Na+/K+-ATPase Alpha 2 Isoform Elicits Rac1-Dependent Oxidative Stress and TLR4-Induced Inflammation in the Hypothalamic Paraventricular Nucleus in High Salt-Induced Hypertension
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. General Experimental Protocol
2.2.1. Part I: The Effect of High Salt Diet on NKA Subunits, Na+/K+-ATPase, Oxidative Stress, and Inflammation in the PVN
2.2.2. Part II: The Effect of NKA α2 in the PVN on Rac1-Dependent Oxidative Stress and TLR4-Induced Inflammation in Salt-Induced Hypertension
2.3. NKA α2 shRNA Adenovirus-Associated Virus Preparation
2.4. Bilateral PVN Microinjection of Adenovirus-Associated Virus
2.5. Measurement of Mean Arterial Blood Pressure
2.6. Immunofluorescence and Immunohistochemistry
2.7. Western Blotting
2.8. Real-Time PCR
2.9. Enzyme-Linked Immunosorbent Assay (ELISA) Results
2.10. ELISA for Ouabain-Like Compound (OLC)
2.11. Statistical Analysis
3. Results and Statistical Analyses
3.1. Effect of High Salt Diet on NKA Subunits, Na+/K+-ATPase, Oxidative Stress, and Inflammation in the PVN
3.2. Effect of Decreased NKA α2 in the PVN on Mean Arterial Blood Pressure, Sympathetic Activity, NKA, and ADP/ATP Ratio in Salt-Induced Hypertension
3.3. Effect of Decreased NKA α2 in the PVN on the Level of NKA α2, PKC γ, and p-Rac1 in Salt-induced Hypertension
3.4. Effect of Decreased NKA α2 Expression in the PVN on Oxidative Stress in Salt-Induced Hypertension
3.5. Effect of Decreased NKA α2 Expression in the PVN on the Expression of TLR4 and MyD88 in Rats with Salt-Induced Hypertension
3.6. Effect of Decreased NKA α2 Expression in the PVN on the Expression of TLR4, MyD88, NF-κB p65, TNF-α, and Caspase-3 in Rats with Salt-Induced Hypertension
3.7. Effect of Decreased NKA α2 Expression in the PVN on Cytokine Levels in Rats with Salt-Induced Hypertension
4. Discussion
5. Limitations
6. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Blaustein, M.P.; Leenen, F.H.; Chen, L.; Golovina, V.A.; Hamlyn, J.M.; Pallone, T.L.; Van Huysse, J.W.; Zhang, J.; Wier, W.G. How NaCl raises blood pressure: A new paradigm for the pathogenesis of salt-dependent hypertension. Am. J. Physiol. Heart Circ. Physiol. 2012, 302, H1031–H1049. [Google Scholar] [CrossRef] [Green Version]
- Borsody, M.; Semenov, I.; Carroll, K.; Kessler, A.; Dubow, J.; Olson, E.; Stern, J.; Barion, A.; Hammond, C.; Van Stavern, G.; et al. The relation of brain ouabain-like compounds and idiopathic intracranial hypertension. Headache 2006, 46, 1255–1260. [Google Scholar] [CrossRef]
- Leenen, F.H.; Harmsen, E.; Yu, H.; Yuan, B. Dietary sodium stimulates ouabainlike activity in adrenalectomized spontaneously hypertensive rats. Am. J. Physiol. 1993, 265, H421–H424. [Google Scholar] [CrossRef]
- Siman, F.D.; Stefanon, I.; Vassallo, D.V.; Padilha, A.S. A low concentration of ouabain (0.18 microg/kg) enhances hypertension in spontaneously hypertensive rats by inhibiting the Na+ pump and activating the renin-angiotensin system. Braz. J. Med. Biol. Res. Rev. Bras. Pesqui. Med. Biol. 2010, 43, 767–776. [Google Scholar] [CrossRef] [Green Version]
- Dvela, M.; Rosen, H.; Ben-Ami, H.C.; Lichtstein, D. Endogenous ouabain regulates cell viability. Am. J. Physiol. Cell Physiol. 2012, 302, C442–C452. [Google Scholar] [CrossRef] [Green Version]
