2-Methoxyestradiol TPGS Micelles Attenuate Cyclosporine A-Induced Nephrotoxicity in Rats through Inhibition of TGF-β1 and p-ERK1/2 Axis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Animals
2.3. Preparation of 2ME TPGS Micelles
2.4. Characterization of 2ME TPGS Micelles
2.4.1. Particle Size
2.4.2. Entrapment Efficiency %
2ME TPGS Micelles Investigation by Transmission Electron Microscopy
2.5. Experimental Design
2.6. Measurements of Renal Functional Markers
2.7. Histopathology and Immunohistochemistry
2.8. Oxidative Status Markers
2.9. Real-Time Polymerase Chain Reaction
2.10. Western Blot
2.11. Statistical Analyses
3. Results
3.1. Preparation and Characterization of 2ME-TPGS Micelles
3.2. Kidney Function Markers
3.3. Histopathological Examinations
3.4. Assessment of Oxidative Status
3.5. Assessment of Inflammation Markers
3.6. mRNA Expression of Bax and Bcl2
3.7. Western Blot of TGF-β1 and p-ERK1/2
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wallace, M.A. Anatomy and physiology of the kidney. AORN J. 1998, 68, 799–800. [Google Scholar] [CrossRef]
- Vervaet, B.A.; D’Haese, P.C.; Verhulst, A. Environmental toxin-induced acute kidney injury. Clin. Kidney J. 2017, 10, 747–758. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, S.Y.; Moon, A. Drug-induced nephrotoxicity and its biomarkers. Biomol. Ther. 2012, 20, 268–272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gupta, S.; Portales-Castillo, I.; Daher, A.; Kitchlu, A. Conventional Chemotherapy Nephrotoxicity. Adv. Chronic Kidney Dis. 2021, 28, 402–414.e1. [Google Scholar] [CrossRef]
- Cohen, D.J.; Loertscher, R.; Rubin, M.F.; Tilney, N.L.; Carpenter, C.B.; Strom, T.B. Cyclosporine: A new immunosuppressive agent for organ transplantation. Ann. Intern. Med. 1984, 101, 667–682. [Google Scholar] [CrossRef]
- Tedesco, D.; Haragsim, L. Cyclosporine: A Review. J. Transplant. 2012, 2012, 230386. [Google Scholar] [CrossRef] [Green Version]
- De Mattos, A.M.; Olyaei, A.J.; Bennett, W.M. Pharmacology of immunosuppressive medications used in renal diseases and transplantation. Am. J. Kidney Dis. 1996, 28, 631–667. [Google Scholar] [CrossRef]
- Matsuda, S.; Koyasu, S. Mechanisms of action of cyclosporine. Immunopharmacology 2000, 47, 119–125. [Google Scholar] [CrossRef]
- Rezzani, R. Cyclosporine A and adverse effects on organs: Histochemical studies. Prog. Histochem. Cytochem. 2004, 39, 85–128. [Google Scholar] [CrossRef]
- English, J.; Evan, A.; Houghton, D.C.; Bennett, W.M. Cyclosporine-induced acute renal dysfunction in the rat: Evidence of arteriolar vasoconstriction with preservation of tubular function. Transplantation 1987, 44, 135–141. [Google Scholar] [CrossRef]
- Bennett, W.M.; Demattos, A.; Meyer, M.M.; Andoh, T.; Barry, J.M. Chronic cyclosporine nephropathy: The Achilles’ heel of immunosuppressive therapy. Kidney Int. 1996, 50, 1089–1100. [Google Scholar] [CrossRef] [Green Version]
- Naesens, M.; Kuypers, D.R.J.; Sarwal, M. Calcineurin inhibitor nephrotoxicity. Clin. J. Am. Soc. Nephrol. 2009, 4, 481–508. [Google Scholar] [CrossRef] [Green Version]
- Caires, A.; Fernandes, G.S.; Leme, A.M.; Castino, B.; Pessoa, E.A.; Fernandes, S.M.; Fonseca, C.D.; Vattimo, M.F.; Schor, N.; Borges, F.T. Endothelin-1 receptor antagonists protect the kidney against the nephrotoxicity induced by cyclosporine-A in normotensive and hypertensive rats. Braz. J. Med. Biol. Res. 2018, 51. [Google Scholar] [CrossRef] [Green Version]
