Eugenol Attenuates Transmissible Gastroenteritis Virus-Induced Oxidative Stress and Apoptosis Via ROS-NRF2-ARE Signaling
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Virus, Cell Culture, and Treatment
2.3. Experimental Design and Diet
2.4. Sample Collection
2.5. Serum Antioxidant Indexes
2.6. Western blotting and RT-PCR
2.7. Intestinal Epithelial Cell Apoptosis and ROS Level Detection
2.8. Cell Viability
2.9. Statistical Analysis
3. Results
3.1. Effects of Eugenol on Serum Antioxidant Indicators in TGEV-Infected Weaned Piglets
3.2. Effects of Eugenol on Jejunum Antioxidation-Related Genes in TGEV-Infected Weaned Piglets
3.3. Effects of Eugenol on Jejunum Antioxidation-Related Proteins in TGEV-Infected Weaned Piglets
3.4. Eugenol Decreases TGEV-Induced ROS Increase in Jejunal Epithelial Cells of Weaned Piglets
3.5. Eugenol Alleviates TGEV-Induced Jejunal Epithelial Cell Death in Piglets
3.6. TGEV Damages the Antioxidant Capacity of IPEC-J2 Cells
3.7. Effect of Eugenol on IPEC-J2 Cells Viability
3.8. Eugenol Alleviates TGEV-Induced Oxidative Stress in IPEC-J2 Cells
3.9. Eugenol Relieves Oxidative Stress by Removing ROS
3.10. Effect of Eugenol on TGEV-Induced IPEC-J2 Cells’ Death Pattern
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Singh, D.; Yi, S.V. On the origin and evolution of SARS-CoV-2. Exp. Mol. Med. 2021, 53, 537–547. [Google Scholar] [CrossRef] [PubMed]
- Song, D.; Moon, H.; Kang, B. Porcine epidemic diarrhea: A review of current epidemiology and available vaccines. Clin. Exp. Vaccine Res. 2015, 4, 166–176. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Wang, H.-Y. Porcine enteric coronaviruses: An updated overview of the pathogenesis, prevalence, and diagnosis. Vet. Res. Commun. 2021, 45, 75–86. [Google Scholar] [CrossRef] [PubMed]
- Wu, A.; Yu, B.; Zhang, K.; Xu, Z.; Wu, D.; He, J.; Luo, J.; Luo, Y.; Yu, J.; Zheng, P.; et al. Transmissible gastroenteritis virus targets Paneth cells to inhibit the self-renewal and differentiation of Lgr5 intestinal stem cells via Notch signaling. Cell Death Dis. 2020, 11, 40. [Google Scholar] [CrossRef] [PubMed]
- Pu, J.; Chen, D.; Tian, G.; He, J.; Huang, Z.; Zheng, P.; Mao, X.; Yu, J.; Luo, J.; Luo, Y.; et al. All-Trans Retinoic Acid Attenuates Transmissible Gastroenteritis Virus-Induced Inflammation in IPEC-J2 Cells via Suppressing the RLRs/NF-κB Signaling Pathway. Front. Immunol. 2022, 13, 734171. [Google Scholar] [CrossRef]
- Ding, L.; Li, J.; Li, W.; Fang, Z.; Li, N.; Wu, S.; Li, J.; Hong, M. p53- and ROS-mediated AIF pathway involved in TGEV-induced apoptosis. J. Vet. Med. Sci. 2018, 80, 1775–1781. [Google Scholar] [CrossRef]
- Ding, L.; Zhao, X.; Huang, Y.; Du, Q.; Dong, F.; Zhang, H.; Song, X.; Zhang, W.; Tong, D. Regulation of ROS in transmissible gastroenteritis virus-activated apoptotic signaling. Biochem. Biophys. Res. Commun. 2013, 442, 33–37. [Google Scholar] [CrossRef]
- Piechota-Polanczyk, A.; Fichna, J. Review article: The role of oxidative stress in pathogenesis and treatment of inflammatory bowel diseases. Naunyn Schmiedeberg’s Arch. Pharmacol. 2014, 387, 605–620. [Google Scholar] [CrossRef]
