Maqui Berry and Ginseng Extracts Reduce Cigarette Smoke-Induced Cell Injury in a 3D Bone Co-Culture Model
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemical Reagents, Cell Culture Medium
2.2. The Preparation of GEL Scaffolds
2.3. Cell Lines
2.4. The Construction of the 3D Bone Cell Co-Culture System
2.5. The Preparation of Cigarette Smoke Extract (CSE) and Antioxidants
2.6. Resazurin Conversion Assay
2.7. Total DNA Isolation and Quantification
2.8. Alkaline Phosphatase (AP) Activity
2.9. Tartrate-Resistant Acid Phosphatase (TRAP) 5b Activity
2.10. Carbonic Anhydrase II (CAII) Activity
2.11. RT-PCR Analysis
2.12. Dot Blot Analysis
2.13. Western Blot
2.14. Immunofluorescence Staining
2.15. Statistical Analysis
3. Results
3.1. Cytotoxicity Tests of MBE, GE, and NAC
3.2. MBE and GE Suppressed Osteoclast Function in Bone Cells Exposed to CSE
3.3. MBE and GE Enhanced Osteogenic Differentiation and Inhibited Osteoclastic Differentiation in Bone Cells Exposed to CSE
3.4. MBE and GE Enhanced Osteoblast Function in Bone Cells Exposed to CSE
3.5. MBE and GE Reduced CSE-Induced Cell Injury by Downregulation of sRANKL: OPG Ratio and NF-κB Signaling Pathways
3.6. MBE and GE Prevented CSE-Induced Cell Injury by Activating Nrf 2 Signaling Pathway
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mortimer, P.M.; Mc Intyre, S.A.; Thomas, D.C. Beyond the Extra Respiration of Phagocytosis: NADPH Oxidase 2 in Adaptive Immunity and Inflammation. Front. Immunol. 2021, 12, 733918. [Google Scholar] [CrossRef] [PubMed]
- Heher, P.; Ganassi, M.; Weidinger, A.; Engquist, E.N.; Pruller, J.; Nguyen, T.H.; Tassin, A.; Declèves, A.E.; Mamchaoui, K.; Banerji, C.; et al. Interplay between mitochondrial reactive oxygen species, oxidative stress and hypoxic adaptation in facioscapulohumeral muscular dystrophy: Metabolic stress as potential therapeutic target. Redox Biol. 2022, 51, 102251. [Google Scholar] [CrossRef] [PubMed]
- Deng, W.; Ding, Z.; Wang, Y.; Zou, B.; Zheng, J.; Tan, Y.; Yang, Q.; Ke, M.; Chen, Y.; Wang, S.; et al. Dendrobine attenuates osteoclast differentiation through modulating ROS/NFATc1/MMP9 pathway and prevents inflammatory bone destruction. Phytomedicine 2022, 96, 153838. [Google Scholar] [CrossRef]
- Torre, M.F.; Martinez-Ferran, M.; Vallecillo, N.; Jiménez, S.L.; Romero-Morales, C.; Pareja-Galeano, H. Supplementation with Vitamins C and E and Exercise-Induced Delayed-Onset Muscle Soreness: A Systematic Review. Antioxidants 2021, 10, 279. [Google Scholar] [CrossRef]
- Zanaty, M.I.; Abdel-Moneim, A.; Kitani, Y.; Sekiguchi, T.; Suzuki, N. Effect of Omeprazole on Osteoblasts and Osteoclasts in vivo and in the in vitro Model Using Fish Scales. Biochem. Mosc. 2021, 86, 1192–1200. [Google Scholar] [CrossRef]
- Ren, J.; Yu, R.; Xue, J.; Tang, Y.; Su, S.; Liao, C.; Guo, Q.; Guo, W.; Zheng, J. How Do Extracellular Vesicles Play a Key Role in the Maintenance of Bone Homeostasis and Regeneration? A Comprehensive Review of Literature. Int. J. Nanomed. 2022, 17, 5375–5389. [Google Scholar] [CrossRef] [PubMed]
- Weng, W.; Häussling, V.; Aspera-Werz, R.H.; Springer, F.; Rinderknecht, H.; Braun, B.; Küper, M.A.; Nussler, A.K.; Ehnert, B. Material-Dependent Formation and Degradation of Bone Matrix-Comparison of Two Cryogels. Bioengineering 2020, 7, 52. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Ding, J.; Xu, P.; Feng, X.; Wang, Z.; Zhou, T.; Tu, C.; Cao, W.; Xie, J.; Deng, L.; et al. A cell-free ROS-responsive hydrogel/oriented poly(lactide-co-glycolide) hybrid scaffold for reducing inflammation and restoring full-thickness cartilage defectsin vivo. Biomed. Mater. 2021, 16, 064101. [Google Scholar] [CrossRef]