- Morales, J.M.; Andres, A.; Rengel, M.; Rodicio, J.L. Influence of cyclosporin, tacrolimus and rapamycin on renal function and arterial hypertension after renal transplantation. Nephrol. Dial. Transplant. 2001, 16, 121–124. [Google Scholar] [CrossRef] [Green Version]
- Busauschina, A.; Schnuelle, P.; Van Der Woude, F.J. Cyclosporine nephrotoxicity. Transplant. Proc. 2004, 36, S229–S233. [Google Scholar] [CrossRef]
- Perez-Sepulveda, A.; España-Perrot, P.P.; Norwitz, E.R.; Illanes, S.E. Metabolic pathways involved in 2-methoxyestradiol synthesis and their role in preeclampsia. Reprod. Sci. 2013, 20, 1020–1029. [Google Scholar] [CrossRef] [Green Version]
- Pribluda, V.S.; Gubish, J.; LaVallee, T.M.; Treston, A.; Swartz, G.M.; Green, S.J. 2-Methoxyestradiol: An endogenous antiangiogenic and antiproliferative drug candidate. Cancer Metastasis Rev. 2000, 19, 173–179. [Google Scholar] [CrossRef]
- Liao, W.I.; Wu, S.Y.; Tsai, S.H.; Pao, H.P.; Huang, K.L.; Chu, S.J. 2-Methoxyestradiol Protects Against Lung Ischemia/Reperfusion Injury by Upregulating Annexin A1 Protein Expression. Front. Immunol. 2021, 12, 596376. [Google Scholar] [CrossRef]
- MacHado-Linde, F.; Pelegrin, P.; Sanchez-Ferrer, M.L.; Leon, J.; Cascales, P.; Parrilla, J.J. 2-methoxyestradiol in the pathophysiology of endometriosis: Focus on angiogenesis and therapeutic potential. Reprod. Sci. 2012, 19, 1018–1029. [Google Scholar] [CrossRef]
- Lakhani, N.J.; Sarkar, M.A.; Venitz, J.; Figg, W.D. 2-methoxyestradiol, a promising anticancer agent. Pharmacotherapy 2003, 23, 165–172. [Google Scholar] [CrossRef] [Green Version]
- Bonacasa, B.; Sanchez, M.L.; Rodriguez, F.; Lopez, B.; Quesada, T.; Fenoy, F.J.; Hernández, I. 2-Methoxyestradiol attenuates hypertension and coronary vascular remodeling in spontaneously hypertensive rats. Maturitas 2008, 61, 310–316. [Google Scholar] [CrossRef] [PubMed]
- Azhar, A.S.; Zaher, Z.F.; Ashour, O.M.; Abdel-Naim, A.B. 2-Methoxyestradiol ameliorates metabolic syndrome-induced hypertension and catechol-O-methyltransferase inhibited expression and activity in rats. Eur. J. Pharmacol. 2020, 882, 173278. [Google Scholar] [CrossRef] [PubMed]
- Azhar, A.S.; Abdel-Naim, A.B.; Ashour, O.M. 2-Methoxyestradiol inhibits carotid artery intimal hyperplasia induced by balloon injury via inhibiting JAK/STAT axis in rats. Environ. Sci. Pollut. Res. 2022. Online ahead of print. [Google Scholar] [CrossRef] [PubMed]
- Schaible, E.V.; Windschügl, J.; Bobkiewicz, W.; Kaburov, Y.; Dangel, L.; Krämer, T.; Huang, C.; Sebastiani, A.; Luh, C.; Werner, C.; et al. 2-Methoxyestradiol confers neuroprotection and inhibits a maladaptive HIF-1α response after traumatic brain injury in mice. J. Neurochem. 2014, 129, 940–954. [Google Scholar] [CrossRef]
- Yeh, C.H.; Chou, W.; Chu, C.C.; So, E.C.; Chang, H.C.; Wang, J.J.; Hsing, C.H. Anticancer agent 2-methoxyestradiol improves survival in septic mice by reducing the production of cytokines and nitric oxide. Shock 2011, 36, 510–516. [Google Scholar] [CrossRef]
- Zhang, X.; Jia, Y.; Jackson, E.K.; Tofovic, S.P. 2-Methoxyestradiol and 2-ethoxyestradiol retard the progression of renal disease in aged, obese, diabetic ZSF1 rats. J. Cardiovasc. Pharmacol. 2007, 49, 56–63. [Google Scholar] [CrossRef]
- Chen, Y.Y.; Yeh, C.H.; So, E.C.; Sun, D.P.; Wang, L.Y.; Hsing, C.H. Anticancer drug 2-methoxyestradiol protects against renal ischemia/reperfusion injury by reducing inflammatory cytokines expression. Biomed. Res. Int. 2014, 2014, 431524. [Google Scholar] [CrossRef]
