Renal Ischemia/Reperfusion Mitigation via Geraniol: The Role of Nrf-2/HO-1/NQO-1 and TLR2,4/MYD88/NFκB Pathway
Abstract
:1. Introduction
2. Materials and Methods
2.1. Absorption, Distribution, Metabolism, and Excretion Assessment of Geraniol
2.2. Animals
2.3. Ethical Approval Statement
2.4. Induction Renal Ischemia/Reperfusion (I/R) Injury
2.5. Experimental Design
2.6. Evaluation of Renal Function
2.7. Evaluation of Renal Oxidative Stress Status
2.8. Molecular Docking Study
2.9. Gene Expression by Real-Time PCR (qPCR)
2.10. Evaluation of Nrf2 Pathway Protein Expression
2.11. Evaluation of Inflammatory Indicators
2.12. Evaluation of Apoptotic Indicators
2.13. Evaluations Using Histopathological Investigations
2.14. Statistical Analysis
3. Results
3.1. Predictions of Pharmacokinetics, Drug-Likeness, Physicochemical Properties of Geraniol
3.2. Geraniol Improves Renal Function and Oxidative Stress Markers in Renal I/R Induced Injury
3.3. Molecular Docking Studies of Geraniol
3.4. Geraniol Prompts Renal Nrf2/HO-1/NQO-1 Pathway in Renal I/R Induced Injury
3.5. Geraniol Averts Renal TLR2,4/MYD88/NFκB Pathway in Renal I/R Induced Injury
3.6. Geraniol Precludes Renal Inflammatory and Apoptotic Markers in Renal I/R Induced Injury
3.7. Geraniol Histopathological Effects in Renal I/R Induced Injury
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhao, H.; Alam, A.; Soo, A.P.; George, A.J.T.; Ma, D. Ischemia-Reperfusion Injury Reduces Long Term Renal Graft Survival: Mechanism and Beyond. EBioMedicine 2018, 28, 31–42. [Google Scholar] [CrossRef]
- Fawzy, M.A.; Maher, S.A.; Bakkar, S.M.; El-Rehany, M.A.; Fathy, M. Pantoprazole Attenuates MAPK (ERK1/2, JNK, p38)-NF-κB and Apoptosis Signaling Pathways after Renal Ischemia/Reperfusion Injury in Rats. Int. J. Mol. Sci. 2021, 22, 10669. [Google Scholar] [CrossRef] [PubMed]
- Zhong, D.; Wang, H.; Liu, M.; Li, X.; Huang, M.; Zhou, H.; Lin, S.; Lin, Z.; Yang, B. Ganoderma lucidum polysaccharide peptide prevents renal ischemia reperfusion injury via counteracting oxidative stress. Sci. Rep. 2015, 5, 16910. [Google Scholar] [CrossRef] [PubMed]
- Ponticelli, C. Ischaemia-reperfusion injury: A major protagonist in kidney transplantation. Nephrol. Dial. Transplant. 2014, 29, 1134–1140. [Google Scholar] [CrossRef] [PubMed]
- Shan, Y.; Chen, D.; Hu, B.; Xu, G.; Li, W.; Jin, Y.; Jin, X.; Jin, X.; Jin, L. Allicin ameliorates renal ischemia/reperfusion injury via inhibition of oxidative stress and inflammation in rats. Biomed. Pharmacother. 2021, 142, 112077. [Google Scholar] [CrossRef]
- El-Emam, S.Z.; Soubh, A.A.; Al-Mokaddem, A.K.; Abo El-Ella, D.M. Geraniol activates Nrf-2/HO-1 signaling pathway mediating protection against oxidative stress-induced apoptosis in hepatic ischemia-reperfusion injury. Naunyn-Schmiedeberg’s Arch. Pharmacol. 2020, 393, 1849–1858. [Google Scholar] [CrossRef]
- Nezu, M.; Suzuki, N. Roles of Nrf2 in Protecting the Kidney from Oxidative Damage. Int. J. Mol. Sci. 2020, 21, 2951. [Google Scholar] [CrossRef]
