Methylation Status of Exon IV of the Brain-Derived Neurotrophic Factor (BDNF)-Encoding Gene in Patients with Non-Diabetic Hyperglycaemia (NDH) before and after a Lifestyle Intervention
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Samples
4.2. DNA Methylation
4.3. Gene Expression
4.4. Serum Protein and Other Assays
4.5. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gunstad, J.; Benitez, A.; Smith, J.; Glickman, E.; Spitznagel, M.B.; Alexander, T.; Juvancic-Heltzel, J.; Murray, L. Serum brain-derived neurotrophic factor is associated with cognitive function in healthy older adults. J. Geriatr. Psychiatry Neurol. 2008, 21, 166–170. [Google Scholar] [CrossRef] [PubMed]
- Erickson, K.I.; Voss, M.W.; Prakash, R.S.; Basak, C.; Szabo, A.; Chaddock, L.; Kim, J.S.; Heo, S.; Alves, H.; White, S.M.; et al. Exercise training increases size of hippocampus and improves memory. Proc. Natl. Acad. Sci. USA 2011, 108, 3017–3022. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leibrock, J.; Lottspeich, F.; Hohn, A.; Hofer, M.; Hengerer, B.; Masiakowski, P.; Thoenen, H.; Barde, Y. Molecular cloning and expression of brain-derived neurotrophic factor. Nature 1989, 341, 149–152. [Google Scholar] [CrossRef] [PubMed]
- Eyileten, C.; Kaplon-Cieslicka, A.; Mirowska-Guzel, D.; Małek, L.; Postula, M. Antidiabetic Effect of Brain-Derived Neurotrophic Factor and Its Association with Inflammation in Type 2 Diabetes Mellitus. J. Diabetes Res. 2017, 2017, 2823671. [Google Scholar] [CrossRef] [PubMed]
- Wisse, B.E.; Schwartz, M.W. The skinny on neurotrophins. Nat. Neurosci. 2003, 6, 655–656. [Google Scholar] [CrossRef]
- Ukropec, J.; Ukropcova, B.; Kurdiova, T.; Gasperikova, D.; Klimeš, I. Adipose tissue and skeletal muscle plasticity modulates metabolic health. Arch. Physiol. Biochem. 2008, 114, 357–368. [Google Scholar] [CrossRef]
- Noble, E.E.; Billington, C.J.; Kotz, C.M.; Wang, C. The lighter side of BDNF. Am. J. Physiol. Integr. Comp. Physiol. 2011, 300, R1053–R1069. [Google Scholar] [CrossRef]
- Ono, M.; Itakura, Y.; Nonomura, T.; Nakagawa, T.; Nakayama, C.; Taiji, M.; Noguchi, H. Intermittent administration of brain-derived neurotrophic factor ameliorates glucose metabolism in obese diabetic mice. Metabolism 2000, 49, 129–133. [Google Scholar] [CrossRef]
- Hanyu, O.; Yamatani, K.; Ikarashi, T.; Soda, S.; Maruyama, S.; Kamimura, T.; Kaneko, S.; Hirayama, S.; Suzuki, K.; Nakagawa, O.; et al. Brain-derived neurotrophic factor modulates glucagon secretion from pancreatic alpha cells: Its contribution to glucose metabolism. Diabetes Obes. Metab. 2003, 5, 27–37. [Google Scholar] [CrossRef]
- Gray, J.; Yeo, G.S.; Cox, J.J.; Morton, J.; Adlam, A.-L.R.; Keogh, J.M.; Yanovski, J.A.; El Gharbawy, A.; Han, J.C.; Tung, Y.L.; et al. Hyperphagia, Severe Obesity, Impaired Cognitive Function, and Hyperactivity Associated with Functional Loss of One Copy of the Brain-Derived Neurotrophic Factor (BDNF) Gene. Diabetes 2006, 55, 3366–3371. [Google Scholar] [CrossRef] [Green Version]
- Yeo, G.S.H.; Hung, C.-C.C.; Rochford, J.; Keogh, J.; Gray, J.; Sivaramakrishnan, S.; O’Rahilly, S.; Farooqi, S. A de novo mutation affecting human TrkB associated with severe obesity and developmental delay. Nat. Neurosci. 2004, 7, 1187–1189. [Google Scholar] [CrossRef] [PubMed]
