Caffeic Acid Phenethyl Ester Suppresses Oxidative Stress and Regulates M1/M2 Microglia Polarization via Sirt6/Nrf2 Pathway to Mitigate Cognitive Impairment in Aged Mice following Anesthesia and Surgery
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Establishment of POCD Model
2.3. Behaviors Assessment
2.3.1. Open Field Test (OFT)
2.3.2. Y-Maze Test (YMT)
2.3.3. Morris Water Maze Test (MWMT)
2.4. Reactive Oxygen Species (ROS) in the Hippocampus
2.5. Oxidative Stress Indicators in Mice Plasma
2.6. Cells
2.7. Proliferation and Viability Assay of BV2 Cells Exposed to H2O2 and CAPE
2.8. Reactive Oxygen Species (ROS) in BV2 Cells
2.9. Flow Cytometry (FCM)
2.10. Immunofluorescence (IF)
2.11. Real-Time Quantitative PCR (RT-qPCR)
2.12. Statistical Analysis
3. Results
3.1. CAPE Pretreatment Ameliorates Cognitive Dysfunction following Anesthesia and Surgery
3.2. CAPE Pretreatment Suppresses Oxidative Stress Caused by Anesthesia and Surgery
3.3. CAPE Pretreatment Promotes the Switch of Hippocampal Microglia from the M1 to the M2 Type after Anesthesia and Surgery
3.4. CAPE Pretreatment Enhances Hippocampal Sirt6/Nrf2 Signaling Pathway following Anesthesia and Surgery
3.5. CAPE Alleviates H2O2-Induced ROS Generation in BV2 Cells
3.6. CAPE Pretreatment Increases Sirt6/Nrf2 Expression Levels in H2O2-Induced BV2 Cells
3.7. CAPE Suppresses ROS Generation through Activating Sirt6 in H2O2-Induced BV2 Cells
3.8. CAPE Promotes the Switch of H2O2-Induced BV2 Cells from the M1 to the M2 Type through Activating Sirt6
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Deiner, S.; Luo, X.; Lin, H.M.; Sessler, D.I.; Saager, L.; Sieber, F.E.; Lee, H.B.; Sano, M.; The Dexlirium Writing Group; Jankowski, C.; et al. Intraoperative Infusion of Dexmedetomidine for Prevention of Postoperative Delirium and Cognitive Dysfunction in Elderly Patients Undergoing Major Elective Noncardiac Surgery: A Randomized Clinical Trial. JAMA Surg. 2017, 152, e171505. [Google Scholar] [CrossRef]
- Takazawa, T.; Horiuchi, T.; Orihara, M.; Nagumo, K.; Tomioka, A.; Ideno, Y.; Hayashi, K.; Yashima, H.; Araki, T.; Hatayama, K.; et al. Prevention of Postoperative Cognitive Dysfunction by Minocycline in Elderly Patients after Total Knee Arthroplasty: A Randomized, Double-Blind, Placebo-Controlled Clinical Trial. Anesthesiology 2023, 138, 172–183. [Google Scholar] [CrossRef] [PubMed]
- Moller, J.T.; Cluitmans, P.; Rasmussen, L.S.; Houx, P.; Rasmussen, H.; Canet, J.; Rabbitt, P.; Jolles, J.; Larsen, K.; Hanning, C.D.; et al. Long-term postoperative cognitive dysfunction in the elderly ISPOCD1 study. ISPOCD investigators. International Study of Post-Operative Cognitive Dysfunction. Lancet 1998, 351, 857–861. [Google Scholar] [CrossRef] [PubMed]
- Newman, M.F.; Grocott, H.P.; Mathew, J.P.; White, W.D.; Landolfo, K.; Reves, J.G.; Laskowitz, D.T.; Mark, D.B.; Blumenthal, J.A.; The Neurologic Outcome Research Group; et al. Report of the substudy assessing the impact of neurocognitive function on quality of life 5 years after cardiac surgery. Stroke 2001, 32, 2874–2881. [Google Scholar] [CrossRef] [PubMed]