- Ringh, M.V.; Hagemann-Jensen, M.; Needhamsen, M.; Kular, L.; Breeze, C.E.; Sjöholm, L.K.; Slavec, L.; Kullberg, S.; Wahlström, J.; Grunewald, J.; et al. Tobacco smoking induces changes in true DNA methylation, hydroxymethylation and gene expression in bronchoalveolar lavage cells. EBioMedicine 2019, 46, 290–304. [Google Scholar] [CrossRef] [Green Version]
- Camici, G.G.; Savarese, G.; Akhmedov, A.; Lüscher, T.F. Molecular mechanism of endothelial and vascular aging: Implications for cardiovascular disease. Eur. Heart J. 2015, 36, 3392–3403. [Google Scholar] [CrossRef]
- Morris, P.B.; Ference, B.A.; Jahangir, E.; Feldman, D.N.; Ryan, J.J.; Bahrami, H.; El-Chami, M.F.; Bhakta, S.; Winchester, D.E.; Al-Mallah, M.H.; et al. Cardiovascular Effects of Exposure to Cigarette Smoke and Electronic Cigarettes: Clinical Perspectives From the Prevention of Cardiovascular Disease Section Leadership Council and Early Career Councils of the American College of Cardiology. J. Am. Coll. Cardiol. 2015, 66, 1378–1391. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, H.; Wallin, M.; Barregard, L.; Sallsten, G.; Lundh, T.; Ohlsson, C.; Mellström, D.; Andersson, E.M. Smoking-Induced Risk of Osteoporosis Is Partly Mediated by Cadmium From Tobacco Smoke: The MrOS Sweden Study. J. Bone Miner. Res. 2020, 35, 1424–1429. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aspera-Werz, R.H.; Ehnert, S.; Heid, D.; Zhu, S.; Chen, T.; Braun, B.; Sreekumar, V.; Arnscheidt, C.; Nussler, A.K. Nicotine and Cotinine Inhibit Catalase and Glutathione Reductase Activity Contributing to the Impaired Osteogenesis of SCP-1 Cells Exposed to Cigarette Smoke. Oxidative Med. Cell. Longev. 2018, 2018, 3172480. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, S.; Häussling, V.; Aspera-Werz, R.H.; Chen, T.; Braun, B.; Weng, W.; Histing, T.; Nussler, A.K. Bisphosphonates Reduce Smoking-Induced Osteoporotic-Like Alterations by Regulating RANKL/OPG in an Osteoblast and Osteoclast Co-Culture Model. Int. J. Mol. Sci. 2020, 22, 53. [Google Scholar] [CrossRef] [PubMed]
- Aspera-Werz, R.H.; Chen, T.; Ehnert, S.; Zhu, S.; Fröhlich, T.; Nussler, A.K. Cigarette Smoke Induces the Risk of Metabolic Bone Diseases: Transforming Growth Factor Beta Signaling Impairment via Dysfunctional Primary Cilia Affects Migration, Proliferation, and Differentiation of Human Mesenchymal Stem Cells. Int. J. Mol. Sci. 2019, 20, 2915. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hao, Z.; Li, J.; Li, B.; Alder, K.D.; Cahill, S.V.; Munger, A.M.; Lee, I.; Kwon, H.K.; Back, J.; Xu, S.; et al. Smoking Alters Inflammation and Skeletal Stem and Progenitor Cell Activity During Fracture Healing in Different Murine Strains. J. Bone Miner. Res. 2021, 36, 186–198. [Google Scholar] [CrossRef]
- Zhu, S.; Aspera-Werz, R.H.; Chen, T.; Weng, W.; Braun, B.; Histing, T.; Nüssler, A.K. Maqui berry extract prevents cigarette smoke induced oxidative stress in human osteoblasts in vitro. EXCLI J. 2021, 20, 281–296. [Google Scholar]
- Watson, R.R.; Schönlau, F. Nutraceutical and antioxidant effects of a delphinidin-rich maqui berry extract Delphinol®: A review. Minerva Cardioangiol. 2015, 63 (Suppl. 1), 1–12. [Google Scholar]