- Staehr, C.; Rajanathan, R.; Matchkov, V.V. Involvement of the Na(+), K(+)-ATPase isoforms in control of cerebral perfusion. Exp. Physiol. 2019, 104, 1023–1028. [Google Scholar] [CrossRef]
- Namazi, G.; Asa, P.; Sarrafzadegan, N.; Pourfarzam, M. Decreased Na+/K+-ATPase Activity and Altered Susceptibility to Peroxidation and Lipid Composition in the Erythrocytes of Metabolic Syndrome Patients with Coronary Artery Disease. Ann. Nutr. Metab. 2019, 74, 140–148. [Google Scholar] [CrossRef]
- Srikanthan, K.; Shapiro, J.I.; Sodhi, K. The Role of Na/K-ATPase Signaling in Oxidative Stress Related to Obesity and Cardiovascular Disease. Molecules 2016, 21, 1172. [Google Scholar] [CrossRef] [Green Version]
- Pendyala, G.; Buescher, J.L.; Fox, H.S. Methamphetamine and inflammatory cytokines increase neuronal Na+/K+-ATPase isoform 3: Relevance for HIV associated neurocognitive disorders. PLoS ONE 2012, 7, e37604. [Google Scholar] [CrossRef]
- Yang, S.; Yan, T.; Zhao, L.; Wu, H.; Du, Z.; Xiao, Q. Effects of temperature on activities of antioxidant enzymes and Na(+)/K(+)-ATPase, and hormone levels in Schizothorax prenanti. J. Therm. Biol. 2018, 72, 155–160. [Google Scholar] [CrossRef]
- Kinoshita, P.F.; Yshii, L.M.; Orellana, A.M.M.; Paixao, A.G.; Vasconcelos, A.R.; Lima, L.S.; Kawamoto, E.M.; Scavone, C. Alpha 2 Na(+),K(+)-ATPase silencing induces loss of inflammatory response and ouabain protection in glial cells. Sci. Rep. 2017, 7, 4894. [Google Scholar] [CrossRef] [Green Version]
- Watts, A.G.; Sanchez-Watts, G.; Emanuel, J.R.; Levenson, R. Cell-specific expression of mRNAs encoding Na+,K(+)-ATPase alpha- and beta-subunit isoforms within the rat central nervous system. Proc. Natl. Acad. Sci. USA 1991, 88, 7425–7429. [Google Scholar] [CrossRef] [Green Version]
- Mata, M.; Siegel, G.J.; Hieber, V.; Beaty, M.W.; Fink, D.J. Differential distribution of (Na,K)-ATPase alpha isoform mRNAs in the peripheral nervous system. Brain Res. 1991, 546, 47–54. [Google Scholar] [CrossRef]
- Corthesy-Theulaz, I.; Merillat, A.M.; Honegger, P.; Rossier, B.C. Na(+)-K(+)-ATPase gene expression during in vitro development of rat fetal forebrain. Am. J. Physiol. 1990, 258, C1062–C1069. [Google Scholar] [CrossRef]
- Van Huysse, J.W. Endogenous brain Na pumps, brain ouabain-like substance and the alpha2 isoform in salt-dependent hypertension. Pathophysiol. Off. J. Int. Soc. Pathophysiol. 2007, 14, 213–220. [Google Scholar]
- Herrera, V.L.; Cova, T.; Sassoon, D.; Ruiz-Opazo, N. Developmental cell-specific regulation of Na(+)-K(+)-ATPase alpha 1-, alpha 2-, and alpha 3-isoform gene expression. Am. J. Physiol. 1994, 266, C1301–C1312. [Google Scholar] [CrossRef]
- Skou, J.C.; Esmann, M. The Na,K-ATPase. J. Bioenerg. Biomembr. 1992, 24, 249–261. [Google Scholar]
- Lingrel, J.B.; Williams, M.T.; Vorhees, C.V.; Moseley, A.E. Na,K-ATPase and the role of alpha isoforms in behavior. J. Bioenerg. Biomembr. 2007, 39, 385–389. [Google Scholar] [CrossRef]
- Hou, X.; Theriault, S.F.; Dostanic-Larson, I.; Moseley, A.E.; Lingrel, J.B.; Wu, H.; Dean, S.; Van Huysse, J.W. Enhanced pressor response to increased CSF sodium concentration and to central ANG I in heterozygous alpha2 Na+-K+-ATPase knockout mice. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2009, 296, R1427–R1438. [Google Scholar]