- Hassan, E.; Allam, S.; Mansour, A.M.; Shaheen, A.; Salama, S.A. The potential protective effects of estradiol and 2-methoxyestradiol in ischemia reperfusion-induced kidney injury in ovariectomized female rats. Life Sci. 2022, 296, 120441. [Google Scholar] [CrossRef]
- Pingili, A.K.; Davidge, K.N.; Thirunavukkarasu, S.; Khan, N.S.; Katsurada, A.; Majid, D.S.A.; Gonzalez, F.J.; Navar, L.G.; Malik, K.U. 2-Methoxyestradiol Reduces Angiotensin II-Induced Hypertension and Renal Dysfunction in Ovariectomized Female and Intact Male Mice. Hypertension 2017, 69, 1104–1112. [Google Scholar] [CrossRef]
- Tevaarwerk, A.J.; Holen, K.D.; Alberti, D.B.; Sidor, C.; Arnott, J.; Quon, C.; Wilding, G.; Liu, G. Phase I trial of 2-methoxyestradioI NanoCrystal dispersion in advanced solid malignancies. Clin. Cancer Res. 2009, 15, 1460–1465. [Google Scholar] [CrossRef] [Green Version]
- Harrison, M.R.; Hahn, N.M.; Pili, R.; Oh, W.K.; Hammers, H.; Sweeney, C.; Kim, K.M.; Perlman, S.; Arnott, J.; Sidor, C.; et al. A phase II study of 2-methoxyestradiol (2ME2) NanoCrystal® dispersion (NCD) in patients with taxane-refractory, metastatic castrate-resistant prostate cancer (CRPC). Investig. New Drugs 2011, 29, 1465–1474. [Google Scholar] [CrossRef] [Green Version]
- Bruce, J.Y.; Eickhoff, J.; Pili, R.; Logan, T.; Carducci, M.; Arnott, J.; Treston, A.; Wilding, G.; Liu, G. A phase II study of 2-methoxyestradiol nanocrystal colloidal dispersion alone and in combination with sunitinib malate in patients with metastatic renal cell carcinoma progressing on sunitinib malate. Investig. New Drugs 2012, 30, 794–802. [Google Scholar] [CrossRef] [Green Version]
- Ireson, C.R.; Chander, S.K.; Purohit, A.; Perera, S.; Newman, S.P.; Parish, D.; Leese, M.P.; Smith, A.C.; Potter, B.V.L.; Reed, M.J. Pharmacokinetics and efficacy of 2-methoxyoestradiol and 2-methoxyoestradiol-bis-sulphamate in vivo in rodents. Br. J. Cancer 2004, 90, 932–937. [Google Scholar] [CrossRef] [Green Version]
- James, J.; Murry, D.J.; Treston, A.M.; Storniolo, A.M.; Sledge, G.W.; Sidor, C.; Miller, K.D. Phase I safety, pharmacokinetic and pharmacodynamic studies of 2-methoxyestradiol alone or in combination with docetaxel in patients with locally recurrent or metastatic breast cancer. Investig. New Drugs 2007, 25, 41–48. [Google Scholar] [CrossRef]
- Newman, S.P.; Ireson, C.R.; Tutill, H.J.; Day, J.M.; Parsons, M.F.C.; Leese, M.P.; Potter, B.V.L.; Reed, M.J.; Purohit, A. The role of 17β-hydroxysteroid dehydrogenases in modulating the activity of 2-methoxyestradiol in breast cancer cells. Cancer Res. 2006, 66, 324–330. [Google Scholar] [CrossRef] [Green Version]
- Brede, C.; Labhasetwar, V. Applications of Nanoparticles in the Detection andTreatment of Kidney Diseases. Adv. Chronic Kidney Dis. 2013, 20, 454–465. [Google Scholar] [CrossRef] [Green Version]
- Lee, S.H.; Lee, J.B.; Bae, M.S.; Balikov, D.A.; Hwang, A.; Boire, T.C.; Kwon, I.K.; Sung, H.J.; Yang, J.W. Current Progress in Nanotechnology Applications for Diagnosis and Treatment of Kidney Diseases. Adv. Healthc. Mater. 2015, 4, 2037–2045. [Google Scholar] [CrossRef] [Green Version]
- Choi, C.H.J.; Zuckerman, J.E.; Webster, P.; Davis, M.E. Targeting kidney mesangium by nanoparticles of defined size. Proc. Natl. Acad. Sci. USA 2011, 108, 6656–6661. [Google Scholar] [CrossRef] [Green Version]
- Lin, B.; Ma, Y.-Y.; Wang, J.-W. Nano-Technological Approaches for Targeting Kidney Diseases with Focus on Diabetic Nephropathy: Recent Progress, and Future Perspectives. Front. Bioeng. Biotechnol. 2022, 10, 870049. [Google Scholar] [CrossRef]