- Corrêa, M.G.; Absy, S.; Tenenbaum, H.; Ribeiro, F.V.; Cirano, F.R.; Casati, M.Z.; Pimentel, S.P. Resveratrol attenuates oxidative stress during experimental periodontitis in rats exposed to cigarette smoke inhalation. J. Periodont. Res. 2019, 54, 225–232. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhu, J.; Meng, X.; Liu, S.; Mu, J.; Ning, C. Comparison of polyphenol, anthocyanin and antioxidant capacity in four varieties of Lonicera caerulea berry extracts. Food Chem. 2016, 197, 522–529. [Google Scholar] [CrossRef]
- Sandoval, V.; Femenias, A.; Martínez-Garza, Ú.; Sanz-Lamora, H.; Castagnini, J.M.; Quifer-Rada, P.; Lamuela-Raventós, R.M.; Marrero, P.F.; Haro, D.; Relat, J. Lyophilized Maqui (Aristotelia chilensis) Berry Induces Browning in the Subcutaneous White Adipose Tissue and Ameliorates the Insulin Resistance in High Fat Diet-Induced Obese Mice. Antioxidants 2019, 8, 360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, L.; Zhou, G.; Meng, X.S.; Fu, H.Y.; Mo, Q.G.; Wang, Y.W. Photoprotection of maqui berry against ultraviolet B-induced photodamage in vitro and in vivo. Food Funct. 2020, 11, 2749–2762. [Google Scholar] [CrossRef] [PubMed]
- Hidalgo, J.; Flores, C.; Hidalgo, M.A.; Perez, M.; Yañez, A.; Quiñones, L.; Caceres, D.D.; Burgos, R.A. Delphinol® standardized maqui berry extract reduces postprandial blood glucose increase in individuals with impaired glucose regulation by novel mechanism of sodium glucose cotransporter inhibition. Panminerva Med. 2014, 56 (Suppl. 3), 1–7. [Google Scholar]
- Tenci, M.; Rossi, S.; Giannino, V.; Vigani, B.; Sandri, G.; Bonferoni, M.C.; Daglia, M.; Longo, L.M.; Macelloni, C.; Ferrari, F. An In Situ Gelling System for the Local Treatment of Inflammatory Bowel Disease (IBD). The Loading of Maqui (Aristotelia chilensis) Berry Extract as an Antioxidant and Anti-Inflammatory Agent. Pharmaceutics 2019, 11, 611. [Google Scholar] [CrossRef] [Green Version]
- Cho, S.K.; Kim, D.; Yoo, D.; Jang, E.J.; Jun, J.B.; Sung, Y.K. Korean Red Ginseng exhibits no significant adverse effect on disease activity in patients with rheumatoid arthritis: A randomized, double-blind, crossover study. J. Ginseng Res. 2018, 42, 144–148. [Google Scholar] [CrossRef]
- Kim, K.H.; Lee, D.; Lee, H.L.; Kim, C.E.; Jung, K.; Kang, K.S. Beneficial effects of Panax ginseng for the treatment and prevention of neurodegenerative diseases: Past findings and future directions. J. Ginseng Res. 2018, 42, 239–247. [Google Scholar] [CrossRef]
- Baik, I.H.; Kim, K.H.; Lee, K.A. Antioxidant, Anti-Inflammatory and Antithrombotic Effects of Ginsenoside Compound K Enriched Extract Derived from Ginseng Sprouts. Molecules 2021, 26, 4102. [Google Scholar] [CrossRef]
- Kim, H.M.; Song, Y.; Hyun, G.H.; Long, N.P.; Park, J.H.; Hsieh, Y.; Kwon, S.W. Characterization and Antioxidant Activity Determination of Neutral and Acidic Polysaccharides from Panax ginseng C. A. Meyer. Molecules 2020, 25, 791. [Google Scholar] [CrossRef] [Green Version]
- Guo, M.; Shao, S.; Wang, D.; Zhao, D.; Wang, M. Recent progress in polysaccharides from Panax ginseng C. A. Meyer. Food Funct. 2021, 12, 494–518. [Google Scholar] [CrossRef]