- Zhang, D.D.; Liang, Y.F.; Qi, J.; Kang, K.B.; Yu, X.J.; Gao, H.L.; Liu, K.L.; Chen, Y.M.; Shi, X.L.; Xin, G.R.; et al. Carbon Monoxide Attenuates High Salt-Induced Hypertension While Reducing Pro-inflammatory Cytokines and Oxidative Stress in the Paraventricular Nucleus. Cardiovasc. Toxicol. 2019, 19, 451–464. [Google Scholar] [CrossRef]
- Ngarashi, D.; Fujikawa, K.; Ferdaus, M.Z.; Zahid, H.M.; Ohara, H.; Nabika, T. Dual inhibition of NADPH oxidases and xanthine oxidase potently prevents salt-induced stroke in stroke-prone spontaneously hypertensive rats. Hypertens. Res. Off. J. Jpn. Soc. Hypertens. 2019, 42, 981–989. [Google Scholar] [CrossRef]
- Zheng, X.; Li, X.; Chen, M.; Yang, P.; Zhao, X.; Zeng, L.; OuYang, Y.; Yang, Z.; Tian, Z. The protective role of hawthorn fruit extract against high salt-induced hypertension in Dahl salt-sensitive rats: Impact on oxidative stress and metabolic patterns. Food Funct. 2019, 10, 849–858. [Google Scholar] [CrossRef]
- Yu, X.J.; Miao, Y.W.; Li, H.B.; Su, Q.; Liu, K.L.; Fu, L.Y.; Hou, Y.K.; Shi, X.L.; Li, Y.; Mu, J.J.; et al. Blockade of Endogenous Angiotensin-(1-7) in Hypothalamic Paraventricular Nucleus Attenuates High Salt-Induced Sympathoexcitation and Hypertension. Neurosci. Bull. 2019, 35, 47–56. [Google Scholar] [CrossRef]
- Banek, C.T.; Gauthier, M.M.; Van Helden, D.A.; Fink, G.D.; Osborn, J.W. Renal Inflammation in DOCA-Salt Hypertension. Hypertension 2019, 73, 1079–1086. [Google Scholar] [CrossRef]
- Wang, M.L.; Yu, X.J.; Li, X.G.; Pang, D.Z.; Su, Q.; Saahene, R.O.; Li, H.B.; Mao, X.Y.; Liu, K.L.; Fu, L.Y.; et al. Blockade of TLR4 Within the Paraventricular Nucleus Attenuates Blood Pressure by Regulating ROS and Inflammatory Cytokines in Prehypertensive Rats. Am. J. Hypertens. 2018, 31, 1013–1023. [Google Scholar] [CrossRef]
- Su, Q.; Huo, C.J.; Li, H.B.; Liu, K.L.; Li, X.; Yang, Q.; Song, X.A.; Chen, W.S.; Cui, W.; Zhu, G.Q.; et al. Renin-angiotensin system acting on reactive oxygen species in paraventricular nucleus induces sympathetic activation via AT1R/PKCgamma/Rac1 pathway in salt-induced hypertension. Sci. Rep. 2017, 7, 43107. [Google Scholar] [CrossRef]
- Li, H.B.; Li, X.; Huo, C.J.; Su, Q.; Guo, J.; Yuan, Z.Y.; Zhu, G.Q.; Shi, X.L.; Liu, J.J.; Kang, Y.M. TLR4/MyD88/NF-kappaB signaling and PPAR-gamma within the paraventricular nucleus are involved in the effects of telmisartan in hypertension. Toxicol. Appl. Pharmacol. 2016, 305, 93–102. [Google Scholar] [CrossRef]
- Wang, Y.; Thatcher, S.E.; Cassis, L.A. Measuring Blood Pressure Using a Noninvasive Tail Cuff Method in Mice. Methods Mol. Biol. 2017, 1614, 69–73. [Google Scholar]
- Xia, W.J.; Xu, M.L.; Yu, X.J.; Du, M.M.; Li, X.H.; Yang, T.; Li, L.; Li, Y.; Kang, K.B.; Su, Q.; et al. Antihypertensive effects of exercise involve reshaping of gut microbiota and improvement of gut-brain axis in spontaneously hypertensive rat. Gut Microbes 2021, 13, 1–24. [Google Scholar] [CrossRef]
- Lupia, E.; Spatola, T.; Cuccurullo, A.; Bosco, O.; Mariano, F.; Pucci, A.; Ramella, R.; Alloatti, G.; Montrucchio, G. Thrombopoietin modulates cardiac contractility in vitro and contributes to myocardial depressing activity of septic shock serum. Basic Res. Cardiol. 2010, 105, 609–620. [Google Scholar] [CrossRef]
