Dim Blue Light at Night Induces Spatial Memory Impairment in Mice by Hippocampal Neuroinflammation and Oxidative Stress
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Treatments
2.2. Y-Maze Test
2.3. Immunohistochemical Staining
2.4. Sholl Analysis
2.5. Double Labeling Immunofluorescence
2.6. Real-Time Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
2.7. Western Blot Assay
2.8. Measurements of Antioxidant Activity and Lipid Peroxidation
2.9. Cell Culture
2.10. MTT Assay
2.11. Cellular Immunofluorescence
2.12. Enzyme-Linked Immunosorbent Assay (ELISA)
2.13. Statistical Analyses
3. Results
3.1. Dim Blue Light at Night Impairs Spatial Learning and Memory Function
3.2. Dim Blue Light at Night Induces Loss of Hippocampal Neurons
3.3. Dim Blue Light at Night Impairs Hippocampal Synaptic Function and Neurogenesis
3.4. Dim Blue Light at Night Induces Oxidative Stress in the Hippocampus
3.5. Dim Blue Light at Night Induces Inflammation in the Hippocampus
3.6. Dim Blue Light at Night Induces Activation of Hippocampal Microglia
3.7. Corticosterone Induces Activation of BV2 Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Voorn, P.; Vanderschuren, L.; Groenewegen, H.J.; Robbins, T.; Pennartz, C. Putting a spin on the dorsal–ventral divide of the striatum. Trends Neurosci. 2004, 27, 468–474. [Google Scholar] [CrossRef]
- Fagiani, F.; Di Marino, D.; Romagnoli, A.; Travelli, C.; Voltan, D.; Mannelli, L.D.C.; Racchi, M.; Govoni, S.; Lanni, C. Molecular regulations of circadian rhythm and implications for physiology and diseases. Signal Transduct. Target. Ther. 2022, 7, 41. [Google Scholar] [CrossRef]
- Hattar, S.; Lucas, R.J.; Mrosovsky, N.; Thompson, S.; Douglas, R.H.; Hankins, M.W.; Lem, J.; Biel, M.; Hofmann, F.; Foster, R.G.; et al. Melanopsin and rod–cone photoreceptive systems account for all major accessory visual functions in mice. Nature 2003, 424, 75–81. [Google Scholar] [CrossRef] [Green Version]
- Muindi, F.; Zeitzer, J.M.; Colas, D.; Heller, H.C. The acute effects of light on murine sleep during the dark phase: Importance of melanopsin for maintenance of light-induced sleep. Eur. J. Neurosci. 2013, 37, 1727–1736. [Google Scholar] [CrossRef]
- Walmsley, L.; Hanna, L.; Mouland, J.W.; Martial, F.; West, A.; Smedley, A.; Bechtold, D.; Webb, A.R.; Lucas, R.J.; Brown, T.M. Colour as a Signal for Entraining the Mammalian Circadian Clock. PLoS Biol. 2015, 13, e1002127. [Google Scholar] [CrossRef]
- Shan, L.L.; Guo, H.; Song, N.N.; Jia, Z.P.; Hu, X.T.; Huang, J.F.; Ding, Y.Q.; Richter-Levin, G.; Zhou, Q.X.; Xu, L. Light exposure before learning improves memory consolidation at night (vol 5, 15578, 2015). Sci. Rep. UK 2016, 6, 19172. [Google Scholar] [CrossRef] [Green Version]
- Namgyal, D.; Chandan, K.; Ali, S.; Ahmad, A.; Hashim, M.J.; Sarwat, M. Aberrant Lighting Causes Anxiety-like Behavior in Mice but Curcumin Ameliorates the Symptoms. Animals 2021, 11, 2590. [Google Scholar] [CrossRef]