- Nguyen, T.; Huynh, D.; Jin, Y.; Jeon, H.; Heo, K.S. Protective effects of ginsenoside-Rg2 and -Rh1 on liver function through inhibiting TAK1 and STAT3-mediated inflammatory activity and Nrf2/ARE-mediated antioxidant signaling pathway. Arch. Pharm. Res. 2021, 44, 241–252. [Google Scholar] [CrossRef]
- Park, C.M.; Kim, H.M.; Kim, D.H.; Han, H.J.; Noh, H.; Jang, J.H.; Park, S.H.; Chae, H.J.; Chae, S.W.; Ryu, E.K.; et al. Ginsenoside Re Inhibits Osteoclast Differentiation in Mouse Bone Marrow-Derived Macrophages and Zebrafish Scale Model. Mol. Cells 2016, 39, 855–861. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, H.; Zhang, Q.; Li, W.; Li, H.; Bao, J.; Yang, C.; Wang, A.; Wei, J.; Chen, S.; Jin, H. Role of Nrf2 in the antioxidation and oxidative stress induced developmental toxicity of honokiol in zebrafish. Toxicol. Appl. Pharmacol. 2019, 373, 48–61. [Google Scholar] [CrossRef] [PubMed]
- Guo, S.; Fei, H.D.; Ji, F.; Chen, F.L.; Xie, Y.; Wang, S.G. Activation of Nrf2 by MIND4-17 protects osteoblasts from hydrogen peroxide-induced oxidative stress. Oncotarget 2017, 8, 105662–105672. [Google Scholar] [CrossRef] [PubMed]
- Rangasamy, T.; Cho, C.Y.; Thimmulappa, R.K.; Zhen, L.; Srisuma, S.S.; Kensler, T.W.; Yamamoto, M.; Petrache, I.; Tuder, R.M.; Biswal, S. Genetic ablation of Nrf2 enhances susceptibility to cigarette smoke-induced emphysema in mice. J. Clin. Investig. 2004, 114, 1248–1259. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Zhu, Y.; Zheng, S.; Ni, C.; Zhao, L.; Liu, C.; Chen, A.; Xiao, J. Amiloride inhibits osteoclastogenesis by suppressing nuclear factor-κB and mitogen-activated protein kinase activity in receptor activator of nuclear factor-κB-induced RAW264.7 cells. Mol. Med. Rep. 2015, 11, 3451–3456. [Google Scholar] [CrossRef] [Green Version]
- Qian, Z.; Zhong, Z.; Ni, S.; Li, D.; Zhang, F.; Zhou, Y.; Kang, Z.; Qian, J.; Yu, B. Cytisine attenuates bone loss of ovariectomy mouse by preventing RANKL-induced osteoclastogenesis. J. Cell. Mol. Med. 2020, 24, 10112–10127. [Google Scholar] [CrossRef]
- Chen, G.; Huang, L.; Wu, X.; Liu, X.; Xu, Q.; Li, F.; Dai, M.; Zhang, B. Adiponectin inhibits osteoclastogenesis by suppressing NF-κB and p38 signaling pathways. Biochem. Biophys. Res. Commun. 2018, 503, 2075–2082. [Google Scholar] [CrossRef]
- Chen, R.; Liu, G.; Sun, X.; Cao, X.; He, W.; Lin, X.; Liu, Q.; Zhao, J.; Pang, Y.; Li, B.; et al. Chitosan derived nitrogen-doped carbon dots suppress osteoclastic osteolysis via downregulating ROS. Nanoscale 2020, 12, 16229–16244. [Google Scholar] [CrossRef]
- Jiang, T.; Kai, D.; Liu, S.; Huang, X.; Heng, S.; Zhao, J.; Chan, B.; Loh, X.J.; Zhu, Y.; Mao, C.; et al. Mechanically cartilage-mimicking poly(PCL-PTHF urethane)/collagen nanofibers induce chondrogenesis by blocking NF-kappa B signaling pathway. Biomaterials 2018, 178, 281–292. [Google Scholar] [CrossRef]
- Jimi, E.; Takakura, N.; Hiura, F.; Nakamura, I.; Hirata-Tsuchiya, S. The Role of NF-κB in Physiological Bone Development and Inflammatory Bone Diseases: Is NF-κB Inhibition “Killing Two Birds with One Stone”. Cells 2019, 8, 1636. [Google Scholar] [CrossRef] [Green Version]
- Böcker, W.; Yin, Z.; Drosse, I.; Haasters, F.; Rossmann, O.; Wierer, M.; Popov, C.; Locher, M.; Mutschler, W.; Docheva, D.; et al. Introducing a single-cell-derived human mesenchymal stem cell line expressing hTERT after lentiviral gene transfer. J. Cell. Mol. Med. 2008, 12, 1347–1359. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Häussling, V.; Aspera-Werz, R.H.; Rinderknecht, H.; Springer, F.; Arnscheidt, C.; Menger, M.M.; Histing, T.; Nussler, A.K.; Ehnert, S. 3D Environment Is Required In Vitro to Demonstrate Altered Bone Metabolism Characteristic for Type 2 Diabetics. Int. J. Mol. Sci. 2021, 22, 2925. [Google Scholar] [CrossRef] [PubMed]