- Mata, A.; Cadenas, S. The Antioxidant Transcription Factor Nrf2 in Cardiac Ischemia-Reperfusion Injury. Int. J. Mol. Sci. 2021, 22, 11939. [Google Scholar] [CrossRef]
- Lei, Y.; Fu, P.; Jun, X.; Cheng, P. Pharmacological Properties of Geraniol—A Review. Planta Med. 2019, 85, 48–55. [Google Scholar] [CrossRef]
- Qi, F.; Yan, Q.; Zheng, Z.; Liu, J.; Chen, Y.; Zhang, G. Geraniol and geranyl acetate induce potent anticancer effects in colon cancer Colo-205 cells by inducing apoptosis, DNA damage and cell cycle arrest. J. Balk. Union Oncol. 2018, 23, 346–352. [Google Scholar]
- Wang, J.; Su, B.; Zhu, H.; Chen, C.; Zhao, G. Protective effect of geraniol inhibits inflammatory response, oxidative stress and apoptosis in traumatic injury of the spinal cord through modulation of NF-κB and p38 MAPK. Exp. Ther. Med. 2016, 12, 3607–3613. [Google Scholar] [CrossRef]
- El-Said, Y.A.M.; Sallam, N.A.A.; Ain-Shoka, A.A.; Abdel-Latif, H.A. Geraniol ameliorates diabetic nephropathy via interference with miRNA-21/PTEN/Akt/mTORC1 pathway in rats. Naunyn-Schmiedeberg’s Arch. Pharmacol. 2020, 393, 2325–2337. [Google Scholar] [CrossRef] [PubMed]
- Kandeil, M.A.; Mahmoud, M.O.; Abdel-Razik, A.H.; Gomaa, S.B. Thymoquinone and geraniol alleviate cisplatin-induced neurotoxicity in rats through downregulating the p38 MAPK/STAT-1 pathway and oxidative stress. Life Sci. 2019, 228, 145–151. [Google Scholar] [CrossRef] [PubMed]
- Crespo, R.; Wei, K.; Rodenak-Kladniew, B.; Mercola, M.; Ruiz-Lozano, P.; Hurtado, C. Effect of geraniol on rat cardiomyocytes and its potential use as a cardioprotective natural compound. Life Sci. 2017, 172, 8–12. [Google Scholar] [CrossRef] [PubMed]
- Soubh, A.A.; Abdallah, D.M.; El-Abhar, H.S. Geraniol ameliorates TNBS-induced colitis: Involvement of Wnt/β-catenin, p38MAPK, NFκB, and PPARγ signaling pathways. Life Sci. 2015, 136, 142–150. [Google Scholar] [CrossRef] [PubMed]
- Qiu, Y.; Wu, Y.; Zhao, H.; Sun, H.; Gao, S. Maresin 1 mitigates renal ischemia/reperfusion injury in mice via inhibition of the TLR4/MAPK/NF-κB pathways and activation of the Nrf2 pathway. Drug Des. Dev. Ther. 2019, 13, 739–745. [Google Scholar] [CrossRef]
- Hu, L.; Yang, C.; Zhao, T.; Xu, M.; Tang, Q.; Yang, B.; Rong, R.; Zhu, T. Erythropoietin Ameliorates Renal Ischemia and Reperfusion Injury via Inhibiting Tubulointerstitial Inflammation. J. Surg. Res. 2012, 176, 260–266. [Google Scholar] [CrossRef]
- Tan, X.; Zhu, H.; Tao, Q.; Guo, L.; Jiang, T.; Xu, L.; Yang, R.; Wei, X.; Wu, J.; Li, X.; et al. FGF10 Protects Against Renal Ischemia/Reperfusion Injury by Regulating Autophagy and Inflammatory Signaling. Front. Genet. 2018, 9. [Google Scholar] [CrossRef]
- Ucar, B.I.; Ucar, G.; Saha, S.; Buttari, B.; Profumo, E.; Saso, L. Pharmacological Protection against Ischemia-Reperfusion Injury by Regulating the Nrf2-Keap1-ARE Signaling Pathway. Antioxidants 2021, 10, 823. [Google Scholar] [CrossRef]