- Zhang, S.; Zhang, Y.; Zhang, W.; Chen, S.; Liu, C. Chronic exposure to green light aggravates high-fat diet-induced obesity and metabolic disorders in male mice. Ecotoxicol. Environ. Saf. 2019, 178, 94–104. [Google Scholar] [CrossRef]
- Oh, P.-S.; Hwang, H.; Jeong, H.-S.; Kwon, J.; Kim, H.-S.; Kim, M.; Lim, S.; Sohn, M.-H. Blue light emitting diode induces apoptosis in lymphoid cells by stimulating autophagy. Int. J. Biochem. Cell Biol. 2016, 70, 13–22. [Google Scholar] [CrossRef]
- Kim, M.; Subramanian, M.; Cho, Y.H.; Kim, G.H.; Lee, E.; Park, J.J. Short-term exposure to dim light at night disrupts rhythmic behaviors and causes neurodegeneration in fly models of tauopathy and Alzheimer’s disease. Biochem. Biophys. Res. Commun. 2018, 495, 1722–1729. [Google Scholar] [CrossRef]
- Namgyal, D.; Chandan, K.; Sultan, A.; Aftab, M.; Ali, S.; Mehta, R.; El-Serehy, H.A.; Al-Misned, F.A.; Sarwat, M. Dim Light at Night Induced Neurodegeneration and Ameliorative Effect of Curcumin. Cells 2020, 9, 2093. [Google Scholar] [CrossRef]
- Aubrecht, T.G.; Jenkins, R.; Nelson, R.J. Dim light at night increases body mass of female mice. Chronobiol. Int. 2015, 32, 557–560. [Google Scholar] [CrossRef] [Green Version]
- Fonken, L.K.; Bedrosian, T.A.; Zhang, N.; Weil, Z.M.; DeVries, A.C.; Nelson, R.J. Dim light at night impairs recovery from global cerebral ischemia. Exp. Neurol. 2019, 317, 100–109. [Google Scholar] [CrossRef]
- Fonken, L.K.; Aubrecht, T.G.; Meléndez-Fernández, O.H.; Weil, Z.M.; Nelson, R.J. Dim light at night disrupts molecular circadian rhythms and increases body weight. J. Biol. Rhythm. 2013, 28, 262–271. [Google Scholar] [CrossRef]
- Cho, C.-H.; Lee, H.-J.; Yoon, H.-K.; Kang, S.-G.; Bok, K.-N.; Jung, K.-Y.; Kim, L.; Lee, E.-I. Exposure to dim artificial light at night increases REM sleep and awakenings in humans. Chronobiol. Int. 2016, 33, 117–123. [Google Scholar] [CrossRef]
- LeGates, T.; Fernandez, D.C.; Hattar, S. Light as a central modulator of circadian rhythms, sleep and affect. Nat. Rev. Neurosci. 2014, 15, 443–454. [Google Scholar] [CrossRef]
- Da Cunha, P.L.; Villar, M.E.; Ballarini, F.; Tintorelli, R.; Viola, H.A.M. Spatial object recognition memory formation under acute stress. Hippocampus 2019, 29, 491–499. [Google Scholar] [CrossRef]
- Finsterwald, C.; Alberini, C.M. Stress and glucocorticoid receptor-dependent mechanisms in long-term memory: From adaptive responses to psychopathologies. Neurobiol. Learn. Mem. 2014, 112, 17–29. [Google Scholar] [CrossRef] [Green Version]
- Stackman, R.W.; Cohen, S.J.; Lora, J.C.; Rios, L.M. Temporary inactivation reveals that the CA1 region of the mouse dorsal hippocampus plays an equivalent role in the retrieval of long-term object memory and spatial memory. Neurobiol. Learn. Mem. 2016, 133, 118–128. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhu, M.; Sun, Y.; Tang, B.; Zhang, G.; An, P.; Cheng, Y.; Shan, Y.; Merzenich, M.M.; Zhou, X. Environmental noise degrades hippocampus-related learning and memory. Proc. Natl. Acad. Sci. USA 2021, 118, e2017841117. [Google Scholar] [CrossRef]