- Newman, M.F.; Kirchner, J.L.; Phillips-Bute, B.; Gaver, V.; Grocott, H.; Jones, R.H.; Mark, D.B.; Reves, J.G.; Blumenthal, J.A.; The Neurologic Outcome Research Group; et al. Longitudinal assessment of neurocognitive function after coronary-artery bypass surgery. N. Engl. J. Med. 2001, 344, 395–402. [Google Scholar] [CrossRef] [PubMed]
- Dou, Y.; Wu, H.J.; Li, H.Q.; Qin, S.; Wang, Y.E.; Li, J.; Lou, H.F.; Chen, Z.; Li, X.M.; Luo, Q.M.; et al. Microglial migration mediated by ATP-induced ATP release from lysosomes. Cell Res. 2012, 22, 1022–1033. [Google Scholar] [CrossRef] [PubMed]
- Zha, Z.; Gao, Y.F.; Ji, J.; Sun, Y.Q.; Li, J.L.; Qi, F.; Zhang, N.; Jin, L.Y.; Xue, B.; Yang, T.; et al. Bu Shen Yi Sui Capsule Alleviates Neuroinflammation and Demyelination by Promoting Microglia toward M2 Polarization, Which Correlates with Changes in miR-124 and miR-155 in Experimental Autoimmune Encephalomyelitis. Oxid. Med. Cell. Longev. 2021, 2021, 5521503. [Google Scholar] [CrossRef]
- Li, Y.; Liu, T.; Li, Y.; Han, D.; Hong, J.; Yang, N.; He, J.; Peng, R.; Mi, X.; Kuang, C.; et al. Baicalin Ameliorates Cognitive Impairment and Protects Microglia from LPS-Induced Neuroinflammation via the SIRT1/HMGB1 Pathway. Oxid. Med. Cell. Longev. 2020, 2020, 4751349. [Google Scholar] [CrossRef]
- Lan, X.; Han, X.; Li, Q.; Yang, Q.W.; Wang, J. Modulators of microglial activation and polarization after intracerebral haemorrhage. Nat. Rev. Neurol. 2017, 13, 420–433. [Google Scholar] [CrossRef]
- Jin, X.; Liu, M.Y.; Zhang, D.F.; Zhong, X.; Du, K.; Qian, P.; Gao, H.; Wei, M.J. Natural products as a potential modulator of microglial polarization in neurodegenerative diseases. Pharmacol. Res. 2019, 145, 104253. [Google Scholar] [CrossRef]
- Walker, D.G.; Lue, L.F. Immune phenotypes of microglia in human neurodegenerative disease: Challenges to detecting microglial polarization in human brains. Alzheimers Res. Ther. 2015, 7, 56. [Google Scholar] [CrossRef]
- Yang, X.; Xu, S.; Qian, Y.; Xiao, Q. Resveratrol regulates microglia M1/M2 polarization via PGC-1alpha in conditions of neuroinflammatory injury. Brain Behav. Immun. 2017, 64, 162–172. [Google Scholar] [CrossRef] [PubMed]
- Ji, J.; Xue, T.F.; Guo, X.D.; Yang, J.; Guo, R.B.; Wang, J.; Huang, J.Y.; Zhao, X.J.; Sun, X.L. Antagonizing peroxisome proliferator-activated receptor gamma facilitates M1-to-M2 shift of microglia by enhancing autophagy via the LKB1-AMPK signaling pathway. Aging Cell 2018, 17, e12774. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.; Li, X.; Li, N.; Wang, X.; He, S.; Li, W.; Fan, W.; Li, R.; Liu, J.; Hou, S. Icariin alleviates uveitis by targeting peroxiredoxin 3 to modulate retinal microglia M1/M2 phenotypic polarization. Redox. Biol. 2022, 52, 102297. [Google Scholar] [CrossRef]
- Roichman, A.; Elhanati, S.; Aon, M.A.; Abramovich, I.; Di Francesco, A.; Shahar, Y.; Avivi, M.Y.; Shurgi, M.; Rubinstein, A.; Wiesner, Y.; et al. Restoration of energy homeostasis by SIRT6 extends healthy lifespan. Nat. Commun. 2021, 12, 3208. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.H.; Zheng, J.; Feldman, J.L.; Klein, M.A.; Kuznetsov, V.I.; Peterson, C.L.; Griffin, P.R.; Denu, J.M. Multivalent interactions drive nucleosome binding and efficient chromatin deacetylation by SIRT6. Nat. Commun. 2020, 11, 5244. [Google Scholar] [CrossRef] [PubMed]