- Cagel, M.; Tesan, F.C.; Bernabeu, E.; Salgueiro, M.J.; Zubillaga, M.B.; Moretton, M.A.; Chiappetta, D.A. Polymeric mixed micelles as nanomedicines: Achievements and perspectives. Eur. J. Pharm. Biopharm. 2017, 113, 211–228. [Google Scholar] [CrossRef]
- Gorain, B.; Choudhury, H.; Patro Sisinthy, S.; Kesharwani, P. Polymeric micelle-based drug delivery systems for tuberculosis treatment. In Nanotechnology Based Approaches for Tuberculosis Treatment; Elsevier: Amsterdam, The Netherlands, 2020; pp. 175–191. [Google Scholar]
- Guo, Y.; Luo, J.; Tan, S.; Otieno, B.O.; Zhang, Z. The applications of Vitamin E TPGS in drug delivery. Eur. J. Pharm. Sci. 2013, 49, 175–186. [Google Scholar] [CrossRef] [PubMed]
- Choudhury, H.; Gorain, B.; Pandey, M.; Kumbhar, S.A.; Tekade, R.K.; Iyer, A.K.; Kesharwani, P. Recent advances in TPGS-based nanoparticles of docetaxel for improved chemotherapy. Int. J. Pharm. 2017, 529, 506–522. [Google Scholar] [CrossRef] [PubMed]
- Puig-Rigall, J.; Blanco-Prieto, M.J.; Radulescu, A.; Dreiss, C.A.; González-Gaitano, G. Morphology, gelation and cytotoxicity evaluation of D-α-Tocopheryl polyethylene glycol succinate (TPGS)—Tetronic mixed micelles. J. Colloid Interface Sci. 2021, 582, 353–363. [Google Scholar] [CrossRef] [PubMed]
- Zuccari, G.; Baldassari, S.; Alfei, S.; Marengo, B.; Valenti, G.E.; Domenicotti, C.; Ailuno, G.; Villa, C.; Marchitto, L.; Caviglioli, G. D-α-tocopherol-based micelles for successful encapsulation of retinoic acid. Pharmaceuticals 2021, 14, 212. [Google Scholar] [CrossRef]
- Lakhani, N.J.; Lepper, E.R.; Sparreboom, A.; Dahut, W.L.; Venitz, J.; Figg, W.D. Determination of 2-methoxyestradiol in human plasma, using liquid chromatography/tandem mass spectrometry. Rapid Commun. Mass Spectrom. 2005, 19, 1176–1182. [Google Scholar] [CrossRef]
- Hu, Q.; Du, Q.; Yu, W.; Dong, X. 2-Methoxyestradiol Alleviates Neuroinflammation and Brain Edema in Early Brain Injury after Subarachnoid Hemorrhage in Rats. Front. Cell. Neurosci. 2022, 16, 869546. [Google Scholar] [CrossRef]
- Huang, J.; Yao, X.; Weng, G.; Qi, H.; Ye, X. Protective effect of curcumin against cyclosporine A-induced rat nephrotoxicity. Mol. Med. Rep. 2018, 17, 6038–6044. [Google Scholar] [CrossRef] [Green Version]
- Tirkey, N.; Kaur, G.; Vij, G.; Chopra, K. Curcumin, a diferuloylmethane, attenuates cyclosporine-induced renal dysfunction and oxidative stress in rat kidneys. BMC Pharmacol. 2005, 5, 15. [Google Scholar] [CrossRef] [Green Version]
- Sirwi, A.; Shaik, R.A.; Alamoudi, A.J.; Eid, B.G.; Elfaky, M.A.; Ibrahim, S.R.M.; Mohamed, G.A.; Abdallah, H.M.; Abdel-Naim, A.B. Mokko Lactone Alleviates Doxorubicin-Induced Cardiotoxicity in Rats via Antioxidant, Anti-Inflammatory, and Antiapoptotic Activities. Nutrients 2022, 14, 733. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Abdel-Naim, A.B.; Neamatallah, T.; Eid, B.G.; Esmat, A.; Alamoudi, A.J.; Abd El-Aziz, G.S.; Ashour, O.M. 2-Methoxyestradiol attenuates testosterone-induced benign prostate hyperplasia in rats through inhibition of HIF-1α/TGF-β/Smad2 Axis. Oxid. Med. Cell. Longev. 2018, 2018, 4389484. [Google Scholar] [CrossRef] [Green Version]
- Cattaneo, D.; Perico, N.; Gaspari, F.; Remuzzi, G. Nephrotoxic aspects of cyclosporine. Transplant. Proc. 2004, 36, S234–S239. [Google Scholar] [CrossRef]
- Myers, B.D.; Ross, J.; Newton, L.; Luetscher, J.; Perlroth, M. Cyclosporine-Associated Chronic Nephropathy. N. Engl. J. Med. 1984, 311, 699–705. [Google Scholar] [CrossRef]