- Bhattacharyya, A.; Chattopadhyay, R.; Mitra, S.; Crowe, S.E. Oxidative stress: An essential factor in the pathogenesis of gastrointestinal mucosal diseases. Physiol. Rev. 2014, 94, 329–354. [Google Scholar] [CrossRef]
- Filomeni, G.; de Zio, D.; Cecconi, F. Oxidative stress and autophagy: The clash between damage and metabolic needs. Cell Death Differ. 2015, 22, 377–388. [Google Scholar] [CrossRef] [Green Version]
- Pan, X.; Zhou, Y.; Duan, X.; Cui, J.; Liu, J.; Song, X.; Ma, W.; Zhang, W.; Liu, Y.; Fan, Y. The inhibitory effect Polygonum Cillinerve polysaccharide on transmissible gastroenteritis virus of swine. Res. Vet. Sci. 2021, 140, 47–55. [Google Scholar] [CrossRef] [PubMed]
- Flores-Romero, H.; Ros, U.; Garcia-Saez, A.J. Pore formation in regulated cell death. EMBO J. 2020, 39, e105753. [Google Scholar] [CrossRef] [PubMed]
- Kaminskyy, V.O.; Zhivotovsky, B. Free radicals in cross talk between autophagy and apoptosis. Antioxid. Redox Signal. 2014, 21, 86–102. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.-H.; Song, T.-Z.; Zheng, H.-Y.; Li, Y.-H.; Zheng, Y.-T. Jejunal epithelial barrier disruption triggered by reactive oxygen species in early SIV infected rhesus macaques. Free Radic. Biol. Med. 2021, 177, 143–155. [Google Scholar] [CrossRef]
- Pu, J.; Chen, D.; Tian, G.; He, J.; Huang, Z.; Zheng, P.; Mao, X.; Yu, J.; Luo, J.; Luo, Y.; et al. All-Trans Retinoic Acid Attenuates Transmissible Gastroenteritis Virus-Induced Apoptosis in IPEC-J2 Cells via Inhibiting ROS-Mediated P38MAPK Signaling Pathway. Antioxidants 2022, 11, 345. [Google Scholar] [CrossRef]
- Pluskal, T.; Weng, J.-K. Natural product modulators of human sensations and mood: Molecular mechanisms and therapeutic potential. Chem. Soc. Rev. 2018, 47, 1592–1637. [Google Scholar] [CrossRef]
- Ruiz-Medina, B.E.; Lerma, D.; Hwang, M.; Ross, J.A.; Skouta, R.; Aguilera, R.J.; Kirken, R.A.; Varela-Ramirez, A.; Robles-Escajeda, E. Green barley mitigates cytotoxicity in human lymphocytes undergoing aggressive oxidative stress, via activation of both the Lyn/PI3K/Akt and MAPK/ERK pathways. Sci. Rep. 2019, 9, 6005. [Google Scholar] [CrossRef]
- Morán-Santibañez, K.; Vasquez, A.H.; Varela-Ramirez, A.; Henderson, V.; Sweeney, J.; Odero-Marah, V.; Fenelon, K.; Skouta, R. Larrea tridentata Extract Mitigates Oxidative Stress-Induced Cytotoxicity in Human Neuroblastoma SH-SY5Y Cells. Antioxidants 2019, 8, 427. [Google Scholar] [CrossRef]
- Huang, T.; Che, Q.; Chen, X.; Chen, D.; Yu, B.; He, J.; Chen, H.; Yan, H.; Zheng, P.; Luo, Y.; et al. Apple Polyphenols Improve Intestinal Antioxidant Capacity and Barrier Function by Activating the Nrf2/Keap1 Signaling Pathway in a Pig Model. J. Agric. Food Chem. 2022, 70, 7576–7585. [Google Scholar] [CrossRef]
- Hseu, Y.-C.; Vudhya Gowrisankar, Y.; Wang, L.-W.; Zhang, Y.-Z.; Chen, X.-Z.; Huang, P.-J.; Yen, H.-R.; Yang, H.-L. The in vitro and in vivo depigmenting activity of pterostilbene through induction of autophagy in melanocytes and inhibition of UVA-irradiated α-MSH in keratinocytes via Nrf2-mediated antioxidant pathways. Redox Biol. 2021, 44, 102007. [Google Scholar] [CrossRef]
- Taleuzzaman, M.; Jain, P.; Verma, R.; Iqbal, Z.; Mirza, M.A. Eugenol as a Potential Drug Candidate: A Review. Curr. Top. Med. Chem. 2021, 21, 1804–1815. [Google Scholar] [CrossRef] [PubMed]