- Sreekumar, V.; Aspera-Werz, R.; Ehnert, S.; Strobel, J.; Tendulkar, G.; Heid, D.; Schreiner, A.; Arnscheidt, C.; Nussler, A.K. Resveratrol protects primary cilia integrity of human mesenchymal stem cells from cigarette smoke to improve osteogenic differentiation in vitro. Arch. Toxicol. 2018, 92, 1525–1538. [Google Scholar] [CrossRef] [PubMed]
- Braun, K.F.; Ehnert, S.; Freude, T.; Egaña, J.T.; Schenck, T.L.; Buchholz, A.; Schmitt, A.; Siebenlist, S.; Schyschka, L.; Neumaier, M.; et al. Quercetin protects primary human osteoblasts exposed to cigarette smoke through activation of the antioxidative enzymes HO-1 and SOD-1. Sci. World J. 2011, 11, 2348–2357. [Google Scholar] [CrossRef] [Green Version]
- Su, Y.; Han, W.; Giraldo, C.; De Li, Y.; Block, E.R. Effect of cigarette smoke extract on nitric oxide synthase in pulmonary artery endothelial cells. Am. J. Respir. Cell Mol. Biol. 1998, 19, 819–825. [Google Scholar] [CrossRef] [Green Version]
- Weng, W.; Zanetti, F.; Bovard, D.; Braun, B.; Ehnert, S.; Uynuk-Ool, T.; Histing, T.; Hoeng, J.; Nussler, A.K.; Aspera-Werz, R.H. A simple method for decellularizing a cell-derived matrix for bone cell cultivation and differentiation. J. Mater. Sci. Mater. Med. 2021, 32, 124. [Google Scholar] [CrossRef]
- Chen, Y.; Menger, M.M.; Braun, B.J.; Schweizer, S.; Linnemann, C.; Falldorf, K.; Ronniger, M.; Wang, H.; Histing, T.; Nussler, A.K.; et al. Modulation of Macrophage Activity by Pulsed Electromagnetic Fields in the Context of Fracture Healing. Bioengineering 2021, 8, 167. [Google Scholar] [CrossRef]
- Kim, Y.; Kim, D.M.; Kim, J.Y. Ginger Extract Suppresses Inflammatory Response and Maintains Barrier Function in Human Colonic Epithelial Caco-2 Cells Exposed to Inflammatory Mediators. J. Food Sci. 2017, 82, 1264–1270. [Google Scholar] [CrossRef]
- Chen, E.A.; Lin, Y.S. Using synthetic peptides and recombinant collagen to understand DDR-collagen interactions. Biochim. Biophys. Acta Mol. Cell Res. 2019, 1866, 118458. [Google Scholar] [CrossRef]
- Khalmuratova, R.; Shin, H.W.; Kim, D.W.; Park, J.W. Interleukin (IL)-13 and IL-17A contribute to neo-osteogenesis in chronic rhinosinusitis by inducing RUNX2. EBioMedicine 2019, 46, 330–341. [Google Scholar] [CrossRef] [Green Version]
- Xu, H.; Cai, L.; Zhang, L.; Wang, G.; Xie, R.; Jiang, Y.; Yuan, Y.; Nie, H. Paeoniflorin ameliorates collagen-induced arthritis via suppressing nuclear factor-κB signalling pathway in osteoclast differentiation. Immunology 2018, 154, 593–603. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, G.; Sul, O.J.; Yu, R.; Choi, H.S. 7-Ketocholesterol-Induced Micro-RNA-107-5p Increases Number and Activity of Osteoclasts by Targeting MKP1. Int. J. Mol. Sci. 2022, 23, 3697. [Google Scholar] [CrossRef] [PubMed]
- Silva, R.; Borges, A.; Hernandéz-Gatón, P.; de Queiroz, A.M.; Arzate, H.; Romualdo, P.C.; Nelson-Filho, P.; Silva, L. Histopathological, histoenzymological, immunohistochemical and immunofluorescence analysis of tissue response to sealing materials after furcation perforation. Int. Endod. J. 2019, 52, 1489–1500. [Google Scholar] [CrossRef] [PubMed]