- Novick, A.C.; Ho-Hsieh, H.; Steinmuller, D.; Streem, S.B.; Cunningham, R.J.; Steinhilber, D.; Goormastic, M.; Buszta, C. Detrimental effect of cyclosporine on initial function of cadaver renal allografts following extended preservation: Results of a randomized prospective study. Transplantation 1986, 42, 154–158. [Google Scholar] [CrossRef]
- MacDougall, B.R.D.; Williams, R.; Evans, D.B.; Thiru, S.; Henderson, R.G.; Hamilton, D.V.; Rolles, K.; Duffy, T.J. Cyclosporin A in cadaveric organ transplantation. Br. Med. J. (Clin. Res. Ed.). 1981, 282, 934–936. [Google Scholar]
- Flores, C.; Fouquet, G.; Moura, I.C.; Maciel, T.T.; Hermine, O. Lessons to learn from low-dose cyclosporin-A: A new approach for unexpected clinical applications. Front. Immunol. 2019, 10, 588. [Google Scholar] [CrossRef] [Green Version]
- Cho, J.K.; Hong, K.Y.; Park, J.W.; Yang, H.K.; Song, S.C. Injectable delivery system of 2-methoxyestradiol for breast cancer therapy using biodegradable thermosensitive poly(organophosphazene) hydrogel. J. Drug Target. 2011, 19, 270–280. [Google Scholar] [CrossRef]
- Edsall, A.B.; Agoston, G.E.; Treston, A.M.; Plum, S.M.; McClanahan, R.H.; Lu, T.S.; Song, W.; Cushman, M. Synthesis and in vivo antitumor evaluation of 2-methoxyestradiol 3-phosphate, 17-phosphate, and 3,17-diphosphate. J. Med. Chem. 2007, 50, 6700–6705. [Google Scholar] [CrossRef]
- Pillai, G.J.; Paul-Prasanth, B.; Nair, S.V.; Menon, D. Influence of surface passivation of 2-Methoxyestradiol loaded PLGA nanoparticles on cellular interactions, pharmacokinetics and tumour accumulation. Colloids Surf. B Biointerfaces 2017, 150, 242–249. [Google Scholar] [CrossRef]
- Awan, Z.A.; AlGhamdi, S.A.; Alhakamy, N.A.; Okbazghi, S.Z.; Alfaleh, M.A.; Badr-Eldin, S.M.; Aldawsari, H.M.; Abourehab, M.A.S.; Asfour, H.Z.; Zakai, S.A.; et al. Optimized 2-methoxyestradiol invasomes fortified with apamin: A promising approach for suppression of A549 lung cancer cells. Drug Deliv. 2022, 29, 1536–1548. [Google Scholar] [CrossRef]
- Alhakamy, N.A.; Al-Rabia, M.W.; Asfour, H.Z.; Alshehri, S.; Alharbi, W.S.; Halawani, A.; Alamoudi, A.J.; Noor, A.O.; Bannan, D.F.; Fahmy, U.A.; et al. 2-Methoxy-estradiol Loaded Alpha Lipoic Acid Nanoparticles Augment Cytotoxicity in MCF-7 Breast Cancer Cells. Dose-Response 2021, 19, 15593258211055023. [Google Scholar] [CrossRef] [PubMed]
- Pham, C.V.; Cho, C.W. Application of d-α-tocopheryl polyethylene glycol 1000 succinate (TPGS) in transdermal and topical drug delivery systems (TDDS). J. Pharm. Investig. 2017, 47, 111–121. [Google Scholar] [CrossRef]
- Ahmed, T.A.A.; El-Say, K.M.; Ahmed, O.A.A.; Aljaeid, B.M. Superiority of tpgs-loaded micelles in the brain delivery of vinpocetine via administration of thermosensitive intranasal gel. Int. J. Nanomed. 2019, 14, 5555–5567. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dintaman, J.M.; Silverman, J.A. Inhibition of P-glycoprotein by D-alpha-tocopheryl polyethylene glycol 1000 succinate (TPGS). Pharm. Res. 1999, 16, 1550–1556. [Google Scholar] [CrossRef]
- Beig, A.; Fine-Shamir, N.; Porat, D.; Lindley, D.; Miller, J.M.; Dahan, A. Concomitant solubility-permeability increase: Vitamin E TPGS vs. amorphous solid dispersion as oral delivery systems for etoposide. Eur. J. Pharm. Biopharm. 2017, 121, 97–103. [Google Scholar] [CrossRef]
- Zhao, J.; Mi, Y.; Feng, S.-S. Targeted co-delivery of docetaxel and siPlk1 by herceptin-conjugated vitamin E TPGS based immunomicelles. Biomaterials 2013, 34, 3411–3421. [Google Scholar] [CrossRef]