- Li, H.B.; Yang, T.; Richards, E.M.; Pepine, C.J.; Raizada, M.K. Maternal Treatment With Captopril Persistently Alters Gut-Brain Communication and Attenuates Hypertension of Male Offspring. Hypertension 2020, 75, 1315–1324. [Google Scholar] [CrossRef]
- Li, Y.; Salih Ibrahim, R.M.; Chi, H.L.; Xiao, T.; Xia, W.J.; Li, H.B.; Kang, Y.M. Altered Gut Microbiota is Involved in the Anti-Hypertensive Effects of Vitamin C in Spontaneously Hypertensive Rat. Mol. Nutr. Food Res. 2021, 65, e2000885. [Google Scholar] [CrossRef]
- Guo, N.; Ai, W.; Jiang, X.; Ren, Y.; Tian, G.; Xue, X. Low-dose Exogenous Ouabain Alleviates Cardiac Lipotoxicity Through Suppressing Expression of CD36. J. Cardiovasc. Pharmacol. 2016, 67, 39–46. [Google Scholar] [CrossRef]
- Zhang, M.J.; Yang, J.; Ge, H.; Qiang, L.; Duan, Z.M.; Wang, C.X.; Wang, R.; Lu, Z.R. Comparison between anti-ouabain egg yolk(IgY) and rabbit antibody(IgG) in enzyme-linked immunosorbent assay. Zhongguo Ying Yong Sheng Li Xue Za Zhi Zhongguo Yingyong Shenglixue Zazhi Chin. J. Appl. Physiol. 2007, 23, 505–508. [Google Scholar]
- Yang, Y.H.; Wan, Y.; Lou, H.; Xue, T.; Su, P. Relationship between ouabain and asthenozoospermia. J. Huazhong Univ. Sci. Technol. Med. Sci. Hua Zhong Ke Ji Da Xue Xue Bao Yi Xue Ying De Wen Ban Huazhong Keji Daxue Xuebao Yixue Yingdewen Ban 2014, 34, 87–90. [Google Scholar] [CrossRef]
- Zhang, M.J.; Yang, J.; Zhu, C.Z.; Duan, Z.M.; Niu, X.L. Generation and application of anti-ouabain IgY antibodies. Mol. Cell. Biochem. 2011, 358, 241–247. [Google Scholar] [CrossRef]
- Vakkuri, O.; Arnason, S.S.; Joensuu, P.; Jalonen, J.; Vuolteenaho, O.; Leppaluoto, J. Radioiodinated tyrosyl-ouabain and measurement of a circulating ouabain-like compound. Clin. Chem. 2001, 47, 95–101. [Google Scholar] [CrossRef]
- Yoshika, M.; Komiyama, Y.; Takahashi, H. An ouabain-like factor is secreted from immortalized hypothalamic cells in an aldosterone-dependent manner. Neurochem. Int. 2011, 59, 104–108. [Google Scholar] [CrossRef]
- Wang, H.; Leenen, F.H. Brain sodium channels mediate increases in brain “ouabain” and blood pressure in Dahl S rats. Hypertension 2002, 40, 96–100. [Google Scholar] [CrossRef] [Green Version]
- Wang, M.L.; Kang, Y.M.; Li, X.G.; Su, Q.; Li, H.B.; Liu, K.L.; Fu, L.Y.; Saahene, R.O.; Li, Y.; Tan, H.; et al. Central blockade of NLRP3 reduces blood pressure via regulating inflammation microenvironment and neurohormonal excitation in salt-induced prehypertensive rats. J. Neuroinflamm. 2018, 15, 95. [Google Scholar] [CrossRef]
- Yu, X.J.; Zhao, Y.N.; Hou, Y.K.; Li, H.B.; Xia, W.J.; Gao, H.L.; Liu, K.L.; Su, Q.; Yang, H.-Y.; Liang, B.; et al. Chronic Intracerebroventricular Infusion of Metformin Inhibits Salt-Sensitive Hypertension via Attenuation of Oxidative Stress and Neurohormonal Excitation in Rat Paraventricular Nucleus. Neurosci. Bull. 2019, 35, 57–66. [Google Scholar] [CrossRef]
- Leite, J.A.; Isaksen, T.J.; Heuck, A.; Scavone, C.; Lykke-Hartmann, K. The alpha2 Na(+)/K(+)-ATPase isoform mediates LPS-induced neuroinflammation. Sci. Rep. 2020, 10, 14180. [Google Scholar] [CrossRef]