- Barboza, J.N.; da Silva Maia Bezerra Filho, C.; Silva, R.O.; Medeiros, J.V.R.; de Sousa, D.P. An Overview on the Anti-inflammatory Potential and Antioxidant Profile of Eugenol. Oxid. Med. Cell. Longev. 2018, 2018, 3957262. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Wu, X.; Tang, S.; Yin, J.; Song, Z.; He, X.; Yin, Y. Eugenol Alleviates Dextran Sulfate Sodium-Induced Colitis Independent of Intestinal Microbiota in Mice. J. Agric. Food Chem. 2021, 69, 10506–10514. [Google Scholar] [CrossRef] [PubMed]
- Lu, M.-C.; Ji, J.-A.; Jiang, Z.-Y.; You, Q.-D. The Keap1-Nrf2-ARE Pathway As a Potential Preventive and Therapeutic Target: An Update. Med. Res. Rev. 2016, 36, 924–963. [Google Scholar] [CrossRef]
- Abed, D.A.; Goldstein, M.; Albanyan, H.; Jin, H.; Hu, L. Discovery of direct inhibitors of Keap1-Nrf2 protein-protein interaction as potential therapeutic and preventive agents. Acta Pharm. Sin. B 2015, 5, 285–299. [Google Scholar] [CrossRef] [PubMed]
- Du, J.; Chen, D.; Yu, B.; He, J.; Yu, J.; Mao, X.; Luo, Y.; Zheng, P.; Luo, J. L-Leucine Promotes STAT1 and ISGs Expression in TGEV-Infected IPEC-J2 Cells via mTOR Activation. Front. Immunol. 2021, 12, 656573. [Google Scholar] [CrossRef]
- Robles-Escajeda, E.; Lerma, D.; Nyakeriga, A.M.; Ross, J.A.; Kirken, R.A.; Aguilera, R.J.; Varela-Ramirez, A. Searching in mother nature for anti-cancer activity: Anti-proliferative and pro-apoptotic effect elicited by green barley on leukemia/lymphoma cells. PLoS ONE 2013, 8, e73508. [Google Scholar] [CrossRef]
- Kensler, T.W.; Wakabayashi, N.; Biswal, S. Cell survival responses to environmental stresses via the Keap1-Nrf2-ARE pathway. Annu. Rev. Pharmacol. Toxicol. 2007, 47, 89–116. [Google Scholar] [CrossRef]
- G Bardallo, R.; Panisello-Roselló, A.; Sanchez-Nuno, S.; Alva, N.; Roselló-Catafau, J.; Carbonell, T. Nrf2 and oxidative stress in liver ischemia/reperfusion injury. FEBS J. 2021. [Google Scholar] [CrossRef]
- Su, L.-J.; Zhang, J.-H.; Gomez, H.; Murugan, R.; Hong, X.; Xu, D.; Jiang, F.; Peng, Z.-Y. Reactive Oxygen Species-Induced Lipid Peroxidation in Apoptosis, Autophagy, and Ferroptosis. Oxid. Med. Cell. Longev. 2019, 2019, 5080843. [Google Scholar] [CrossRef] [Green Version]
- Guo, Z.; Mo, Z. Keap1-Nrf2 signaling pathway in angiogenesis and vascular diseases. J. Tissue Eng. Regen. Med. 2020, 14, 869–883. [Google Scholar] [CrossRef] [PubMed]
- Zheng, S.; Deng, Z.; Chen, F.; Zheng, L.; Pan, Y.; Xing, Q.; Tsao, R.; Li, H. Synergistic antioxidant effects of petunidin and lycopene in H9c2 cells submitted to hydrogen peroxide: Role of Akt/Nrf2 pathway. J. Food Sci. 2020, 85, 1752–1763. [Google Scholar] [CrossRef] [PubMed]
- Riedl, M.A.; Saxon, A.; Diaz-Sanchez, D. Oral sulforaphane increases Phase II antioxidant enzymes in the human upper airway. Clin. Immunol. 2009, 130, 244–251. [Google Scholar] [CrossRef] [PubMed]
- Tsikas, D. Assessment of lipid peroxidation by measuring malondialdehyde (MDA) and relatives in biological samples: Analytical and biological challenges. Anal. Biochem. 2017, 524, 13–30. [Google Scholar] [CrossRef] [PubMed]