- Meng, X.; Liu, J.; Yu, X.; Li, J.; Lu, X.; Shen, T. Pluronic F127 and D-α-Tocopheryl Polyethylene Glycol Succinate (TPGS) Mixed Micelles for Targeting Drug Delivery across The Blood Brain Barrier. Sci. Rep. 2017, 7, 2964. [Google Scholar] [CrossRef]
- Zou, T.; Gu, L. TPGS emulsified zein nanoparticles enhanced oral bioavailability of daidzin: In vitro characteristics and in vivo performance. Mol. Pharm. 2013, 10, 2062–2070. [Google Scholar] [CrossRef]
- Yang, C.; Wu, T.; Qi, Y.; Zhang, Z. Recent Advances in the Application of Vitamin E TPGS for Drug Delivery. Theranostics 2018, 8, 464–485. [Google Scholar] [CrossRef]
- McCall, R.L.; Sirianni, R.W. PLGA nanoparticles formed by single- or double-emulsion with vitamin E-TPGS. J. Vis. Exp. 2013, 82, 51015. [Google Scholar] [CrossRef] [Green Version]
- Li, X.; Uppala, V.V.S.; Cooksey, T.J.; Robertson, M.L.; Madsen, L.A. Quantifying Drug Cargo Partitioning in Block Copolymer Micelle Solutions. ACS Appl. Polym. Mater. 2020, 2, 3749–3755. [Google Scholar] [CrossRef]
- González-Guerrero, C.; Cannata-Ortiz, P.; Guerri, C.; Egido, J.; Ortiz, A.; Ramos, A.M. TLR4-mediated inflammation is a key pathogenic event leading to kidney damage and fibrosis in cyclosporine nephrotoxicity. Arch. Toxicol. 2017, 91, 1925–1939. [Google Scholar] [CrossRef]
- Neamatallah, T.; Abdel-Naim, A.B.; Eid, B.G.; Hasan, A. 2-Methoxyestradiol attenuates liver fibrosis in mice: Implications for M2 macrophages. Naunyn. Schmiedebergs. Arch. Pharmacol. 2019, 392, 381–391. [Google Scholar] [CrossRef]
- Tofovic, S.P.; Zhang, X.; Jackson, E.K.; Zhu, H.; Petrusevska, G. 2-methoxyestradiol attenuates bleomycin-induced pulmonary hypertension and fibrosis in estrogen-deficient rats. Vascul. Pharmacol. 2009, 51, 190–197. [Google Scholar] [CrossRef] [Green Version]
- Song, C.Y.; Singh, P.; Motiwala, M.; Shin, J.S.; Lew, J.; Dutta, S.R.; Gonzalez, F.J.; Bonventre, J.V.; Malik, K.U. 2-Methoxyestradiol Ameliorates Angiotensin II-Induced Hypertension by Inhibiting Cytosolic Phospholipase A2α Activity in Female Mice. Hypertension 2021, 78, 1368–1381. [Google Scholar] [CrossRef]
- Wu, Q.; Wang, X.; Nepovimova, E.; Wang, Y.; Yang, H.; Kuca, K. Mechanism of cyclosporine A nephrotoxicity: Oxidative stress, autophagy, and signalings. Food Chem. Toxicol. 2018, 118, 889–907. [Google Scholar] [CrossRef]
- Wang, L.; Zheng, Q.; Yuan, Y.; Li, Y.; Gong, X. Effects of 17β-estradiol and 2-methoxyestradiol on the oxidative stress-hypoxia inducible factor-1 pathway in hypoxic pulmonary hypertensive rats. Exp. Ther. Med. 2017, 13, 2537–2543. [Google Scholar] [CrossRef] [Green Version]
- de Arriba, G.; de Hornedo, J.P.; Rubio, S.R.; Fernández, M.C.; Martínez, S.B.; Camarero, M.M.; Cid, T.P. Vitamin E protects against the mitochondrial damage caused by cyclosporin A in LLC-PK1 cells. Toxicol. Appl. Pharmacol. 2009, 239, 241–250. [Google Scholar] [CrossRef]
- Al-Malki, A.L.; Moselhy, S.S. The protective effect of epicatchin against oxidative stress and nephrotoxicity in rats induced by cyclosporine. Hum. Exp. Toxicol. 2011, 30, 145–151. [Google Scholar] [CrossRef]
- Satyanarayana, P.S.V.; Singh, D.; Chopra, K. Quercetin, a bioflavonoid, protects against oxidative stress-related renal dysfunction by cyclosporine in rats. Methods Find. Exp. Clin. Pharmacol. 2001, 23, 175–181. [Google Scholar] [CrossRef]