- Lian, S.; Wang, D.; Xu, B.; Guo, W.; Wang, L.; Li, W.; Ji, H.; Wang, J.; Kong, F.; Zhen, L.; et al. Prenatal cold stress: Effect on maternal hippocampus and offspring behavior in rats. Behav. Brain Res. 2018, 346, 1–10. [Google Scholar] [CrossRef]
- Cao, J.; Xu, J.; Chen, S.; Fan, F.; Chen, M.; Liu, F.; Li, G. Odor-mediated contextual learning induced memory consolidation and hippocampus development in neonate rat. Neuroreport 2020, 31, 64–68. [Google Scholar] [CrossRef]
- Hasan, S.; Tam, S.K.; Foster, R.G.; Vyazovskiy, V.V.; Bannerman, D.M.; Peirson, S.N. Modulation of recognition memory performance by light and its relationship with cortical EEG theta and gamma activities. Biochem. Pharmacol. 2021, 191, 114404. [Google Scholar] [CrossRef] [PubMed]
- Fernandez, D.C.; Fogerson, P.M.; Ospri, L.L.; Thomsen, M.B.; Layne, R.M.; Severin, D.; Zhan, J.; Singer, J.H.; Kirkwood, A.; Zhao, H.; et al. Light Affects Mood and Learning through Distinct Retina-Brain Pathways. Cell 2018, 175, 71–84. [Google Scholar] [CrossRef] [Green Version]
- Atanasova, D.; Lazarov, N.; Stoyanov, D.S.; Spassov, R.H.; Tonchev, A.B.; Tchekalarova, J. Reduced neuroinflammation and enhanced neurogenesis following chronic agomelatine treatment in rats undergoing chronic constant light. Neuropharmacology 2021, 197, 108706. [Google Scholar] [CrossRef]
- Fujioka, A.; Fujioka, T.; Tsuruta, R.; Izumi, T.; Kasaoka, S.; Maekawa, T. Effects of a constant light environment on hippocampal neurogenesis and memory in mice. Neurosci. Lett. 2011, 488, 41–44. [Google Scholar] [CrossRef]
- Taufique, S.K.T.; Prabhat, A.; Kumar, V. Illuminated night alters hippocampal gene expressions and induces depressive-like responses in diurnal corvids. Eur. J. Neurosci. 2018, 48, 3005–3018. [Google Scholar] [CrossRef]
- Walbeek, T.J.; Harrison, E.M.; Gorman, M.R.; Glickman, G.L. Naturalistic Intensities of Light at Night: A Review of the Potent Effects of Very Dim Light on Circadian Responses and Considerations for Translational Research. Front. Neurol. 2021, 12, 625334. [Google Scholar] [CrossRef]
- Lee, S.; Kim, T.K.; Choi, J.E.; Choi, Y.; You, M.; Ryu, J.; Chun, Y.L.; Ham, S.; Hyeon, S.J.; Ryu, H.; et al. Dysfunction of striatal MeCP2 is associated with cognitive decline in a mouse model of Alzheimer’s disease. Theranostics 2022, 12, 1404–1418. [Google Scholar] [CrossRef]
- Fonken, L.K.; Kitsmiller, E.; Smale, L.; Nelson, R.J. Dim Nighttime Light Impairs Cognition and Provokes Depressive-Like Responses in a Diurnal Rodent. J. Biol. Rhythm. 2012, 27, 319–327. [Google Scholar] [CrossRef]
- Wang, X.; Wang, Z.; Cao, J.; Dong, Y.; Chen, Y. Melatonin ameliorates anxiety-like behaviors induced by sleep deprivation in mice: Role of oxidative stress, neuroinflammation, autophagy and apoptosis. Brain Res. Bull. 2021, 174, 161–172. [Google Scholar] [CrossRef] [PubMed]