- Depner, C.M.; Rice, J.D.; Tussey, E.J.; Eckel, R.H.; Bergman, B.C.; Higgins, J.A.; Melanson, E.L.; Kohrt, W.M.; Wright, K.P., Jr.; Swanson, C.M. Bone turnover marker responses to sleep restriction and weekend recovery sleep. Bone 2021, 152, 116096. [Google Scholar] [CrossRef]
- Li, M.; Chow, S.; Wong, R.; Qin, L.; Cheung, W.H. The role of osteocytes-specific molecular mechanism in regulation of mechanotransduction-A systematic review. J. Orthop. Transl. 2021, 29, 1–9. [Google Scholar] [CrossRef]
- Napolitano, G.; Fasciolo, G.; Venditti, P. Mitochondrial Management of Reactive Oxygen Species. Antioxidants 2021, 10, 1824. [Google Scholar] [CrossRef]
- Wang, P.; Zhang, S.; Liu, W.; Chen, S.; Lv, X.; Hu, B.; Shao, Z. Selenium Attenuates TBHP-Induced Apoptosis of Nucleus Pulposus Cells by Suppressing Mitochondrial Fission through Activating Nuclear Factor Erythroid 2-Related Factor 2. Oxidative Med. Cell. Longev. 2022, 2022, 7531788. [Google Scholar] [CrossRef]
- Tao, S.; Liu, P.; Luo, G.; Rojo de la Vega, M.; Chen, H.; Wu, T.; Tillotson, J.; Chapman, E.; Zhang, D.D. p97 Negatively Regulates NRF2 by Extracting Ubiquitylated NRF2 from the KEAP1-CUL3 E3 Complex. Mol. Cell. Biol. 2017, 37, e00660-16. [Google Scholar] [CrossRef] [Green Version]
- Sun, C.; Han, B.; Zhai, Y.; Zhao, H.; Li, X.; Qian, J.; Hao, X.; Liu, Q.; Shen, J.; Kai, G. Dihydrotanshinone I inhibits ovarian tumor growth by activating oxidative stress through Keap1-mediated Nrf2 ubiquitination degradation. Free Radic. Biol. Med. 2022, 180, 220–235. [Google Scholar] [CrossRef]
- Han, J.; Yang, K.; An, J.; Jiang, N.; Fu, S.; Tang, X. The Role of NRF2 in Bone Metabolism-Friend or Foe. Front. Endocrinol. 2022, 13, 813057. [Google Scholar] [CrossRef]
- Wang, Y.; Jin, R.; Chen, J.; Cao, J.; Xiao, J.; Li, X.; Sun, C. Tangeretin maintains antioxidant activity by reducing CUL3 mediated NRF2 ubiquitination. Food Chem. 2021, 365, 130470. [Google Scholar] [CrossRef] [PubMed]
- Yue, H.; Tian, Y.; Li, Y.; Bai, X.; Wang, X.; Wang, Y.; Li, Z.; Xue, C.; Wang, J. Comparative study of holothurin A and echinoside A on inhibiting the high bone turnover via downregulating PI3K/AKT/β-catenin and OPG/RANKL/NF-κB signaling in ovariectomized mice. Food Funct. 2022, 13, 4748–4756. [Google Scholar] [CrossRef] [PubMed]
- Cao, Z.; Liu, G.; Zhang, H.; Wang, M.; Xu, Y. Nox4 promotes osteoblast differentiation through TGF-beta signal pathway. Free Radic. Biol. Med. 2022, 193, 595–609. [Google Scholar] [CrossRef]
- Ye, J.; Yao, J.P.; Wang, X.; Zheng, M.; Li, P.; He, C.; Wan, J.B.; Yao, X.; Su, H. Neuroprotective effects of ginsenosides on neural progenitor cells against oxidative injury. Mol. Med. Rep. 2016, 13, 3083–3091. [Google Scholar] [CrossRef] [Green Version]
- Kužma, M.; Jackuliak, P.; Killinger, Z.; Payer, J. Parathyroid Hormone-Related Changes of Bone Structure. Physiol. Res. 2021, 70, S3–S11. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Li, J.; Xie, X.; Gu, F.; Sui, Z.; Zhang, K.; Yu, T. Recent Advances in Osteoclast Biological Behavior. Front. Cell Dev. Biol. 2021, 9, 788680. [Google Scholar] [CrossRef]
- Walsh, M.C.; Choi, Y. Regulation of T cell-associated tissues and T cell activation by RANKL-RANK-OPG. J. Bone Miner. Metab. 2021, 39, 54–63. [Google Scholar] [CrossRef]