- Rezazadeh, S.; Yang, D.; Tombline, G.; Simon, M.; Regan, S.P.; Seluanov, A.; Gorbunova, V. SIRT6 promotes transcription of a subset of NRF2 targets by mono-ADP-ribosylating BAF170. Nucleic Acids Res. 2019, 47, 7914–7928. [Google Scholar] [CrossRef]
- Portillo, M.; Eremenko, E.; Kaluski, S.; Garcia-Venzor, A.; Onn, L.; Stein, D.; Slobodnik, Z.; Zaretsky, A.; Ueberham, U.; Einav, M.; et al. SIRT6-CBP-dependent nuclear Tau accumulation and its role in protein synthesis. Cell Rep. 2021, 35, 109035. [Google Scholar] [CrossRef]
- Pradhan, R.; Singh, A.K.; Kumar, P.; Bajpai, S.; Pathak, M.; Chatterjee, P.; Dwivedi, S.; Dey, A.B.; Dey, S. Blood Circulatory Level of Seven Sirtuins in Alzheimer’s Disease: Potent Biomarker Based on Translational Research. Mol. Neurobiol. 2022, 59, 1440–1451. [Google Scholar] [CrossRef]
- Okun, E.; Marton, D.; Cohen, D.; Griffioen, K.; Kanfi, Y.; Illouz, T.; Madar, R.; Cohen, H.Y. Sirt6 alters adult hippocampal neurogenesis. PLoS ONE 2017, 12, e0179681. [Google Scholar] [CrossRef]
- Song, M.Y.; Yi, F.; Xiao, H.; Yin, J.; Huang, Q.; Xia, J.; Yin, X.M.; Wen, Y.B.; Zhang, L.; Liu, Y.H.; et al. Energy restriction induced SIRT6 inhibits microglia activation and promotes angiogenesis in cerebral ischemia via transcriptional inhibition of TXNIP. Cell Death Dis. 2022, 13, 449. [Google Scholar] [CrossRef] [PubMed]
- He, T.; Shang, J.; Gao, C.; Guan, X.; Chen, Y.; Zhu, L.; Zhang, L.; Zhang, C.; Zhang, J.; Pang, T. A novel SIRT6 activator ameliorates neuroinflammation and ischemic brain injury via EZH2/FOXC1 axis. Acta Pharm. Sin. B 2021, 11, 708–726. [Google Scholar] [CrossRef] [PubMed]
- Dong, L.; Jiang, Z.; Yang, L.; Hu, F.; Zheng, W.; Xue, P.; Jiang, S.; Andersen, M.E.; He, G.; Crabbe, M.J.C.; et al. The genotoxic potential of mixed nitrosamines in drinking water involves oxidative stress and Nrf2 activation. J. Hazard. Mater. 2022, 426, 128010. [Google Scholar] [CrossRef]
- Ren, P.; Chen, J.; Li, B.; Zhang, M.; Yang, B.; Guo, X.; Chen, Z.; Cheng, H.; Wang, P.; Wang, S.; et al. Nrf2 Ablation Promotes Alzheimer’s Disease-Like Pathology in APP/PS1 Transgenic Mice: The Role of Neuroinflammation and Oxidative Stress. Oxid. Med. Cell. Longev. 2020, 2020, 3050971. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Wang, J.; Chang, Y.; Li, R.; Sun, X.; Peng, L.; Zheng, W.; Qiu, W. Caffeic Acid Phenethyl Ester Protects against Experimental Autoimmune Encephalomyelitis by Regulating T Cell Activities. Oxid. Med. Cell. Longev. 2020, 2020, 7274342. [Google Scholar] [CrossRef] [PubMed]
- Wan, T.; Wang, Z.; Luo, Y.; Zhang, Y.; He, W.; Mei, Y.; Xue, J.; Li, M.; Pan, H.; Li, W.; et al. FA-97, a New Synthetic Caffeic Acid Phenethyl Ester Derivative, Protects against Oxidative Stress-Mediated Neuronal Cell Apoptosis and Scopolamine-Induced Cognitive Impairment by Activating Nrf2/HO-1 Signaling. Oxid. Med. Cell. Longev. 2019, 2019, 8239642. [Google Scholar] [CrossRef]
- Tsai, C.F.; Kuo, Y.H.; Yeh, W.L.; Wu, C.Y.; Lin, H.Y.; Lai, S.W.; Liu, Y.S.; Wu, L.H.; Lu, J.K.; Lu, D.Y. Regulatory effects of caffeic acid phenethyl ester on neuroinflammation in microglial cells. Int. J. Mol. Sci. 2015, 16, 5572–5589. [Google Scholar] [CrossRef]