- Sergi, D.; Gelinas, A.; Beaulieu, J.; Renaud, J.; Tardif-Pellerin, E.; Guillard, J.; Martinoli, M.G. Anti-apoptotic and anti-inflammatory role of trans epsilon-viniferin in a neuron-glia co-culture cellular model of Parkinson’s disease. Foods 2021, 10, 586. [Google Scholar] [CrossRef] [PubMed]
- McLay, L.K.; Nagarajan-Radha, V.; Green, M.P.; Jones, T.M. Dim artificial light at night affects mating, reproductive output, and reactive oxygen species in Drosophila melanogaster. J. Exp. Zool. Part A 2018, 329, 419–428. [Google Scholar] [CrossRef] [PubMed]
- Michán, S.; Li, Y.; Chou, M.M.-H.; Parrella, E.; Ge, H.; Long, J.M.; Allard, J.S.; Lewis, K.; Miller, M.; Xu, W.; et al. SIRT1 Is Essential for Normal Cognitive Function and Synaptic Plasticity. J. Neurosci. 2010, 30, 9695–9707. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- He, D.W.; Fu, S.P.; Zhou, A.; Su, Y.C.; Gao, X.Y.; Zhang, Y.F.; Huang, B.X.; Du, J.; Liu, D.F. Camptothecin regulates microglia polarization and exerts neuroprotective effects via activating AKT/Nrf2/HO-1 and inhibiting NF-kappa B pathways in vivo and in vitro. Front. Immunol. 2021, 12, 619761. [Google Scholar] [CrossRef] [PubMed]
- Saitgareeva, A.R.; Bulygin, K.V.; Gareev, I.F.; Beylerli, O.A.; Akhmadeeva, L.R. The role of microglia in the development of neurodegeneration. Neurol. Sci. 2020, 41, 3609–3615. [Google Scholar] [CrossRef]
- Lituma, P.J.; Woo, E.; O’Hara, B.F.; Castillo, P.E.; Sibinga, N.E.S.; Nandi, S. Altered synaptic connectivity and brain function in mice lacking microglial adapter protein Iba1. Proc. Natl. Acad. Sci. USA 2021, 118, e2115539118. [Google Scholar] [CrossRef]
- Bedrosian, T.A.; Weil, Z.; Nelson, R.J. Chronic dim light at night provokes reversible depression-like phenotype: Possible role for TNF. Mol. Psychiatry 2013, 18, 930–936. [Google Scholar] [CrossRef]
- Quek, H.; Cuní-López, C.; Stewart, R.; Colletti, T.; Notaro, A.; Nguyen, T.H.; Sun, Y.; Guo, C.C.; Lupton, M.K.; Roberts, T.L.; et al. ALS monocyte-derived microglia-like cells reveal cytoplasmic TDP-43 accumulation, DNA damage, and cell-specific impairment of phagocytosis associated with disease progression. J. Neuroinflamm. 2022, 19, 58. [Google Scholar] [CrossRef]
- Svahn, A.J.; Don, E.K.; Badrock, A.P.; Cole, N.J.; Graeber, M.B.; Yerbury, J.J.; Chung, R.; Morsch, M. Nucleo-cytoplasmic transport of TDP-43 studied in real time: Impaired microglia function leads to axonal spreading of TDP-43 in degenerating motor neurons. Acta Neuropathol. 2018, 136, 445–459. [Google Scholar] [CrossRef] [Green Version]
- Gupta, N.; Shyamasundar, S.; Patnala, R.; Karthikeyan, A.; Arumugam, T.V.; Ling, E.A.; Dheen, S.T. Recent progress in therapeutic strategies for microglia-mediated neuroinflammation in neuropathologies. Expert Opin. Ther. Targets 2018, 22, 765–781. [Google Scholar] [CrossRef] [PubMed]