- Wu, L.; Xi, B.; Zhang, M.; Shen, Y.; Zhao, X.; Cheng, H.; Hou, D.; Sun, D.; Ott, J.; Wang, X.; et al. Associations of Six Single Nucleotide Polymorphisms in Obesity-Related Genes with BMI and Risk of Obesity in Chinese Children. Diabetes 2010, 59, 3085–3089. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Skledar, M.; Nikolac, M.; Dodig-Curkovic, K.; Curkovic, M.; Borovecki, F.; Pivac, N. Association between brain-derived neurotrophic factor Val66Met and obesity in children and adolescents. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2012, 36, 136–140. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kernie, S.; Liebl, D.J.; Parada, L.F. BDNF regulates eating behavior and locomotor activity in mice. EMBO J. 2000, 19, 1290–1300. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rios, M.; Fan, G.; Fekete, C.; Kelly, J.; Bates, B.; Kuehn, R.; Lechan, R.M.; Jaenisch, R. Conditional Deletion of Brain-Derived Neurotrophic Factor in the Postnatal Brain Leads to Obesity and Hyperactivity. Mol. Endocrinol. 2001, 15, 1748–1757. [Google Scholar] [CrossRef] [PubMed]
- Gabir, M.M.; Hanson, R.L.; Dabelea, D.; Imperatore, G.; Roumain, J.; Bennett, P.H.; Knowler, W.C. The 1997 American Diabetes Association and 1999 World Health Organization criteria for hyperglycemia in the diagnosis and prediction of diabetes. Diabetes Care 2000, 23, 1108–1112. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Malipatil, N.; Fachim, H.A.; Siddals, K.; Geary, B.; Wark, G.; Porter, N.; Anderson, S.; Donn, R.; Harvie, M.; Whetton, A.D.; et al. Data Independent Acquisition Mass Spectrometry Can Identify Circulating Proteins That Predict Future Weight Loss with a Diet and Exercise Programme. J. Clin. Med. 2019, 8, 141. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fachim, H.A.; Loureiro, C.M.; Siddals, K.; Dalton, C.F.; Reynolds, G.P.; Gibson, J.M.; Chen, Z.B.; Heald, A.H. Circulating microRNA changes in patients with impaired glucose regulation. Adipocyte 2020, 9, 443–453. [Google Scholar] [CrossRef]
- Heald, A.H.; Kaushal, K.; Siddals, K.W.; Rudenski, A.S.; Anderson, S.G.; Gibson, J.M. Insulin-like Growth Factor Binding Protein-2 (IGFBP-2) is a Marker for the Metabolic Syndrome. Exp. Clin. Endocrinol. Diabetes 2006, 114, 371–376. [Google Scholar] [CrossRef]
- Kang, H.S.; Cho, H.C.; Lee, J.H.; Oh, G.T.; Koo, S.H.; Park, B.H.; Lee, I.K.; Choi, H.S.; Song, D.K.; Im, S.S. Metformin stimulates IGFBP-2 gene expression through PPARalpha in diabetic states. Sci. Rep. 2016, 6, 23665. [Google Scholar] [CrossRef]
- Ceccarini, G.; Pelosini, C.; Ferrari, F.; Magno, S.; Vitti, J.; Salvetti, G.; Moretto, C.; Marioni, A.; Buccianti, P.; Piaggi, P.; et al. Serum IGF-binding protein 2 (IGFBP-2) concentrations change early after gastric bypass bariatric surgery revealing a possible marker of leptin sensitivity in obese subjects. Endocrine 2019, 65, 86–93. [Google Scholar] [CrossRef] [PubMed]