- Daina, A.; Michielin, O.; Zoete, V. SwissADME: A free web tool to evaluate pharmacokinetics, drug-likeness and medicinal chemistry friendliness of small molecules. Sci. Rep. 2017, 7, 42717. [Google Scholar] [CrossRef]
- Long, C.; Yang, J.; Yang, H.; Li, X.; Wang, G. Attenuation of renal ischemia/reperfusion injury by oleanolic acid preconditioning via its antioxidant, anti-inflammatory, and anti-apoptotic activities. Mol. Med. Rep. 2016, 13, 4697–4704. [Google Scholar] [CrossRef] [PubMed]
- da Rocha, B.A.; Ritter, A.M.; Ames, F.Q.; Gonçalves, O.H.; Leimann, F.V.; Bracht, L.; Natali, M.R.; Cuman, R.K.; Bersani-Amado, C.A. Acetaminophen-induced hepatotoxicity: Preventive effect of trans anethole. Biomed. Pharmacother. 2017, 86, 213–220. [Google Scholar] [CrossRef] [PubMed]
- Estevão-Silva, C.F.; Kummer, R.; Fachini-Queiroz, F.C.; Grespan, R.; Nogueira de Melo, G.A.; Baroni, S.; Cuman, R.K.; Bersani-Amado, C.A. Anethole and eugenol reduce in vitro and in vivo leukocyte migration induced by fMLP, LTB4, and carrageenan. J. Nat. Med. 2014, 68, 567–575. [Google Scholar] [CrossRef]
- Honegr, J.; Dolezal, R.; Malinak, D.; Benkova, M.; Soukup, O.; Almeida, J.; Franca, T.C.C.; Kuca, K.; Prymula, R. Rational Design of a New Class of Toll-Like Receptor 4 (TLR4) Tryptamine Related Agonists by Means of the Structure- and Ligand-Based Virtual Screening for Vaccine Adjuvant Discovery. Molecules 2018, 23, 102. [Google Scholar] [CrossRef] [PubMed]
- Su, L.; Wang, Y.; Wang, J.; Mifune, Y.; Morin, M.D.; Jones, B.T.; Moresco, E.M.Y.; Boger, D.L.; Beutler, B.; Zhang, H. Structural Basis of TLR2/TLR1 Activation by the Synthetic Agonist Diprovocim. J. Med. Chem. 2019, 62, 2938–2949. [Google Scholar] [CrossRef]
- Cosimelli, B.; Greco, G.; Laneri, S.; Novellino, E.; Sacchi, A.; Amendola, G.; Cosconati, S.; Bortolozzi, R.; Viola, G. Identification of novel indole derivatives acting as inhibitors of the Keap1-Nrf2 interaction. J. Enzym. Inhib. Med. Chem. 2019, 34, 1152–1157. [Google Scholar] [CrossRef]
- Eberhardt, J.; Santos-Martins, D.; Tillack, A.F.; Forli, S. AutoDock Vina 1.2.0: New Docking Methods, Expanded Force Field, and Python Bindings. J. Chem. Inf. Model. 2021, 61, 3891–3898. [Google Scholar] [CrossRef]
- Trott, O.; Olson, A.J. AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J. Comput. Chem. 2010, 31, 455–461. [Google Scholar] [CrossRef]
- Pettersen, E.F.; Goddard, T.D.; Huang, C.C.; Couch, G.S.; Greenblatt, D.M.; Meng, E.C.; Ferrin, T.E. UCSF Chimera--a visualization system for exploratory research and analysis. J. Comput. Chem. 2004, 25, 1605–1612. [Google Scholar] [CrossRef]
- Younis, N.S.; Mohamed, M.E. β-Caryophyllene as a Potential Protective Agent Against Myocardial Injury: The Role of Toll-Like Receptors. Molecules 2019, 24, 1929. [Google Scholar] [CrossRef]
- Tan, Z.; Shi, Y.; Yan, Y.; Liu, W.; Li, G.; Li, R. Impact of endogenous hydrogen sulfide on toll-like receptor pathway in renal ischemia/reperfusion injury in rats. Ren. Fail. 2015, 37, 727–733. [Google Scholar] [CrossRef] [PubMed]