- Tang, Y.; Le, W. Differential Roles of M1 and M2 Microglia in Neurodegenerative Diseases. Mol. Neurobiol. 2016, 53, 1181–1194. [Google Scholar] [CrossRef] [PubMed]
- Ren, P.; Xiao, B.; Wang, L.-P.; Li, Y.-S.; Jin, H.; Jin, Q.-H. Nitric oxide impairs spatial learning and memory in a rat model of Alzheimer’s disease via disturbance of glutamate response in the hippocampal dentate gyrus during spatial learning. Behav. Brain Res. 2022, 422, 113750. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Zhang, Y.; Xie, B.; Abdelgawad, A.; Chen, X.; Han, M.; Shang, Y.; Yuan, S.; Zhang, J. RhANP attenuates endotoxin-derived cognitive dysfunction through subdiaphragmatic vagus nerve-mediated gut microbiota–brain axis. J. Neuroinflamm. 2021, 18, 300. [Google Scholar] [CrossRef] [PubMed]
- Hsieh, C.-Y.; Hung, C.-H.; Lee, Y.-H.; Wu, S.-T.; Hu, C.-J. Effects of Light-Dark Cycle on Hippocampal iNOS Expression and CREB Activation in Rats. Chin. J. Physiol. 2015, 58, 19–26. [Google Scholar] [CrossRef] [Green Version]
- Chen, R.; Weitzner, A.S.; McKennon, L.A.; Fonken, L.K. Light at night during development in mice has modest effects on adulthood behavior and neuroimmune activation. Behav. Brain Res. 2021, 405, 113171. [Google Scholar] [CrossRef]
- Oyefeso, F.A.; Muotri, A.R.; Wilson, C.G.; Pecaut, M.J. Brain organoids: A promising model to assess oxidative stress-induced central nervous system damage. Dev. Neurobiol. 2021, 81, 653–670. [Google Scholar] [CrossRef]
- Singh, A.; Kukreti, R.; Saso, L.; Kukreti, S. Oxidative Stress: A Key Modulator in Neurodegenerative Diseases. Molecules 2019, 24, 1583. [Google Scholar] [CrossRef] [Green Version]
- Rumanova, V.S.; Okuliarova, M.; Zeman, M. Differential Effects of Constant Light and Dim Light at Night on the Circadian Control of Metabolism and Behavior. Int. J. Mol. Sci. 2020, 21, 5478. [Google Scholar] [CrossRef]
- Yang, Y.; Jiang, W.; Feng, Y.; Liu, J.; Chen, H.; Wang, D.; Zhao, R. Melatonin alleviates hippocampal GR inhibition and depression-like behavior induced by constant light exposure in mice. Ecotoxicol. Environ. Saf. 2021, 228, 112979. [Google Scholar] [CrossRef]
- Fonken, L.K.; Workman, J.L.; Walton, J.C.; Weil, Z.M.; Morris, J.S.; Haim, A.; Nelson, R.J. Light at night increases body mass by shifting the time of food intake. Proc. Natl. Acad. Sci. USA 2010, 107, 18664–18669. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kumari, R.; Verma, V.; Kronfeld-Schor, N.; Singaravel, M. Differential response of diurnal and nocturnal mammals to prolonged altered light-dark cycle: A possible role of mood associated endocrine, inflammatory and antioxidant system. Chronobiol. Int. 2021, 38, 1618–1630. [Google Scholar] [CrossRef] [PubMed]
- Sierra, A.; Gottfried-Blackmore, A.; Milner, T.A.; McEwen, B.S.; Bulloch, K. Steroid hormone receptor expression and function in microglia. Glia 2008, 56, 659–674. [Google Scholar] [CrossRef]