- Kang, R.; Li, R.; Dai, P.; Li, Z.; Li, Y.; Li, C. Deoxynivalenol induced apoptosis and inflammation of IPEC-J2 cells by promoting ROS production. Environ. Pollut. 2019, 251, 689–698. [Google Scholar] [CrossRef]
- Ji, P.; Huang, H.; Yuan, S.; Wang, L.; Wang, S.; Chen, Y.; Feng, N.; Veroniaina, H.; Wu, Z.; Wu, Z.; et al. ROS-Mediated Apoptosis and Anticancer Effect Achieved by Artesunate and Auxiliary Fe(II) Released from Ferriferous Oxide-Containing Recombinant Apoferritin. Adv. Healthc. Mater. 2019, 8, e1900911. [Google Scholar] [CrossRef]
- Zhao, B.; Luo, J.; Wang, Y.; Zhou, L.; Che, J.; Wang, F.; Peng, S.; Zhang, G.; Shang, P. Metformin Suppresses Self-Renewal Ability and Tumorigenicity of Osteosarcoma Stem Cells via Reactive Oxygen Species-Mediated Apoptosis and Autophagy. Oxid. Med. Cell. Longev. 2019, 2019, 9290728. [Google Scholar] [CrossRef]
- Carvalho, R.P.R.; Lima, G.D.d.A.; Machado-Neves, M. Effect of eugenol treatment in hyperglycemic murine models: A meta-analysis. Pharmacol. Res. 2021, 165, 105315. [Google Scholar] [CrossRef]
- Zhang, L.; Wang, K.; Lei, Y.; Li, Q.; Nice, E.C.; Huang, C. Redox signaling: Potential arbitrator of autophagy and apoptosis in therapeutic response. Free Radic. Biol. Med. 2015, 89, 452–465. [Google Scholar] [CrossRef]
- DeNicola, G.M.; Chen, P.-H.; Mullarky, E.; Sudderth, J.A.; Hu, Z.; Wu, D.; Tang, H.; Xie, Y.; Asara, J.M.; Huffman, K.E.; et al. NRF2 regulates serine biosynthesis in non-small cell lung cancer. Nat. Genet. 2015, 47, 1475–1481. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Singh, A.; Misra, V.; Thimmulappa, R.K.; Lee, H.; Ames, S.; Hoque, M.O.; Herman, J.G.; Baylin, S.B.; Sidransky, D.; Gabrielson, E.; et al. Dysfunctional KEAP1-NRF2 interaction in non-small-cell lung cancer. PLoS Med. 2006, 3, e420. [Google Scholar] [CrossRef] [PubMed]
- Erlank, H.; Elmann, A.; Kohen, R.; Kanner, J. Polyphenols activate Nrf2 in astrocytes via H2O2, semiquinones, and quinones. Free Radic. Biol. Med. 2011, 51, 2319–2327. [Google Scholar] [CrossRef] [PubMed]
- Cuadrado, A.; Pajares, M.; Benito, C.; Jiménez-Villegas, J.; Escoll, M.; Fernández-Ginés, R.; Garcia Yagüe, A.J.; Lastra, D.; Manda, G.; Rojo, A.I.; et al. Can Activation of NRF2 Be a Strategy against COVID-19? Trends Pharmacol. Sci. 2020, 41, 598–610. [Google Scholar] [CrossRef] [PubMed]
- Olagnier, D.; Farahani, E.; Thyrsted, J.; Blay-Cadanet, J.; Herengt, A.; Idorn, M.; Hait, A.; Hernaez, B.; Knudsen, A.; Iversen, M.B.; et al. SARS-CoV2-mediated suppression of NRF2-signaling reveals potent antiviral and anti-inflammatory activity of 4-octyl-itaconate and dimethyl fumarate. Nat. Commun. 2020, 11, 4938. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Zhu, S.; Han, W.; Cai, Y.; Liu, C. DMEP induces mitochondrial damage regulated by inhibiting Nrf2 and SIRT1/PGC-1α signaling pathways in HepG2 cells. Ecotoxicol. Environ. Saf. 2021, 221, 112449. [Google Scholar] [CrossRef] [PubMed]
- Foo, J.; Bellot, G.; Pervaiz, S.; Alonso, S. Mitochondria-mediated oxidative stress during viral infection. Trends Microbiol. 2022, 30, 679–692. [Google Scholar] [CrossRef]
- Tummers, B.; Green, D.R. The evolution of regulated cell death pathways in animals and their evasion by pathogens. Physiol. Rev. 2022, 102, 411–454. [Google Scholar] [CrossRef] [PubMed]
