Rutaecarpine Protects against Acetaminophen-Induced Acute Liver Injury in Mice by Activating Antioxidant Enzymes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Animals and Treatments
2.3. Histopathological Examination
2.4. Biochemical Analysis
2.5. ELISA
2.6. RNA Extraction and Real-Time PCR
2.7. Western Blot
2.8. Statistical Analysis
3. Results
3.1. Rut Pretreatment Suppressed APAP-Induced Hepatotoxicity by Attenuating CYP2E1
3.2. Rut Pretreatment Suppressed APAP-Induced Proinflammatory Cytokines by Inhibiting NF-κB Signaling
3.3. Rut Pretreatment Prevented APAP-Reduced Antioxidant Enzymes by Activating Nrf2
3.4. Rut Pretreatment Attenuated APAP-Induced Hepatotoxicity by Inhibiting JNK1/2 Signaling
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Andrade, R.J.; Aithal, G.P.; Björnsson, E.S.; Kaplowitz, N.; Kullak-Ublick, G.A.; Larrey, D.; Karlsen, T.H. EASL Clinical Practice Guidelines: Drug-induced liver injury. J. Hepatol. 2019, 70, 1222–1261. [Google Scholar] [CrossRef] [Green Version]
- Larson, A.M.; Polson, J.; Fontana, R.J.; Davern, T.J.; Lalani, E.; Hynan, L.S.; Reisch, J.S.; Schiodt, F.V.; Ostapowicz, G.; Shakil, A.O.; et al. Acetaminophen-induced acute liver failure: Results of a United States multicenter, prospective study. Hepatology 2005, 42, 1364–1372. [Google Scholar] [CrossRef]
- Hinson, J.A.; Roberts, D.W.; James, L.P. Mechanisms of acetaminophen-induced liver necrosis. Handb. Exp. Pharmacol. 2010, 196, 369–405. [Google Scholar] [CrossRef] [Green Version]
- Nourjah, P.; Ahmad, S.R.; Karwoski, C.; Willy, M. Estimates of acetaminophen (Paracetomal)-associated overdoses in the United States. Pharmacoepidemiol. Drug Saf. 2006, 15, 398–405. [Google Scholar] [CrossRef] [PubMed]
- Budnitz, D.S.; Lovegrove, M.C.; Crosby, A.E. Emergency department visits for overdoses of acetaminophen-containing products. Am. J. Prev. Med. 2011, 40, 585–592. [Google Scholar] [CrossRef] [PubMed]
- Kuna, L.; Bozic, I.; Kizivat, T.; Bojanic, K.; Mrso, M.; Kralj, E.; Smolic, R.; Wu, G.Y.; Smolic, M. Models of Drug Induced Liver Injury (DILI)—Current Issues and Future Perspectives. Curr. Drug Metab. 2018, 19, 830–838. [Google Scholar] [CrossRef] [PubMed]
- Madrigal-Santillan, E.; Madrigal-Bujaidar, E.; Alvarez-Gonzalez, I.; Sumaya-Martinez, M.T.; Gutierrez-Salinas, J.; Bautista, M.; Morales-Gonzalez, A.; Garcia-Luna y Gonzalez-Rubio, M.; Aguilar-Faisal, J.L.; Morales-Gonzalez, J.A. Review of natural products with hepatoprotective effects. World J. Gastroenterol. 2014, 20, 14787–14804. [Google Scholar] [CrossRef]
- Cao, H.; Chai, T.T.; Wang, X.; Morais-Braga, M.F.B.; Yang, J.H.; Wong, F.C.; Wang, R.; Yao, H.; Cao, J.; Cornara, L.; et al. Phytochemicals from fern species: Potential for medicine applications. Phytochem. Rev. 2017, 16, 379–440. [Google Scholar] [CrossRef]
- Cui, X.; Wang, S.; Cao, H.; Guo, H.; Li, Y.; Xu, F.; Zheng, M.; Xi, X.; Han, C. A Review: The Bioactivities and Pharmacological Applications of Polygonatum sibiricum polysaccharides. Molecules 2018, 23, 1170. [Google Scholar] [CrossRef] [Green Version]
- Tian, K.M.; Li, J.J.; Xu, S.W. Rutaecarpine: A promising cardiovascular protective alkaloid from Evodia rutaecarpa (Wu Zhu Yu). Pharmacol. Res. 2019, 141, 541–550. [Google Scholar] [CrossRef]