- Kulkarni, N.P.; Vaidya, B.; Narula, A.S.; Sharma, S.S. Neuroprotective Potential of Caffeic Acid Phenethyl Ester (CAPE) in CNS Disorders: Mechanistic and Therapeutic Insights. Curr. Neuropharmacol. 2021, 19, 1401–1415. [Google Scholar] [CrossRef]
- Morroni, F.; Sita, G.; Graziosi, A.; Turrini, E.; Fimognari, C.; Tarozzi, A.; Hrelia, P. Neuroprotective Effect of Caffeic Acid Phenethyl Ester in A Mouse Model of Alzheimer’s Disease Involves Nrf2/HO-1 Pathway. Aging Dis. 2018, 9, 605–622. [Google Scholar] [CrossRef]
- Yan, J.; Luo, A.; Gao, J.; Tang, X.; Zhao, Y.; Zhou, B.; Zhou, Z.; Li, S. The role of SIRT1 in neuroinflammation and cognitive dysfunction in aged rats after anesthesia and surgery. Am. J. Transl. Res. 2019, 11, 1555–1568. [Google Scholar]
- Yan, J.; Luo, A.; Sun, R.; Tang, X.; Zhao, Y.; Zhang, J.; Zhou, B.; Zheng, H.; Yu, H.; Li, S. Resveratrol Mitigates Hippocampal Tau Acetylation and Cognitive Deficit by Activation SIRT1 in Aged Rats following Anesthesia and Surgery. Oxid. Med. Cell. Longev. 2020, 2020, 4635163. [Google Scholar] [CrossRef]
- Kawano, T.; Eguchi, S.; Iwata, H.; Tamura, T.; Kumagai, N.; Yokoyama, M. Impact of Preoperative Environmental Enrichment on Prevention of Development of Cognitive Impairment following Abdominal Surgery in a Rat Model. Anesthesiology 2015, 123, 160–170. [Google Scholar] [CrossRef]
- Vacas, S.; Degos, V.; Maze, M. Fragmented Sleep Enhances Postoperative Neuroinflammation but Not Cognitive Dysfunction. Anesth. Analg. 2017, 124, 270–276. [Google Scholar] [CrossRef]
- Feng, X.; Degos, V.; Koch, L.G.; Britton, S.L.; Zhu, Y.; Vacas, S.; Terrando, N.; Nelson, J.; Su, X.; Maze, M. Surgery results in exaggerated and persistent cognitive decline in a rat model of the Metabolic Syndrome. Anesthesiology 2013, 118, 1098–1105. [Google Scholar] [CrossRef]
- Wang, H.; Shang, Y.; Wang, E.; Xu, X.; Zhang, Q.; Qian, C.; Yang, Z.; Wu, S.; Zhang, T. MST1 mediates neuronal loss and cognitive deficits: A novel therapeutic target for Alzheimer’s disease. Prog. Neurobiol. 2022, 214, 102280. [Google Scholar] [CrossRef] [PubMed]
- Qian, C.; Yang, C.; Lu, M.; Bao, J.; Shen, H.; Deng, B.; Li, S.; Li, W.; Zhang, M.; Cao, C. Activating AhR alleviates cognitive deficits of Alzheimer’s disease model mice by upregulating endogenous Abeta catabolic enzyme Neprilysin. Theranostics 2021, 11, 8797–8812. [Google Scholar] [CrossRef] [PubMed]
- Velazquez, R.; Ferreira, E.; Knowles, S.; Fux, C.; Rodin, A.; Winslow, W.; Oddo, S. Lifelong choline supplementation ameliorates Alzheimer’s disease pathology and associated cognitive deficits by attenuating microglia activation. Aging Cell 2019, 18, e13037. [Google Scholar] [CrossRef]
- Luo, A.; Li, S.; Wang, X.; Xie, Z.; Li, S.; Hua, D. Cefazolin Improves Anesthesia and Surgery-Induced Cognitive Impairments by Modulating Blood-Brain Barrier Function, Gut Bacteria and Short Chain Fatty Acids. Front. Aging Neurosci. 2021, 13, 748637. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Sun, Y.M.; Huang, H.; Chen, C.; Wan, J.; Ma, L.H.; Sun, Y.Y.; Miao, H.H.; Wu, Y.Q. Sirtuin 3 protects against anesthesia/surgery-induced cognitive decline in aged mice by suppressing hippocampal neuroinflammation. J. Neuroinflamm. 2021, 18, 41. [Google Scholar] [CrossRef]