- Xiang, Y.; Piao, S.G.; Zou, H.B.; Jin, J.; Fang, M.R.; Lei, D.M.; Gao, B.H.; Yang, C.W.; Li, C. L-carnitine protects against cyclosporine-induced pancreatic and renal injury in rats. Transplant. Proc. 2013, 45, 3127–3134. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wongmekiat, O.; Gomonchareonsiri, S.; Thamprasert, K. Caffeic acid phenethyl ester protects against oxidative stress-related renal dysfunction in rats treated with cyclosporin A. Fundam. Clin. Pharmacol. 2011, 25, 619–626. [Google Scholar] [CrossRef] [PubMed]
- Lee, J. Use of antioxidants to prevent cyclosporine a toxicity. Toxicol. Res. 2013, 26, 163–170. [Google Scholar] [CrossRef] [PubMed]
- Gu, S.F.; Wang, L.Y.; Tian, Y.J.; Zhou, Z.X.; Tang, J.B.; Liu, X.R.; Jiang, H.P.; Shen, Y.Q. Enhanced water solubility, antioxidant activity, and oral absorption of hesperetin by D-α-tocopheryl polyethylene glycol 1000 succinate and phosphatidylcholine. J. Zhejiang Univ. Sci. B 2019, 20, 273. [Google Scholar] [CrossRef]
- Benigni, A.; Bruzzi, I.; Mister, M.; Azzollini, N.; Gaspari, F.; Perico, N.; Gotti, E.; Bertani, T.; Remuzzi, G. Nature and mediators of renal lesions in kidney transplant patients given cyclosporine for more than one year. Kidney Int. 1999, 55, 674–685. [Google Scholar] [CrossRef] [Green Version]
- González-Guerrero, C.; Ocaña-Salceda, C.; Berzal, S.; Carrasco, S.; Fernández-Fernández, B.; Cannata-Ortiz, P.; Egido, J.; Ortiz, A.; Ramos, A.M. Calcineurin inhibitors recruit protein kinases JAK2 and JNK, TLR signaling and the UPR to activate NF-κB-mediated inflammatory responses in kidney tubular cells. Toxicol. Appl. Pharmacol. 2013, 272, 825–841. [Google Scholar] [CrossRef]
- Arab, H.H.; Ashour, A.M.; Alqarni, A.M.; Arafa, E.S.A.; Kabel, A.M. Camel milk mitigates cyclosporine-induced renal damage in rats: Targeting p38/erk/jnk mapks, nf-κb, and matrix metalloproteinases. Biology 2021, 10, 442. [Google Scholar] [CrossRef]
- Nouri, A.; Ghatreh-Samani, K.; Amini-Khoei, H.; Mohammadi, A.; Heidarian, E.; Najafi, M. Ferulic acid prevents cyclosporine-induced nephrotoxicity in rats through exerting anti-oxidant and anti-inflammatory effects via activation of Nrf2/HO-1 signaling and suppression of NF-κB/TNF-α axis. Naunyn. Schmiedebergs. Arch. Pharmacol. 2022, 395, 387–395. [Google Scholar] [CrossRef]
- El-Sheikh, A.A.K.; Morsy, M.A.; Abdel-latif, R.G. Modulation of eNOS/iNOS by nebivolol protects against cyclosporine A-mediated nephrotoxicity through targeting inflammatory and apoptotic pathways. Environ. Toxicol. Pharmacol. 2019, 69, 26–35. [Google Scholar] [CrossRef]
- Sanz, A.B.; Sanchez-Niño, M.D.; Ramos, A.M.; Moreno, J.A.; Santamaria, B.; Ruiz-Ortega, M.; Egido, J.; Ortiz, A. NF-κB in renal inflammation. J. Am. Soc. Nephrol. 2010, 21, 1254–1262. [Google Scholar] [CrossRef] [Green Version]
- Alhakamy, N.A.; Ahmed, O.A.; Fahmy, U.A.; Asfour, H.Z.; Alghaith, A.F.; Mahdi, W.A.; Alshehri, S.; Md, S. Development, Optimization and Evaluation of 2-Methoxy-Estradiol Loaded Nanocarrier for Prostate Cancer. Front. Pharmacol. 2021, 12, 682337. [Google Scholar] [CrossRef]
- Kher, A.; Meldrum, K.K.; Hile, K.L.; Wang, M.; Tsai, B.M.; Turrentine, M.W.; Brown, J.W.; Meldrum, D.R. Aprotinin improves kidney function and decreases tubular cell apoptosis and proapoptotic signaling after renal ischemia-reperfusion. J. Thorac. Cardiovasc. Surg. 2005, 130, e1–e662. [Google Scholar] [CrossRef] [Green Version]
- Chung, B.H.; Li, C.; Sun, B.K.; Lim, S.W.; Ahn, K.O.; Yang, J.H.; Choi, Y.H.; Yoon, K.H.; Sugawara, A.; Ito, S.; et al. Rosiglitazone protects against cyclosporine-induced pancreatic and renal injury in rats. Am. J. Transplant. 2005, 5, 1856–1867. [Google Scholar] [CrossRef]