- Nakatani, Y.; Amano, T.; Tsuji, M.; Takeda, H. Corticosterone suppresses the proliferation of BV2 microglia cells via glucocorticoid, but not mineralocorticoid receptor. Life Sci. 2012, 91, 761–770. [Google Scholar] [CrossRef] [PubMed]
- Molcan, L.; Sutovska, H.; Okuliarova, M.; Senko, T.; Krskova, L.; Zeman, M. Dim light at night attenuates circadian rhythms in the cardiovascular system and suppresses melatonin in rats. Life Sci. 2019, 231, 116568. [Google Scholar] [CrossRef]
- Li, W.; Wang, Z.; Cao, J.; Dong, Y.; Chen, Y. Role of Sleep Restriction in Daily Rhythms of Expression of Hypothalamic Core Clock Genes in Mice. Curr. Issues Mol. Biol. 2022, 44, 42. [Google Scholar] [CrossRef]
- Dauchy, R.T.; Dauchy, E.M.; Tirrell, R.P.; Hill, C.R.; Davidson, L.K.; Greene, M.W.; Tirrell, P.C.; Wu, J.; Sauer, L.A.; Blask, D.E. Dark-Phase Light Contamination Disrupts Circadian Rhythms in Plasma Measures of Endocrine Physiology and Metabolism in Rats. Comp. Med. 2010, 60, 348–356. [Google Scholar] [PubMed]
Gene Name | Primer Sequence | Product Size | Accession No. |
---|---|---|---|
IL-6 | F: TAGTCCTTCCTACCCCAATTTCC | 76 | NC_000071.7 |
R: TTGGTCCTTAGCCACTCCTTC | |||
TNF-α | F: CCCTCACACTCAGATCATCTTCT | 61 | NC_000083.7 |
R: GCTACGACGTGGGCTACAG | |||
IL-4 | F: GGTCTCAACCCCCAGCTAGT | 102 | NC_000077.7 |
R: GCCGATGATCTCTCTCAAGTGAT | |||
IL-10 | F: AGCCTTATCGGAAATGATCCAGT | 229 | NC_000067.7 |
R: GGCCTTGTAGACACCTTGGT | |||
Bdnf | F: TTACCTGGATGCCGCAAACAT | 101 | NC_000068.8 |
R: TGACCCACTCGCTAATACTGTC | |||
Sirt1 | F: GCTGACGACTTCGACGACG | 101 | NC_000076.7 |
R: TCGGTCAACAGGAGGTTGTCT | |||
Psd-95 | F: TCCGGGAGGTGACCCATTC | 83 | NC_000077.7 |
R: TTTCCGGCGCATGACGTAG | |||
Snap-25 | F: CAACTGGAACGCATTGAGGAA | 177 | NC_000068.8 |
R: GGCCACTACTCCATCCTGATTAT | |||
Gapdh | F: CCGAGAATGGGAAGCTTGTC | 232 | NC_000072.7 |
R: TTCTCGTGGTTCACACCCATC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Q.; Wang, Z.; Cao, J.; Dong, Y.; Chen, Y. Dim Blue Light at Night Induces Spatial Memory Impairment in Mice by Hippocampal Neuroinflammation and Oxidative Stress. Antioxidants 2022, 11, 1218. https://doi.org/10.3390/antiox11071218
Liu Q, Wang Z, Cao J, Dong Y, Chen Y. Dim Blue Light at Night Induces Spatial Memory Impairment in Mice by Hippocampal Neuroinflammation and Oxidative Stress. Antioxidants. 2022; 11(7):1218. https://doi.org/10.3390/antiox11071218
Chicago/Turabian StyleLiu, Qi, Zixu Wang, Jing Cao, Yulan Dong, and Yaoxing Chen. 2022. "Dim Blue Light at Night Induces Spatial Memory Impairment in Mice by Hippocampal Neuroinflammation and Oxidative Stress" Antioxidants 11, no. 7: 1218. https://doi.org/10.3390/antiox11071218
APA StyleLiu, Q., Wang, Z., Cao, J., Dong, Y., & Chen, Y. (2022). Dim Blue Light at Night Induces Spatial Memory Impairment in Mice by Hippocampal Neuroinflammation and Oxidative Stress. Antioxidants, 11(7), 1218. https://doi.org/10.3390/antiox11071218