTR_5_PRIME | MODIFIER | 0.0500 |
1:11803345 | C | A | MTHFR | INTRON | MODIFIER | 0.0556 |
18:657685 | G | GGCCTGCCTCCGTCCCGCCGCGCCACTTC | TYMS | UTR_5_PRIME | MODIFIER | 0.1154 |
22_KI270928v1_alt:52910 | C | G | CYP2D6 | INTRON | MODIFIER | 0.5400 |
22_KI270879v1_alt:278129 | C | T | GSTT1 | INTRON | MODIFIER | 0.5417 |
22_KI270928v1_alt:52912 | T | G | CYP2D6 | INTRON | MODIFIER | 0.6230 |
22_KI270928v1_alt:52919 | G | C | CYP2D6 | INTRON | MODIFIER | 0.6563 |
Pairwise Comparation (p-Value) | |||||||
---|---|---|---|---|---|---|---|
Chromosomal Location | Gene | dbSNP | NAM × AFR | NAM × AMR | NAM × EAS | NAM × EUR | NAM × SAS |
chr7:87531302 | ABCB1 | rs2032582 | 2.18306 × 10−56 | 6.53986 × 10−16 | 2.51344 × 10−12 | 1.02973 × 10−16 | 1.00647 × 10−7 |
chr4:2915035 | ADD1 | rs4963 | 9.45593 × 10−5 | 2.69477 × 10−6 | 4.94438 × 10−17 | 3.89984 × 10−5 | 3.67996 × 10−5 |
10:114045297 | ADRB1 | rs1801253 | 3.97318 × 10−15 | 0.000145471 | 2.41152 × 10−8 | 1.2311 × 10−9 | 4.82047 × 10−8 |
chr5:148826877 | ADRB2 | rs1042713 | 1.19482 × 10−17 | 6.47618 × 10−14 | 1.1541 × 10−20 | 3.6564 × 10−12 | 8.98985 × 10−16 |
chr11:113400106 | ANKK1 | rs1800497 | 8.91338 × 10−13 | 1.89293 × 10−7 | 7.07468 × 10−10 | 1.75701 × 10−25 | 8.89022 × 10−17 |
chr11:113396099 | ANKK1 | rs7118900 | 1.57472 × 10−13 | 4.5083 × 10−7 | 1.35542 × 10−9 | 2.61132 × 10−26 | 2.51963 × 10−16 |
chr22:23285051 | BCR | rs12484731 | 2.18658 × 10−26 | 1.16413 × 10−6 | 9.95701 × 10−26 | 5.38079 × 10−46 | 2.00229 × 10−35 |
chr22:23290360 | BCR | rs35537221 | 1.8611 × 10−28 | 1.05573 × 10−6 | 4.00474 × 10−21 | 2.14428 × 10−45 | 1.21405 × 10−35 |
chr21:36135447 | CBR3 | rs881711 | 5.8767 × 10−19 | 2.17402 × 10−19 | 4.67622 × 10−28 | 2.69704 × 10−29 | 1.15895 × 10−27 |
chr6:31154538 | CCHCR1 | rs130066 | 6.77941 × 10−5 | 1.33884 × 10−6 | 0.000115616 | 1.58769 × 10−6 | 4.19502 × 10−5 |
chr19:41006936 | CYP2B6 | rs3745274 | 1.64912 × 10−11 | 8.995 × 10−10 | 5.73451 × 10−5 | 9.859 × 10−7 | 1.34727 × 10−12 |
chr22:42142513 | CYP2D6 | rs149012039 | 1.14215 × 10−11 | 1.59914 × 10−6 | 6.78214 × 10−20 | 3.22875 × 10−9 | 7.70391 × 10−5 |
chr1:161544752 | FCGR3A | rs396991 | 7.44824 × 10−9 | 1.65936 × 10−5 | 7.84237 × 10−9 | 1.16585 × 10−9 | 2.03133 × 10−9 |
chr6:29943337 | HLA-A | rs3173420 | 4.31224 × 10−9 | 6.87922 × 10−8 | 4.56562 × 10−7 | 8.57084 × 10−12 | 8.71629 × 10−12 |