- Valvassori, S.S.; Dal-Pont, G.C.; Steckert, A.V.; Varela, R.B.; Lopes-Borges, J.; Mariot, E.; Resende, W.R.; Arent, C.O.; Carvalho, A.F.; Quevedo, J. Sodium butyrate has an antimanic effect and protects the brain against oxidative stress in an animal model of mania induced by ouabain. Psychiatry Res. 2016, 235, 154–159. [Google Scholar] [CrossRef]
- Riegel, R.E.; Valvassori, S.S.; Moretti, M.; Ferreira, C.L.; Steckert, A.V.; de Souza, B.; Dal-Pizzol, F.; Quevedo, J. Intracerebroventricular ouabain administration induces oxidative stress in the rat brain. Int. J. Dev. Neurosci. Off. J. Int. Soc. Dev. Neurosci. 2010, 28, 233–237. [Google Scholar] [CrossRef]
- Riegel, R.E.; Valvassori, S.S.; Elias, G.; Réus, G.Z.; Steckert, A.V.; de Souza, B.; Petronilho, F.; Gavioli, E.C.; Dal-Pizzol, F.; Quevedo, J. Animal model of mania induced by ouabain: Evidence of oxidative stress in submitochondrial particles of the rat brain. Neurochem. Int. 2009, 55, 491–495. [Google Scholar] [CrossRef]
- Jiang, E.; Chapp, A.D.; Fan, Y.; Larson, R.A.; Hahka, T.; Huber, M.J.; Yan, J.; Chen, Q.H.; Shan, Z. Expression of Proinflammatory Cytokines Is Upregulated in the Hypothalamic Paraventricular Nucleus of Dahl Salt-Sensitive Hypertensive Rats. Front. Physiol. 2018, 9, 104. [Google Scholar] [CrossRef] [Green Version]
- Baumgarten, G.; Knuefermann, P.; Nozaki, N.; Sivasubramanian, N.; Mann, D.L.; Vallejo, J.G. In vivo expression of proinflammatory mediators in the adult heart after endotoxin administration: The role of toll-like receptor-4. J. Infect. Dis. 2001, 183, 1617–1624. [Google Scholar] [CrossRef]
- Dange, R.B.; Agarwal, D.; Masson, G.S.; Vila, J.; Wilson, B.; Nair, A.; Francis, J. Central blockade of TLR4 improves cardiac function and attenuates myocardial inflammation in angiotensin II-induced hypertension. Cardiovasc. Res. 2014, 103, 17–27. [Google Scholar] [CrossRef]
Name | Forward | Reverse |
---|---|---|
NKA α1 | TTGTGGCTCAGTAAAGGACA | CCAATGAGGGTGAGAGCAA |
NKA α2 | GAGACACTGCAGGAGATG | TGAGGAATCACCCACAGG |
NKA α3 | ATCCTGAAGAGGGACGTG | GTGCATGAGACAGAAGACTC |
GAPDH | ATGGAGAAGGCTGGGGCTCACCT | AGCCCTTCCACGATGCCAAAGTTGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Su, Q.; Yu, X.-J.; Wang, X.-M.; Peng, B.; Bai, J.; Li, H.-B.; Li, Y.; Xia, W.-J.; Fu, L.-Y.; Liu, K.-L.; et al. Na+/K+-ATPase Alpha 2 Isoform Elicits Rac1-Dependent Oxidative Stress and TLR4-Induced Inflammation in the Hypothalamic Paraventricular Nucleus in High Salt-Induced Hypertension. Antioxidants 2022, 11, 288. https://doi.org/10.3390/antiox11020288
Su Q, Yu X-J, Wang X-M, Peng B, Bai J, Li H-B, Li Y, Xia W-J, Fu L-Y, Liu K-L, et al. Na+/K+-ATPase Alpha 2 Isoform Elicits Rac1-Dependent Oxidative Stress and TLR4-Induced Inflammation in the Hypothalamic Paraventricular Nucleus in High Salt-Induced Hypertension. Antioxidants. 2022; 11(2):288. https://doi.org/10.3390/antiox11020288
Chicago/Turabian StyleSu, Qing, Xiao-Jing Yu, Xiao-Min Wang, Bo Peng, Juan Bai, Hong-Bao Li, Ying Li, Wen-Jie Xia, Li-Yan Fu, Kai-Li Liu, and et al. 2022. "Na+/K+-ATPase Alpha 2 Isoform Elicits Rac1-Dependent Oxidative Stress and TLR4-Induced Inflammation in the Hypothalamic Paraventricular Nucleus in High Salt-Induced Hypertension" Antioxidants 11, no. 2: 288. https://doi.org/10.3390/antiox11020288