- Lipinski, C.A.; Lombardo, F.; Dominy, B.W.; Feeney, P.J. Experimental and computational approaches to estimate solubility and permeability in drug discovery and development settings. Adv. Drug Deliv. Rev. 1997, 23, 3–25, Erratum in Adv. Drug Deliv. Rev. 2001, 46, 3–26. [Google Scholar] [CrossRef]
- Delaney, J.S. ESOL: Estimating Aqueous Solubility Directly from Molecular Structure. J. Chem. Inf. Comput. Sci. 2004, 44, 1000–1005. [Google Scholar] [CrossRef]
- Siddique, Y.H.; Naz, F.; Jyoti, S.; Ali, F.; Fatima, A.; Rahul; Khanam, S. Protective effect of Geraniol on the transgenic Drosophila model of Parkinson’s disease. Env. Toxicol. Pharm. 2016, 43, 225–231. [Google Scholar] [CrossRef] [PubMed]
- Jiang, K.; Zhang, T.; Yin, N.; Ma, X.; Zhao, G.; Wu, H.; Qiu, C.; Deng, G. Geraniol alleviates LPS-induced acute lung injury in mice via inhibiting inflammation and apoptosis. Oncotarget 2017, 8, 71038–71053. [Google Scholar] [CrossRef]
- Khan, A.Q.; Khan, R.; Qamar, W.; Lateef, A.; Rehman, M.U.; Tahir, M.; Ali, F.; Hamiza, O.O.; Hasan, S.K.; Sultana, S. Geraniol attenuates 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced oxidative stress and inflammation in mouse skin: Possible role of p38 MAP Kinase and NF-κB. Exp. Mol. Pathol. 2013, 94, 419–429. [Google Scholar] [CrossRef]
- Hasan, S.K.; Sultana, S. Geraniol attenuates 2-acetylaminofluorene induced oxidative stress, inflammation and apoptosis in the liver of wistar rats. Toxicol. Mech. Methods 2015, 25, 559–573. [Google Scholar] [CrossRef]
- Jayachandran, M.; Chandrasekaran, B.; Namasivayam, N. Geraniol attenuates oxidative stress by Nrf2 activation in diet-induced experimental atherosclerosis. J. Basic Clin. Physiol. Pharmacol. 2015, 26, 335–346. [Google Scholar] [CrossRef]
- Mahmoud, N.M.; Elshazly, S.M.; Rezq, S. Geraniol protects against cyclosporine A-induced renal injury in rats: Role of Wnt/β-catenin and PPARγ signaling pathways. Life Sci. 2022, 291, 120259. [Google Scholar] [CrossRef]
- Younis, N.S.; Elsewedy, H.S.; Shehata, T.M.; Mohamed, M.E. Geraniol Averts Methotrexate-Induced Acute Kidney Injury via Keap1/Nrf2/HO-1 and MAPK/NF-κB Pathways. Curr. Issues Mol. Biol. 2021, 43, 1741–1755. [Google Scholar] [CrossRef]
- Mohamed, M.E.; Kandeel, M.; Abd El-Lateef, H.M.; El-Beltagi, H.S.; Younis, N.S. The Protective Effect of Anethole against Renal Ischemia/Reperfusion: The Role of the TLR2,4/MYD88/NFκB Pathway. Antioxidants 2022, 11, 535. [Google Scholar] [CrossRef] [PubMed]
- Aboutaleb, N.; Jamali, H.; Abolhasani, M.; Pazoki Toroudi, H. Lavender oil (Lavandula angustifolia) attenuates renal ischemia/reperfusion injury in rats through suppression of inflammation, oxidative stress and apoptosis. Biomed. Pharmacother. 2019, 110, 9–19. [Google Scholar] [CrossRef] [PubMed]
- Hashemnia, S.; Oloumi, M.m.; Rezayan, M.; Derakhshanfar, A.; Mostafavi, A.; Hojabri, K.; Esmailzadeh, S. Persian sage (Salvia rhytidia) essential oil can ameliorate the renal ischemia-reperfusion injuries in rat. Iran. J. Vet. Surg. 2009, 4, 67–76. [Google Scholar]