- Orzalli, M.H.; Kagan, J.C. Apoptosis and Necroptosis as Host Defense Strategies to Prevent Viral Infection. Trends Cell Biol. 2017, 27, 800–809. [Google Scholar] [CrossRef] [PubMed]
- Bhargava, P.; Schnellmann, R.G. Mitochondrial energetics in the kidney. Nat. Rev. Nephrol. 2017, 13, 629–646. [Google Scholar] [CrossRef] [PubMed]
- Shang, H.-S.; Shih, Y.-L.; Lee, C.-H.; Hsueh, S.-C.; Liu, J.-Y.; Liao, N.-C.; Chen, Y.-L.; Huang, Y.-P.; Lu, H.-F.; Chung, J.-G. Sulforaphane-induced apoptosis in human leukemia HL-60 cells through extrinsic and intrinsic signal pathways and altering associated genes expression assayed by cDNA microarray. Environ. Toxicol. 2017, 32, 311–328. [Google Scholar] [CrossRef] [PubMed]
- Ding, L.; Xu, X.; Huang, Y.; Li, Z.; Zhang, K.; Chen, G.; Yu, G.; Wang, Z.; Li, W.; Tong, D. Transmissible gastroenteritis virus infection induces apoptosis through FasL- and mitochondria-mediated pathways. Vet. Microbiol. 2012, 158, 12–22. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Li, J.; Wang, P.-H.; Yang, N.; Huang, J.; Ou, J.; Xu, T.; Zhao, X.; Liu, T.; Huang, X.; et al. SARS-CoV-2 spike promotes inflammation and apoptosis through autophagy by ROS-suppressed PI3K/AKT/mTOR signaling. Biochim. Biophys. Acta Mol. Basis Dis. 2021, 1867, 166260. [Google Scholar] [CrossRef] [PubMed]
- Pei, J.; Deng, J.; Ye, Z.; Wang, J.; Gou, H.; Liu, W.; Zhao, M.; Liao, M.; Yi, L.; Chen, J. Absence of autophagy promotes apoptosis by modulating the ROS-dependent RLR signaling pathway in classical swine fever virus-infected cells. Autophagy 2016, 12, 1738–1758. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Xu, Y.; Zhang, Q.; Yang, F.; Yin, Z.; Wang, L.; Li, Q. Porcine epidemic diarrhea virus infections induce apoptosis in Vero cells via a reactive oxygen species (ROS)/p53, but not p38 MAPK and SAPK/JNK signalling pathways. Vet. Microbiol. 2019, 232, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Xiang, H.; Bai, X.; Fei, N.; Huang, Y.; Song, X.; Zhang, H.; Zhang, L.; Tong, D. Porcine parvovirus infection activates mitochondria-mediated apoptotic signaling pathway by inducing ROS accumulation. Virol. J. 2016, 13, 26. [Google Scholar] [CrossRef]
- Imai, Y.; Kuba, K.; Neely, G.G.; Yaghubian-Malhami, R.; Perkmann, T.; van Loo, G.; Ermolaeva, M.; Veldhuizen, R.; Leung, Y.H.C.; Wang, H.; et al. Identification of oxidative stress and Toll-like receptor 4 signaling as a key pathway of acute lung injury. Cell 2008, 133, 235–249. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Wang, J.; Wang, L.; Aliyari, S.; Cheng, G. SARS-CoV-2 virus NSP14 Impairs NRF2/HMOX1 activation by targeting Sirtuin 1. Cell. Mol. Immunol. 2022, 19, 872–882. [Google Scholar] [CrossRef]
- Laforge, M.; Elbim, C.; Frère, C.; Hémadi, M.; Massaad, C.; Nuss, P.; Benoliel, J.-J.; Becker, C. Tissue damage from neutrophil-induced oxidative stress in COVID-19. Nat. Rev. Immunol. 2020, 20, 515–516. [Google Scholar] [CrossRef]