- Chen, J.; Liu, S.; Wang, X.; Huang, J.; Phillips, J.; Ma, D.; Ouyang, W.; Tong, J. HDAC6 Inhibition Alleviates Anesthesia and Surgery-Induced Less Medial Prefrontal-Dorsal Hippocampus Connectivity and Cognitive Impairment in Aged Rats. Mol. Neurobiol. 2022, 59, 6158–6169. [Google Scholar] [CrossRef]
- Lai, Z.; Shan, W.; Li, J.; Min, J.; Zeng, X.; Zuo, Z. Appropriate exercise level attenuates gut dysbiosis and valeric acid increase to improve neuroplasticity and cognitive function after surgery in mice. Mol. Psychiatry 2021, 26, 7167–7187. [Google Scholar] [CrossRef]
- Zheng, B.; Lai, R.; Li, J.; Zuo, Z. Critical role of P2X7 receptors in the neuroinflammation and cognitive dysfunction after surgery. Brain Behav. Immun. 2017, 61, 365–374. [Google Scholar] [CrossRef]
- Barrientos, R.M.; Hein, A.M.; Frank, M.G.; Watkins, L.R.; Maier, S.F. Intracisternal interleukin-1 receptor antagonist prevents postoperative cognitive decline and neuroinflammatory response in aged rats. J. Neurosci. 2012, 32, 14641–14648. [Google Scholar] [CrossRef] [PubMed]
- Wan, Y.; Xu, J.; Ma, D.; Zeng, Y.; Cibelli, M.; Maze, M. Postoperative impairment of cognitive function in rats: A possible role for cytokine-mediated inflammation in the hippocampus. Anesthesiology 2007, 106, 436–443. [Google Scholar] [CrossRef] [PubMed]
- Netto, M.B.; de Oliveira Junior, A.N.; Goldim, M.; Mathias, K.; Fileti, M.E.; da Rosa, N.; Laurentino, A.O.; de Farias, B.X.; Costa, A.B.; Rezin, G.T.; et al. Oxidative stress and mitochondrial dysfunction contributes to postoperative cognitive dysfunction in elderly rats. Brain Behav. Immun. 2018, 73, 661–669. [Google Scholar] [CrossRef] [PubMed]
- Zhan, G.; Hua, D.; Huang, N.; Wang, Y.; Li, S.; Zhou, Z.; Yang, N.; Jiang, R.; Zhu, B.; Yang, L.; et al. Anesthesia and surgery induce cognitive dysfunction in elderly male mice: The role of gut microbiota. Aging 2019, 11, 1778–1790. [Google Scholar] [CrossRef]
- Lu, S.M.; Yu, C.J.; Liu, Y.H.; Dong, H.Q.; Zhang, X.; Zhang, S.S.; Hu, L.Q.; Zhang, F.; Qian, Y.N.; Gui, B. S100A8 contributes to postoperative cognitive dysfunction in mice undergoing tibial fracture surgery by activating the TLR4/MyD88 pathway. Brain Behav. Immun. 2015, 44, 221–234. [Google Scholar] [CrossRef]
- Liu, X.; Jiao, K.; Jia, C.C.; Li, G.X.; Yuan, Q.; Xu, J.K.; Hou, Y.; Wang, B. BAP31 regulates IRAK1-dependent neuroinflammation in microglia. J. Neuroinflamm. 2019, 16, 281. [Google Scholar] [CrossRef]
- Wang, K.; Song, F.; Xu, K.; Liu, Z.; Han, S.; Li, F.; Sun, Y. Irisin Attenuates Neuroinflammation and Prevents the Memory and Cognitive Deterioration in Streptozotocin-Induced Diabetic Mice. Mediat. Inflamm. 2019, 2019, 1567179. [Google Scholar] [CrossRef]
- Zhao, B.; Wang, Z.; Liang, X.; Wang, X.; Lin, K.; Yuan, L.; Jiang, J.; Xu, C.; Zhang, D.; Sun, Y.; et al. Inhibition of the postsynaptic density protein 95 on the protective effect of Ang-(1-7)-Mas on cerebral ischaemia injury. Stroke Vasc. Neurol. 2022, 7, 500–509. [Google Scholar] [CrossRef]