- Hu, X.; Li, D.; Chu, C.; Li, X.; Wang, X.; Jia, Y.; Hua, H.; Xu, F. Antiproliferative Effects of Alkaloid Evodiamine and Its Derivatives. Int. J. Mol. Sci. 2018, 19, 3403. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jin, S.W.; Hwang, Y.P.; Choi, C.Y.; Kim, H.G.; Kim, S.J.; Kim, Y.; Chung, Y.C.; Lee, K.J.; Jeong, T.C.; Jeong, H.G. Protective effect of rutaecarpine against t-BHP-induced hepatotoxicity by upregulating antioxidant enzymes via the CaMKII-Akt and Nrf2/ARE pathways. Food Chem. Toxicol. 2017, 100, 138–148. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.H.; Jin, S.W.; Choi, C.Y.; Kim, H.G.; Kim, S.J.; Lee, H.S.; Chung, Y.C.; Kim, E.J.; Lee, Y.C.; Jeong, H.G. Saponins from the roots of Platycodon grandiflorum ameliorate high fat diet-induced non-alcoholic steatohepatitis. Biomed. Pharmacother. 2017, 86, 205–212. [Google Scholar] [CrossRef] [PubMed]
- Gum, S.I.; Cho, M.K. Korean red ginseng extract prevents APAP-induced hepatotoxicity through metabolic enzyme regulation: The role of ginsenoside Rg3, a protopanaxadiol. Liver Int. 2013, 33, 1071–1084. [Google Scholar] [CrossRef] [PubMed]
- Sanz-Garcia, C.; Ferrer-Mayorga, G.; Gonzalez-Rodriguez, A.; Valverde, A.M.; Martin-Duce, A.; Velasco-Martin, J.P.; Regadera, J.; Fernandez, M.; Alemany, S. Sterile inflammation in acetaminophen-induced liver injury is mediated by Cot/tpl2. J. Biol. Chem. 2013, 288, 15342–15351. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, J.; Zhang, S.; Bi, J.; Gu, J.; Deng, Y.; Liu, C. Astaxanthin pretreatment attenuates acetaminophen-induced liver injury in mice. Int. Immunopharmacol. 2017, 45, 26–33. [Google Scholar] [CrossRef]
- Ding, Y.; Li, Q.; Xu, Y.; Chen, Y.; Deng, Y.; Zhi, F.; Qian, K. Attenuating Oxidative Stress by Paeonol Protected against Acetaminophen-Induced Hepatotoxicity in Mice. PLoS ONE 2016, 11, e0154375. [Google Scholar] [CrossRef]
- Shen, H.; Sheng, L.; Chen, Z.; Jiang, L.; Su, H.; Yin, L.; Omary, M.B.; Rui, L. Mouse hepatocyte overexpression of NF-kappaB-inducing kinase (NIK) triggers fatal macrophage-dependent liver injury and fibrosis. Hepatology 2014, 60, 2065–2076. [Google Scholar] [CrossRef] [Green Version]
- Shi, L.; Hao, Z.; Zhang, S.; Wei, M.; Lu, B.; Wang, Z.; Ji, L. Baicalein and baicalin alleviate acetaminophen-induced liver injury by activating Nrf2 antioxidative pathway: The involvement of ERK1/2 and PKC. Biochem. Pharmacol. 2018, 150, 9–23. [Google Scholar] [CrossRef]
- Yan, M.; Ye, L.; Yin, S.; Lu, X.; Liu, X.; Lu, S.; Cui, J.; Fan, L.; Kaplowitz, N.; Hu, H. Glycycoumarin protects mice against acetaminophen-induced liver injury predominantly via activating sustained autophagy. Br. J. Pharmacol. 2018, 175, 3747–3757. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.; Song, Q.; Han, X.; Zhang, Y.; Zhang, Y.; Zhang, X.; Chu, X.; Zhang, F.; Chu, L. Multi-targeted protection of acetaminophen-induced hepatotoxicity in mice by tannic acid. Int. Immunopharmacol. 2017, 47, 95–105. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Liu, J.; Zhang, X.; Zhao, S.; Zou, K.; Xie, J.; Wang, X.; Liu, C.; Wang, J.; Wang, Y. Seabuckthorn berry polysaccharide extracts protect against acetaminophen induced hepatotoxicity in mice via activating the Nrf-2/HO-1-SOD-2 signaling pathway. Phytomedicine 2018, 38, 90–97. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Hu, J.N.; Yan, M.H.; Xing, J.J.; Liu, W.C.; Li, W. Caspase-Mediated Anti-Apoptotic Effect of Ginsenoside Rg5, a Main Rare Ginsenoside, on Acetaminophen-Induced Hepatotoxicity in Mice. J. Agric. Food Chem. 2017, 65, 9226–9236. [Google Scholar] [CrossRef] [PubMed]
- Hussain, Z.; Khan, J.A.; Arshad, A.; Asif, P.; Rashid, H.; Arshad, M.I. Protective effects of Cinnamomum zeylanicum L. (Darchini) in acetaminophen-induced oxidative stress, hepatotoxicity and nephrotoxicityin mouse model. Biomed. Pharmacother. 2019, 109, 2285–2292. [Google Scholar] [CrossRef]