- Cai, Z.; Lu, C.; He, J.; Liu, L.; Zou, Y.; Zhang, Z.; Zhu, Z.; Ge, X.; Wu, A.; Jiang, T.; et al. Identification and characterization of circRNAs encoded by MERS-CoV, SARS-CoV-1 and SARS-CoV-2. Brief. Bioinform. 2021, 22, 1297–1308. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Zhao, C.; Fu, Z.; Fu, Y.; Su, Z.; Li, Y.; Zhou, Y.; Tan, Y.; Li, J.; Xiang, Y.; et al. Genome-scale CRISPR screen identifies TMEM41B as a multi-function host factor required for coronavirus replication. PLoS Pathog. 2021, 17, e1010113. [Google Scholar] [CrossRef]
- Zhao, L.; Li, L.; Xue, M.; Liu, X.; Jiang, C.; Wang, W.; Tang, L.; Feng, L.; Liu, P. Gasdermin D Inhibits Coronavirus Infection by Promoting the Noncanonical Secretion of Beta Interferon. mBio 2022, 13, e0360021. [Google Scholar] [CrossRef] [PubMed]
Ingredients | % | Nutrient Level 3 | Contents |
---|---|---|---|
Corn | 33.80 | Digestible energy (calculated, Mcal/kg) | 3.54 |
Extruded corn | 22.20 | Crude Protein (%) | 19.49 |
Soybean meal | 7.42 | Calcium (%) | 0.75 |
Extruded full-fat soybean | 8.79 | Available phosphorus (%) | 0.37 |
Fish meal | 3.94 | Lysine | 1.35 |
Whey powder | 5.00 | Methionine | 0.39 |
Soybean protein concentrate | 8.00 | Methionine + cysteine | 0.68 |
Soybean oil | 1.65 | Threonine | 0.80 |
Sucrose | 2.00 | Tryptophan | 0.22 |
Limestone | 0.62 | ||
Dicalcium phosphate | 0.46 | ||
NaCl | 0.20 | ||
L-Lysine HCl (78%) | 0.32 | ||
DL-Methionine | 0.07 | ||
L-Threonine (98.5%) | 0.02 | ||
Tryptophan (98%) | 0.01 | ||
Chloride choline | 0.15 | ||
Vitamin premix 1 | 0.05 | ||
Mineral premix 2 | 0.30 | ||
Total | 100 |
Gene | Primers | Sequences | Product size | Accession Numbers |
---|---|---|---|---|
β-actin | Forward | GCAAATGCTTCTAGGCGGAC | 148 | XM_021086047.1 |
Reverse | GCGTCCATCACAGCTTCTCA | |||
Keap1 | Forward | TCTGCTTAGTCATGGTGACCT | 143 | NM_001114671.1 |
Reverse | AAGGGACAACACCACCACTG | |||
Nrf2 | Forward | CTACGGGATTGGGGTTTGGG | 124 | XM_013984303.2 |
Reverse | AACTCAAACAGGGGAAGGGC | |||
HO-1 | Forward | TACCGCTCCCGAATGAACAC | 140 | NM_001004027.1 |
Reverse | TGGTCCTTAGTGTCCTGGGT | |||
NQO1 | Forward | TGCTTACACATACGCTGCCA | 113 | NM_001159613.1 |
Reverse | CGTGGATACCCTGCAGAGAG | |||
Bcl-2 | Forward | AGCATGCGGCCTCTATTTGA | 120 | XM_021099593.1 |
Reverse | GGCCCGTGGACTTCACTTAT | |||
Caspase-3 | Forward | GGATTGAGACGGACAGTGGG | 124 | NM_214131.1 |
Reverse | CCGTCCTTTGAATTTCGCCA | |||
Caspase-8 | Forward | GGATCCCAGGATTTGCCTCC | 135 | NM_001031779.2 |
Reverse | CAGGCTCAGGAACTTGAGGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, K.; Tang, Y.; Wu, X.; Liang, H.; Chen, D.; Yu, B.; He, J.; Mao, X.; Huang, Z.; Yan, H.; et al. Eugenol Attenuates Transmissible Gastroenteritis Virus-Induced Oxidative Stress and Apoptosis Via ROS-NRF2-ARE Signaling. Antioxidants 2022, 11, 1838. https://doi.org/10.3390/antiox11091838
Wang K, Tang Y, Wu X, Liang H, Chen D, Yu B, He J, Mao X, Huang Z, Yan H, et al. Eugenol Attenuates Transmissible Gastroenteritis Virus-Induced Oxidative Stress and Apoptosis Via ROS-NRF2-ARE Signaling. Antioxidants. 2022; 11(9):1838. https://doi.org/10.3390/antiox11091838
Chicago/Turabian StyleWang, Kang, Yan Tang, Xiu Wu, Hongmin Liang, Daiwen Chen, Bing Yu, Jun He, Xiangbing Mao, Zhiqing Huang, Hui Yan, and et al. 2022. "Eugenol Attenuates Transmissible Gastroenteritis Virus-Induced Oxidative Stress and Apoptosis Via ROS-NRF2-ARE Signaling" Antioxidants 11, no. 9: 1838. https://doi.org/10.3390/antiox11091838