- Yahiro, Y.; Maeda, S.; Morikawa, M.; Koinuma, D.; Jokoji, G.; Ijuin, T.; Komiya, S.; Kageyama, R.; Miyazono, K.; Taniguchi, N. BMP-induced Atoh8 attenuates osteoclastogenesis by suppressing Runx2 transcriptional activity and reducing the Rankl/Opg expression ratio in osteoblasts. Bone Res. 2020, 8, 32. [Google Scholar] [CrossRef]
- Popova, E.N.; Pletjushkina, O.Y.; Dugina, V.B.; Domnina, L.V.; Ivanova, O.Y.; Izyumov, D.S.; Skulachev, V.P.; Chernyak, B.V. Scavenging of reactive oxygen species in mitochondria induces myofibroblast differentiation. Antioxid. Redox Signal. 2010, 13, 1297–1307. [Google Scholar] [CrossRef]
- Rhodes, C.A.; Dougherty, P.G.; Cooper, J.K.; Qian, Z.; Lindert, S.; Wang, Q.E.; Pei, D. Cell-Permeable Bicyclic Peptidyl Inhibitors against NEMO-IκB Kinase Interaction Directly from a Combinatorial Library. J. Am. Chem. Soc. 2018, 140, 12102–12110. [Google Scholar] [CrossRef]
- Tsay, J.; Yang, Z.; Ross, F.P.; Cunningham-Rundles, S.; Lin, H.; Coleman, R.; Mayer-Kuckuk, P.; Doty, S.B.; Grady, R.W.; Giardina, P.J.; et al. Bone loss caused by iron overload in a murine model: Importance of oxidative stress. Blood 2010, 116, 2582–2589. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kumar, S.; Mabalirajan, U.; Rehman, R.; Singh, B.K.; Parmar, V.S.; Prasad, A.K.; Biswal, S.; Ghosh, B. A novel cinnamate derivative attenuates asthma features and reduces bronchial epithelial injury in mouse model. Int. Immunopharmacol. 2013, 15, 150–159. [Google Scholar] [CrossRef] [PubMed]
- Nagaoka, M.; Maeda, T.; Chatani, M.; Handa, K.; Yamakawa, T.; Kiyohara, S.; Negishi-Koga, T.; Kato, Y.; Takami, M.; Niida, S.; et al. A Delphinidin-Enriched Maqui Berry Extract Improves Bone Metabolism and Protects against Bone Loss in Osteopenic Mouse Models. Antioxidants 2019, 8, 386. [Google Scholar] [CrossRef] [PubMed]
- Hwang, J.W.; Oh, J.H.; Yoo, H.S.; Lee, Y.W.; Cho, C.K.; Kwon, K.R.; Yoon, J.H.; Park, J.; Her, S.; Lee, Z.W.; et al. Mountain ginseng extract exhibits anti-lung cancer activity by inhibiting the nuclear translocation of NF-κB. Am. J. Chin. Med. 2012, 40, 187–202. [Google Scholar] [CrossRef] [PubMed]
- Song, S.B.; Tung, N.H.; Quang, T.H.; Ngan, N.T.; Kim, K.E.; Kim, Y.H. Inhibition of TNF-α-mediated NF-κB Transcriptional Activity in HepG2 Cells by Dammarane-type Saponins from Panax ginseng Leaves. J. Ginseng Res. 2012, 36, 146–152. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.H.; Choi, Y.K.; Lee, K.S.; Cho, D.H.; Baek, Y.Y.; Lee, D.K.; Ha, K.S.; Choe, J.; Won, M.H.; Jeoung, D.; et al. Functional dissection of Nrf2-dependent phase II genes in vascular inflammation and endotoxic injury using Keap1 siRNA. Free Radic. Biol. Med. 2012, 53, 629–640. [Google Scholar] [CrossRef]
- Lee, D.; Kook, S.H.; Ji, H.; Lee, S.A.; Choi, K.C.; Lee, K.Y.; Lee, J.C. N-acetyl cysteine inhibits H2O2-mediated reduction in the mineralization of MC3T3-E1 cells by down-regulating Nrf2/HO-1 pathway. BMB Rep. 2015, 48, 636–641. [Google Scholar] [CrossRef] [Green Version]
- Bernard, G.R.; Wheeler, A.P.; Arons, M.M.; Morris, P.E.; Paz, H.L.; Russell, J.A.; Wright, P.E.; The Antioxidant in ARDS Study Group. A trial of antioxidants N-acetylcysteine and procysteine in ARDS. Chest 1997, 112, 164–172. [Google Scholar] [CrossRef]
- Sagristá, M.L.; García, A.E.; Africa De Madariaga, M.; Mora, M. Antioxidant and pro-oxidant effect of the thiolic compounds N-acetyl-L-cysteine and glutathione against free radical-induced lipid peroxidation. Free Radic. Res. 2002, 36, 329–340. [Google Scholar] [CrossRef]