- Malheiros, R.T.; Delgado, H.O.; Felber, D.T.; Kraus, S.I.; Dos Santos, A.R.S.; Manfredini, V.; Da Silva, M.D. Mood disorders are associated with the reduction of brain derived neurotrophic factor in the hypocampus in rats submitted to the hipercaloric diet. Metab. Brain Dis. 2020, 36, 145–151. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Han, X.; Zhou, X.; Zhang, S.; Cai, X.; Zhang, L.; Li, Y.; Li, M.; Gong, S.; Ji, L. Brain derived neurotrophic factor in newly diagnosed diabetes and prediabetes. Mol. Cell. Endocrinol. 2016, 429, 106–113. [Google Scholar] [CrossRef]
- Esvald, E.-E.; Tuvikene, J.; Sirp, A.; Patil, S.; Bramham, C.R.; Timmusk, T. CREB Family Transcription Factors Are Major Mediators of BDNF Transcriptional Autoregulation in Cortical Neurons. J. Neurosci. 2020, 40, 1405–1426. [Google Scholar] [CrossRef] [PubMed]
- Marosi, K.; Mattson, M.P. BDNF mediates adaptive brain and body responses to energetic challenges. Trends Endocrinol. Metab. 2013, 25, 89–98. [Google Scholar] [CrossRef] [Green Version]
- Guzzardi, M.; Sanguinetti, E.; Bartoli, A.; Kemeny, A.; Panetta, D.; Salvadori, P.A.; Burchielli, S.; Iozzo, P. Elevated glycemia and brain glucose utilization predict BDNF lowering since early life. J. Cereb. Blood Flow Metab. 2017, 38, 447–455. [Google Scholar] [CrossRef]
- Krabbe, K.S.; Nielsen, A.R.; Krogh-Madsen, R.; Plomgaard, P.; Rasmussen, P.; Erikstrup, C.; Fischer, C.; Lindegaard, B.; Petersen, A.M.W.; Taudorf, S.; et al. Brain-derived neurotrophic factor (BDNF) and type 2 diabetes. Diabetologia 2006, 50, 431–438. [Google Scholar] [CrossRef]
- Zhen, Y.F.; Zhang, J.; Liu, X.Y.; Fang, H.; Tian, L.B.; Zhou, D.H.; Kosten, T.R.; Zhang, X.Y. Low BDNF is associated with cognitive deficits in patients with type 2 diabetes. Psychopharmacology 2012, 227, 93–100. [Google Scholar] [CrossRef]
- Fachim, H.A.; Corsi-Zuelli, F.; Loureiro, C.M.; Iamjan, S.-A.; Shuhama, R.; Joca, S.; Menezes, P.R.; Heald, A.; Louzada-Junior, P.; Dalton, C.F.; et al. Early-life stress effects on BDNF DNA methylation in first-episode psychosis and in rats reared in isolation. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2020, 108, 110188. [Google Scholar] [CrossRef]
Primers | |
---|---|
BDNF | F 5′GATTTTGGTAATTAGTGTATTAGAGTGTT3′ R 5′CCCCATCAACCAAAAACTCCATTTAATCTC3′ Seq 5′GGTAGAGGAGGTATTATATGATAG3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fachim, H.A.; Malipatil, N.; Siddals, K.; Donn, R.; Cortés, G.Y.; Dalton, C.F.; Gibson, J.M.; Heald, A.H. Methylation Status of Exon IV of the Brain-Derived Neurotrophic Factor (BDNF)-Encoding Gene in Patients with Non-Diabetic Hyperglycaemia (NDH) before and after a Lifestyle Intervention. Epigenomes 2022, 6, 7. https://doi.org/10.3390/epigenomes6010007
Fachim HA, Malipatil N, Siddals K, Donn R, Cortés GY, Dalton CF, Gibson JM, Heald AH. Methylation Status of Exon IV of the Brain-Derived Neurotrophic Factor (BDNF)-Encoding Gene in Patients with Non-Diabetic Hyperglycaemia (NDH) before and after a Lifestyle Intervention. Epigenomes. 2022; 6(1):7. https://doi.org/10.3390/epigenomes6010007
Chicago/Turabian StyleFachim, Helene A., Nagaraj Malipatil, Kirk Siddals, Rachelle Donn, Gabriela Y. Cortés, Caroline F. Dalton, J. Martin Gibson, and Adrian H. Heald. 2022. "Methylation Status of Exon IV of the Brain-Derived Neurotrophic Factor (BDNF)-Encoding Gene in Patients with Non-Diabetic Hyperglycaemia (NDH) before and after a Lifestyle Intervention" Epigenomes 6, no. 1: 7. https://doi.org/10.3390/epigenomes6010007