chr6:29942965 | HLA-A | rs281864739rs78306866 | 8.46059 × 10−12 | 4.05707 × 10−17 | 8.97765 × 10−12 | 3.63056 × 10−14 | 4.43796 × 10−13 |
chr6:29942953 | HLA-A | rs199474436 | 5.79981 × 10−6 | 6.93234 × 10−13 | 1.41018 × 10−11 | 6.78811 × 10−9 | 6.08387 × 10−6 |
chr6:29942581 | HLA-A | rs1143146 | 2.45192 × 10−16 | 3.07371 × 10−24 | 1.35824 × 10−18 | 1.34049 × 10−18 | 9.97823 × 10−14 |
chr6:31356226 | HLA-B | rs2308466 | 3.65704 × 10−9 | 3.66621 × 10−9 | 5.81378 × 10−5 | 2.5862 × 10−10 | 7.79316 × 10−12 |
chr6:31356227 | HLA-B | rs2523600 | 1.9236 × 10−13 | 2.13422 × 10−14 | 8.63059 × 10−15 | 4.81953 × 10−11 | 7.03642 × 10−13 |
chr6:31356889 | HLA-B | rs713031 | 1.07572 × 10−17 | 1.41509 × 10−16 | 6.48134 × 10−29 | 2.226 × 10−13 | 1.45874 × 10−21 |
chr6:31356247 | HLA-B | rs697742 | 1.16978 × 10−17 | 4.25927 × 10−20 | 3.31496 × 10−24 | 2.21922 × 10−16 | 3.51264 × 10−21 |
chr6:31356928 | HLA-B | rs1131170 | 2.28835 × 10−24 | 1.15345 × 10−18 | 2.11729 × 10−29 | 4.93973 × 10−20 | 6.05278 × 10−27 |
chr6:31269347 | HLA-C | rs1130838 | 6.45396 × 10−16 | 2.25074 × 10−12 | 1.6135 × 10−15 | 4.15458 × 10−9 | 5.96131 × 10−12 |
chr6:31271999 | HLA-C | rs2074493 | 8.10462 × 10−10 | 9.63528 × 10−11 | 1.02002 × 10−10 | 9.09483 × 10−15 | 4.07089 × 10−20 |
chr6:31270025 | HLA-C | rs1050147 | 1.18398 × 10−31 | 3.7936 × 10−27 | 7.42085 × 10−32 | 7.33005 × 10−23 | 1.50973 × 10−26 |
chr6:33080851 | HLA-DPB1 | rs1042136 | 1.6523 × 10−8 | 1.88517 × 10−7 | 2.47857 × 10−10 | 5.23217 × 10−5 | 1.23339 × 10−6 |
chr6:32641487 | HLA-DQA1 | rs1142333 | 4.373 × 10−28 | 1.9016 × 10−20 | 3.07937 × 10−28 | 1.11648 × 10−30 | 4.88343 × 10−43 |
chr6:32641535 | HLA-DQA1 | rs1129808 | 7.97358 × 10−92 | 1.19523 × 10−84 | 8.96057 × 10−84 | 8.9906 × 10−104 | 3.2328 × 10−109 |
chr6:32641477 | HLA-DQA1 | rs1142331 | 1.18138 × 10−25 | 7.36406 × 10−16 | 2.39546 × 10−25 | 2.60828 × 10−27 | 1.4441 × 10−39 |
chr6:32641521 | HLA-DQA1 | rs199556640 | 9.45834 × 10−19 | 2.68598 × 10−19 | 3.99666 × 10−22 | 6.58968 × 10−19 | 1.29641 × 10−24 |
chr6:32641519 | HLA-DQA1 | rs9282026 | 6.76015 × 10−12 | 5.23003 × 10−12 | 1.15636 × 10−14 | 8.59051 × 10−12 | 3.46752 × 10−16 |
chr6:32642029 | HLA-DQA1 | rs707952 | 7.78654 × 10−6 | 4.53726 × 10−8 | 9.34217 × 10−5 | 3.23443 × 10−7 | 2.9079 × 10−7 |