- Byon, C.H.; Javed, A.; Dai, Q.; Kappes, J.C.; Clemens, T.L.; Darley-Usmar, V.M.; McDonald, J.M.; Chen, Y. Oxidative stress induces vascular calcification through modulation of the osteogenic transcription factor Runx2 by AKT signaling. J. Biol. Chem. 2008, 283, 15319–15327. [Google Scholar] [CrossRef]
Gene | Accession Number | Forward Primer (5′–3′) | Reverse Primer (5′–3′) | Length (bp) | Ta (°C) | Cycles |
---|---|---|---|---|---|---|
Collagen 1 | NM_000088.3 | CAGCCGCTTCACCTACAGC | TTTTGTATTCAATCACTGTCTTGCC | 83 | 56 | 35 |
Runx2 | NM_001024630.4 | CTGTGGTTACTGTCATGGCG | GGGAGGATTTGTGAAGACGGT | 170 | 60 | 35 |
NFATc1 | NM_172390.2 | TGCAAGCCGAATTCTCTGGT | CTTTACGGCGACGTCGTTTC | 228 | 64 | 40 |
TRAP 5b | NM_001111035.1 | TTCCAGGAGACCTTTGAGGA | TAGGCAGTGACCCCGTATGT | 452 | 58 | 35 |
MMP9 | NM_004994.3 | ATGAGCCTCTGGCAGCCCCT | CCGTGCTCCGCGACACCAAA | 527 | 60 | 35 |
18s rRNA | NR_003286 | GGACAGGATTGACAGATTGAT | AGTCTCGTTCGTTATCGGAAT | 111 | 56 | 25 |
Antibody | Order# | Company | Dilution |
---|---|---|---|
Soluble receptor activator of nuclear factor kappa-B ligand (sRANKL) | sc-11383 | Santa Cruz, Heidelberg, Germany | 1:1000 |
Osteoprotegerin (OPG) | 500-P149 | Peprotech, Hamburg, Germany | 1:1000 |
Procollagen type I N-terminal propeptide (PINP) | abx131414 | Abbexa, Aachen, Germany | 1:1000 |
Alkaline phosphatase (AP) | sc-23430 | Santa Cruz, Heidelberg, Germany | 1:1000 |
Osteocalcin (OCN) | sc-365797 | Santa Cruz, Heidelberg, Germany | 1:1000 |
Goat anti-rabbit IgG-HRP | sc-2004 | Santa Cruz, Heidelberg, Germany | 1:10,000 |
Donkey anti-goat IgG | sc-2020 | Santa Cruz, Heidelberg, Germany | 1:10,000 |
Goat anti-mouse IgM | sc-2064 | Santa Cruz, Heidelberg, Germany | 1:10,000 |
Antibody | Order# | Company | Dilution |
---|---|---|---|
Phospho nuclear factor erythroid-2-related factor-2 (p-Nrf2) | ab76026 | Abcam, Cambridge, UK | 1:1000 |
Nuclear factor kappa-B (NF-κB) | sc-109 | Santa Cruz, Heidelberg, Germany | 1:1000 |
Phospho extracellular regulated protein kinases1/2 (p-ERK1/2) | 4370 | Cell Signaling, Massachusetts, USA | 1:1000 |
Superoxide dismutase 1 (SOD1) | sc-11407 | Santa Cruz, Heidelberg, Germany | 1:1000 |
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | sc-365797 | Santa Cruz, Heidelberg, Germany | 1:1000 |
Goat anti-rabbit IgG-HRP | sc-2004 | Santa Cruz, Heidelberg, Germany | 1:10,000 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, H.; Weng, W.; Zhang, S.; Rinderknecht, H.; Braun, B.; Breinbauer, R.; Gupta, P.; Kumar, A.; Ehnert, S.; Histing, T.; et al. Maqui Berry and Ginseng Extracts Reduce Cigarette Smoke-Induced Cell Injury in a 3D Bone Co-Culture Model. Antioxidants 2022, 11, 2460. https://doi.org/10.3390/antiox11122460
Guo H, Weng W, Zhang S, Rinderknecht H, Braun B, Breinbauer R, Gupta P, Kumar A, Ehnert S, Histing T, et al. Maqui Berry and Ginseng Extracts Reduce Cigarette Smoke-Induced Cell Injury in a 3D Bone Co-Culture Model. Antioxidants. 2022; 11(12):2460. https://doi.org/10.3390/antiox11122460
Chicago/Turabian StyleGuo, Huizhi, Weidong Weng, Shuncong Zhang, Helen Rinderknecht, Bianca Braun, Regina Breinbauer, Purva Gupta, Ashok Kumar, Sabrina Ehnert, Tina Histing, and et al. 2022. "Maqui Berry and Ginseng Extracts Reduce Cigarette Smoke-Induced Cell Injury in a 3D Bone Co-Culture Model" Antioxidants 11, no. 12: 2460. https://doi.org/10.3390/antiox11122460