- Gheitasi, I.; Azizi, A.; Omidifar, N.; Doustimotlagh, A.H. Renoprotective Effects of Origanum majorana Methanolic L and Carvacrol on Ischemia/Reperfusion-Induced Kidney Injury in Male Rats. Evid.-Based Complement. Altern. Med. 2020, 2020, 9785932. [Google Scholar] [CrossRef]
- Yildiz, F.; Coban, S.; Terzi, A.; Savas, M.; Bitiren, M.; Celik, H.; Aksoy, N. Protective Effects of Nigella sativa against Ischemia-Reperfusion Injury of Kidneys. Ren. Fail. 2010, 32, 126–131. [Google Scholar] [CrossRef]
- Yang, S.; Chou, W.-P.; Pei, L. Effects of propofol on renal ischemia/reperfusion injury in rats. Exp. Ther. Med. 2013, 6, 1177–1183. [Google Scholar] [CrossRef]
- Zheng, Y.; Zhang, Z.; Zhang, N. Protective Effects of Butyrate on Renal Ischemia-Reperfusion Injury in Rats. Urol. Int. 2019, 102, 348–355. [Google Scholar] [CrossRef]
TLR Pathway | Primer Sequence (5′ to 3′) | Gen-Bank Accession Number |
---|---|---|
Nrf2 | 5′ CAT TTGTAGATGACCATGAGTCGC 3′ (sense) 5′ ATCAGGGGTGGTGAAGACTG ′ (antisense) | NM_031789.2 |
HO-1 | 5′ GTGCACATCGTGCAGAGAA 3′ (sense) 5′ GTGCACATCCGTGCAGAGAA3′ ′ (antisense) | NM_012 580.2 |
NQO1 | 5′-AGGATGGGAGGTACTCGATC -3′ (sense) 5′-AGGCGTCCTTCCTTATATGCTA -3′ ′ (antisense) | NM_008706.5 |
TLR2 | 5′-ATGAACACTAAGACATACCTGGAG-3′ (sense) 5′-CAAGACAGAAACAGGGTGGAG-3′ (antisense) | NM_198769 |
TLR4 | 5′-CATGACATCCCTTATTCAACCAAG-3′ (sense), 5′-GCCATGCCTTGTCTTCAATTG-3′ (antisense) | NM_019178 |
MyD88 | 5′-GAGATCCGCGAGTTTGAGAC-3′ (sense) 5′-CTGTTTCTGCTGGTTGCGTA-3′ (antisense) | NM_198130.2 |
NFκB | 5′-ATCATCAACATGAGAAACGATCTGTA-3′ (sense) 5′-CAGCGGTCCAGAAGACTCAG-3′ (antisense) | L26267.1 |
Bax | 5′-GTGGTTGCCCTCTTCTACTTTG-3′ (sense) 5′-CAAAAGATGGTCACTGTCTGC-3′ (antisense) | NM_017059.2 |
Bcl-2 | 5′-CCGGGAGATCGTGATGAAGT-3′ (sense) 5′-ATCCCAGCC TCCGTTATCCT-3′ (antisense) | NM_016993.1 |
β-Actin | 5′-TGCTATGTT GCCCTAGACTTCG-3′ (sense) 5′-GTTGGCATAGAG GTCTTTACGG-3′ (antisense) | NM_031144 |
Target Protein | Complex Energy (Kcal/mol) | Interacting Residues |
---|---|---|
hTLR4/MD2 | −5.9 | Tyr102 |
hTLR2 | −5.5 | Leu350 |
Keap1 | −5.4 | Ser363 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mohamed, M.E.; Elmorsy, M.A.; Younis, N.S. Renal Ischemia/Reperfusion Mitigation via Geraniol: The Role of Nrf-2/HO-1/NQO-1 and TLR2,4/MYD88/NFκB Pathway. Antioxidants 2022, 11, 1568. https://doi.org/10.3390/antiox11081568
Mohamed ME, Elmorsy MA, Younis NS. Renal Ischemia/Reperfusion Mitigation via Geraniol: The Role of Nrf-2/HO-1/NQO-1 and TLR2,4/MYD88/NFκB Pathway. Antioxidants. 2022; 11(8):1568. https://doi.org/10.3390/antiox11081568
Chicago/Turabian StyleMohamed, Maged E., Mohammad A. Elmorsy, and Nancy S. Younis. 2022. "Renal Ischemia/Reperfusion Mitigation via Geraniol: The Role of Nrf-2/HO-1/NQO-1 and TLR2,4/MYD88/NFκB Pathway" Antioxidants 11, no. 8: 1568. https://doi.org/10.3390/antiox11081568