chr6:32581807 | HLA-DRB1 | rs200088269rs35616319 | 7.84356 × 10−15 | 1.98563 × 10−8 | 7.60999 × 10−12 | 5.08348 × 10−10 | 2.14344 × 10−10 |
chr6:32581802 | HLA-DRB1 | rs753045406 | 1.2253 × 10−13 | 9.15172 × 10−8 | 4.74343 × 10−11 | 3.01143 × 10−9 | 1.4626 × 10−9 |
chr6:32581621 | HLA-DRB1 | rs757139064 | 4.04995 × 10−18 | 6.91184 × 10−18 | 2.46801 × 10−16 | 2.08408 × 10−16 | 7.75881 × 10−20 |
chr19:39248515 | IFNL4 | rs74597329 | 9.56326 × 10−33 | 4.95051 × 10−6 | 1.16957 × 10−5 | 4.53584 × 10−15 | 1.72728 × 10−6 |
chr19:39248513 | IFNL4 | rs11322783 | 9.56326 × 10−33 | 4.95051 × 10−6 | 1.16957 × 10−5 | 4.53584 × 10−15 | 1.72728 × 10−6 |
chr6:160540105 | LPA | rs3798220 | 1.75821 × 10−48 | 7.48752 × 10−5 | 8.65473 × 10−19 | 1.63951 × 10−43 | 6.71261 × 10−58 |
chr12:21178615 | SLCO1B1 | rs4149056 | 9.76195 × 10−23 | 7.37959 × 10−10 | 2.78132 × 10−8 | 2.34092 × 10−6 | 3.06483 × 10−17 |
chr2:159230143 | TANC1 | rs4664277 | 1.61934 × 10−17 | 5.62787 × 10−8 | 3.42429 × 10−10 | 1.86855 × 10−24 | 5.11983 × 10−15 |
chr12:47879112 | VDR | rs2228570 | 7.39552 × 10−41 | 6.3868 × 10−19 | 1.78553 × 10−20 | 4.04936 × 10−25 | 1.4743 × 10−38 |
chr3:14145949 | XPC | rs2228001 | 2.43937 × 10−34 | 1.84077 × 10−32 | 4.51201 × 10−27 | 1.39797 × 10−23 | 1.02515 × 10−27 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rodrigues, J.C.G.; Fernandes, M.R.; Ribeiro-dos-Santos, A.M.; de Araújo, G.S.; de Souza, S.J.; Guerreiro, J.F.; Ribeiro-dos-Santos, Â.; de Assumpção, P.P.; Santos, N.P.C.d.; Santos, S. Pharmacogenomic Profile of Amazonian Amerindians. J. Pers. Med. 2022, 12, 952. https://doi.org/10.3390/jpm12060952
Rodrigues JCG, Fernandes MR, Ribeiro-dos-Santos AM, de Araújo GS, de Souza SJ, Guerreiro JF, Ribeiro-dos-Santos Â, de Assumpção PP, Santos NPCd, Santos S. Pharmacogenomic Profile of Amazonian Amerindians. Journal of Personalized Medicine. 2022; 12(6):952. https://doi.org/10.3390/jpm12060952
Chicago/Turabian StyleRodrigues, Juliana Carla Gomes, Marianne Rodrigues Fernandes, André Maurício Ribeiro-dos-Santos, Gilderlanio Santana de Araújo, Sandro José de Souza, João Farias Guerreiro, Ândrea Ribeiro-dos-Santos, Paulo Pimentel de Assumpção, Ney Pereira Carneiro dos Santos, and Sidney Santos. 2022. "Pharmacogenomic Profile of Amazonian Amerindians" Journal of Personalized Medicine 12, no. 6: 952. https://doi.org/10.3390/jpm12060952