- Xie, W.; Jiang, Z.; Wang, J.; Zhang, X.; Melzig, M.F. Protective effect of hyperoside against acetaminophen (APAP) induced liver injury through enhancement of APAP clearance. Chem. Biol. Interact. 2016, 246, 11–19. [Google Scholar] [CrossRef]
- Wang, W.; Guan, C.; Sun, X.; Zhao, Z.; Li, J.; Fu, X.; Qiu, Y.; Huang, M.; Jin, J.; Huang, Z. Tanshinone IIA protects against acetaminophen-induced hepatotoxicity via activating the Nrf2 pathway. Phytomedicine 2016, 23, 589–596. [Google Scholar] [CrossRef]
- Jaeschke, H.; McGill, M.R.; Ramachandran, A. Oxidant stress, mitochondria, and cell death mechanisms in drug-induced liver injury: Lessons learned from acetaminophen hepatotoxicity. Drug Metab. Rev. 2012, 44, 88–106. [Google Scholar] [CrossRef] [Green Version]
- Lv, H.; Xiao, Q.; Zhou, J.; Feng, H.; Liu, G.; Ci, X. Licochalcone A Upregulates Nrf2 Antioxidant Pathway and Thereby Alleviates Acetaminophen-Induced Hepatotoxicity. Front. Pharmacol. 2018, 9, 147. [Google Scholar] [CrossRef] [Green Version]
- Xu, X.Y.; Hu, J.N.; Liu, Z.; Zhang, R.; He, Y.F.; Hou, W.; Wang, Z.Q.; Yang, G.; Li, W. Saponins (Ginsenosides) from the Leaves of Panax quinquefolius Ameliorated Acetaminophen-Induced Hepatotoxicity in Mice. J. Agric. Food Chem. 2017, 65, 3684–3692. [Google Scholar] [CrossRef]
- Yang, C.; Yi, J.; Gong, X.; Ge, P.; Dai, J.; Lin, L.; Xing, Y.; Zhang, L. Anti-oxidative and anti-inflammatory benefits of the ribonucleoside analogue 5-azacitidine in mice with acetaminophen-induced toxic hepatitis. Int. Immunopharmacol. 2017, 48, 91–95. [Google Scholar] [CrossRef]
- Yang, G.; Zhang, L.; Ma, L.; Jiang, R.; Kuang, G.; Li, K.; Tie, H.; Wang, B.; Chen, X.; Xie, T.; et al. Glycyrrhetinic acid prevents acetaminophen-induced acute liver injury via the inhibition of CYP2E1 expression and HMGB1-TLR4 signal activation in mice. Int. Immunopharmacol. 2017, 50, 186–193. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Zhang, S.; Cheng, H.; Lv, H.; Cheng, G.; Ci, X. Nrf2-mediated liver protection by esculentoside A against acetaminophen toxicity through the AMPK/Akt/GSK3beta pathway. Free Radic. Biol. Med. 2016, 101, 401–412. [Google Scholar] [CrossRef] [PubMed]
- Kaspar, J.W.; Niture, S.K.; Jaiswal, A.K. Nrf2:INrf2 (Keap1) signaling in oxidative stress. Free Radic. Biol. Med. 2009, 47, 1304–1309. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Sequences | NCBI Number | |
---|---|---|---|
TNF-α | F | TTGTCTACTCCCAGGTTCTCTT | NM_001278601.1 |
R | ACTTTCTCCTGGTATGAGATAGC | ||
IL-1β | F | GAAAGAATCTATACCTGTCCTGTGTAA | NM_008361.4 |
R | CTTCTATCTTGTTGAAGACAAACCG | ||
IL-6 | F | ATACAGAAACTCTAATTCATATCTTCAACC | NM_031168.2 |
R | AGCTTATCTGTTAGGAGAGCAT | ||
β-actin | F | CCACCAGTTCGCCATGGAT | NM_007393.5 |
R | CCACGATGGAGGGGAATACA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Choi, J.H.; Jin, S.W.; Lee, G.H.; Han, E.H.; Hwang, Y.P.; Jeong, H.G. Rutaecarpine Protects against Acetaminophen-Induced Acute Liver Injury in Mice by Activating Antioxidant Enzymes. Antioxidants 2021, 10, 86. https://doi.org/10.3390/antiox10010086
Choi JH, Jin SW, Lee GH, Han EH, Hwang YP, Jeong HG. Rutaecarpine Protects against Acetaminophen-Induced Acute Liver Injury in Mice by Activating Antioxidant Enzymes. Antioxidants. 2021; 10(1):86. https://doi.org/10.3390/antiox10010086
Chicago/Turabian StyleChoi, Jae Ho, Sun Woo Jin, Gi Ho Lee, Eun Hee Han, Yong Pil Hwang, and Hye Gwang Jeong. 2021. "Rutaecarpine Protects against Acetaminophen-Induced Acute Liver Injury in Mice by Activating Antioxidant Enzymes" Antioxidants 10, no. 1: 86. https://doi.org/10.3390/antiox10010086