- Shehata, M.; Cope, G.H.; Johnson, T.S.; Raftery, A.T.; El Nahas, A.M. Cyclosporine enhances the expression of TGF-β in the juxtaglomerular cells of the rat kidney. Kidney Int. 1995, 48, 1487–1496. [Google Scholar] [CrossRef] [Green Version]
- Wolf, G. Renal injury due to renin-angiotensin-aldosterone system activation of the transforming growth factor-β pathway. Kidney Int. 2006, 70, 1914–1919. [Google Scholar] [CrossRef] [Green Version]
- Tamaki, K.; Okuda, S. Role of TGF-β in the progression of renal fibrosis. Contrib. Nephrol. 2003, 139, 44–65. [Google Scholar]
- Salama, S.A.; Diaz-Arrastia, C.R.; Kilic, G.S.; Kamel, M.W. 2-Methoxyestradiol causes functional repression of transforming growth factor β3 signaling by ameliorating Smad and non-Smad signaling pathways in immortalized uterine fibroid cells. Fertil. Steril. 2012, 98, 178–184.e1. [Google Scholar] [CrossRef]
- Chen, Y.; Wang, N.; Yuan, Q.; Qin, J.; Hu, G.; Li, Q.; Tao, L.; Xie, Y.; Peng, Z. The Protective Effect of Fluorofenidone against Cyclosporine A-Induced Nephrotoxicity. Kidney Blood Press. Res. 2019, 44, 656–668. [Google Scholar] [CrossRef]
- Finlay, G.A.; Thannickal, V.J.; Fanburg, B.L.; Paulson, K.E. Transforming growth factor-β1-induced activation of the ERK pathway/activator protein-1 in human lung fibroblasts requires the autocrine induction of basic fibroblast growth factor. J. Biol. Chem. 2000, 275, 27650–27656. [Google Scholar] [CrossRef] [Green Version]
- Cheng, X.; Gao, W.; Dang, Y.; Liu, X.; Li, Y.; Peng, X.; Ye, X. Both ERK/MAPK and TGF-Beta/Smad signaling pathways play a role in the kidney fibrosis of diabetic mice accelerated by blood glucose fluctuation. J. Diabetes Res. 2013, 2013, 463740. [Google Scholar] [CrossRef] [Green Version]
Forward Primer | Reverse Primer | Accession Number | |
---|---|---|---|
β-Actin | 5′TCCGTCGCCGGTCCACACCC | 5′TCACCAACTGGGACGATATG | NM_031144.3 |
Bax | 5′CCTGAGCTGACCTTGGAGCA | 5′GGTGGTTGCCCTTTTCTACT | U32098.1 |
Bcl2 | 5′TGATAACCGGGAGATCGTGA | 5′AAAGCACATCCAATAAAAAGC | NM_016993.1 |
Tubular Necrosis | Tubular Degeneration | Tubular Dilatation | Thickened Basement Membrane | Interstitial Fibrosis | |
---|---|---|---|---|---|
Control | - | - | -/+ | - | - |
Vehicle | - | - | -/+ | - | -/+ |
CSA | +++ | +++ | +++ | +++ | +++ |
CSA + 2ME-raw | ++ | ++ | + | + | ++ |
CSA + 2ME-TPGS | + | + | + | -/+ | + |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Al-Rabia, M.W.; Alfaleh, M.A.; Asfour, H.Z.; Alharbi, W.S.; El-Moselhy, M.A.; Alhakamy, N.A.; Fahmy, U.A.; Ahmed, O.A.A.; Fahmy, O.; Rashad, O.M.; et al. 2-Methoxyestradiol TPGS Micelles Attenuate Cyclosporine A-Induced Nephrotoxicity in Rats through Inhibition of TGF-β1 and p-ERK1/2 Axis. Antioxidants 2022, 11, 1499. https://doi.org/10.3390/antiox11081499
Al-Rabia MW, Alfaleh MA, Asfour HZ, Alharbi WS, El-Moselhy MA, Alhakamy NA, Fahmy UA, Ahmed OAA, Fahmy O, Rashad OM, et al. 2-Methoxyestradiol TPGS Micelles Attenuate Cyclosporine A-Induced Nephrotoxicity in Rats through Inhibition of TGF-β1 and p-ERK1/2 Axis. Antioxidants. 2022; 11(8):1499. https://doi.org/10.3390/antiox11081499
Chicago/Turabian StyleAl-Rabia, Mohammed W., Mohamed A. Alfaleh, Hani Z. Asfour, Waleed S. Alharbi, Mohamed A. El-Moselhy, Nabil A. Alhakamy, Usama A. Fahmy, Osama A. A. Ahmed, Omar Fahmy, Omar M. Rashad, and et al. 2022. "2-Methoxyestradiol TPGS Micelles Attenuate Cyclosporine A-Induced Nephrotoxicity in Rats through Inhibition of TGF-β1 and p-ERK1/2 Axis" Antioxidants 11, no. 8: 1499. https://doi.org/10.3390/antiox11081499