- Xin, R.; Qu, D.; Su, S.; Zhao, B.; Chen, D. Downregulation of miR-23b by transcription factor c-Myc alleviates ischemic brain injury by upregulating Nrf2. Int. J. Biol. Sci. 2021, 17, 3659–3671. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Bai, L.; Zhang, S.; Zhou, X.; Li, Y.; Bai, J. Trx-1 ameliorates learning and memory deficits in MPTP-induced Parkinson’s disease model in mice. Free Radic. Biol. Med. 2018, 124, 380–387. [Google Scholar] [CrossRef] [PubMed]
- Qiu, S.; Palavicini, J.P.; Wang, J.; Gonzalez, N.S.; He, S.; Dustin, E.; Zou, C.; Ding, L.; Bhattacharjee, A.; Van Skike, C.E.; et al. Adult-onset CNS myelin sulfatide deficiency is sufficient to cause Alzheimer’s disease-like neuroinflammation and cognitive impairment. Mol. Neurodegener. 2021, 16, 64. [Google Scholar] [CrossRef] [PubMed]
- Hu, C.; Zhang, X.; Wei, W.; Zhang, N.; Wu, H.; Ma, Z.; Li, L.; Deng, W.; Tang, Q. Matrine attenuates oxidative stress and cardiomyocyte apoptosis in doxorubicin-induced cardiotoxicity via maintaining AMPKalpha/UCP2 pathway. Acta Pharm. Sin. B 2019, 9, 690–701. [Google Scholar] [CrossRef] [PubMed]
- Abdalla, M.Y.; Mathahs, M.M.; Ahmad, I.M. Reduced heme oxygenase-1 expression in steatotic livers infected with hepatitis C virus. Eur. J. Intern. Med. 2012, 23, 649–655. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Zhang, J.; Xu, D.; Peng, Y.; Jin, Y.; Zhang, L. SIRT6specific inhibitor OSS128167 exacerbates diabetic cardiomyopathy by aggravating inflammation and oxidative stress. Mol. Med. Rep. 2021, 23, 367. [Google Scholar] [CrossRef]
- Zhao, Y.; Mu, H.; Huang, Y.; Li, S.; Wang, Y.; Stetler, R.A.; Bennett, M.V.L.; Dixon, C.E.; Chen, J.; Shi, Y. Microglia-specific deletion of histone deacetylase 3 promotes inflammation resolution, white matter integrity, and functional recovery in a mouse model of traumatic brain injury. J. Neuroinflamm. 2022, 19, 201. [Google Scholar] [CrossRef]
- Kumar, M.; Bansal, N. Caffeic acid phenethyl ester rescued streptozotocin-induced memory loss through PI3-kinase dependent pathway. Biomed. Pharmacother. 2018, 101, 162–173. [Google Scholar] [CrossRef]
- Mahmoud, A.M.; Abd El-Twab, S.M. Caffeic acid phenethyl ester protects the brain against hexavalent chromium toxicity by enhancing endogenous antioxidants and modulating the JAK/STAT signaling pathway. Biomed. Pharmacother. 2017, 91, 303–311. [Google Scholar] [CrossRef]
- Saxena, S.; Kruys, V.; Vamecq, J.; Maze, M. The Role of Microglia in Perioperative Neuroinflammation and Neurocognitive Disorders. Front. Aging Neurosci. 2021, 13, 671499. [Google Scholar] [CrossRef]
- Chen, L.; Dong, R.; Lu, Y.; Zhou, Y.; Li, K.; Zhang, Z.; Peng, M. MicroRNA-146a protects against cognitive decline induced by surgical trauma by suppressing hippocampal neuroinflammation in mice. Brain Behav. Immun. 2019, 78, 188–201. [Google Scholar] [CrossRef] [PubMed]
- Thangwong, P.; Jearjaroen, P.; Govitrapong, P.; Tocharus, C.; Tocharus, J. Melatonin improves cognitive function by suppressing endoplasmic reticulum stress and promoting synaptic plasticity during chronic cerebral hypoperfusion in rats. Biochem. Pharmacol. 2022, 198, 114980. [Google Scholar] [CrossRef] [PubMed]
- An, L.N.; Yue, Y.; Guo, W.Z.; Miao, Y.L.; Mi, W.D.; Zhang, H.; Lei, Z.L.; Han, S.J.; Dong, L. Surgical trauma induces iron accumulation and oxidative stress in a rodent model of postoperative cognitive dysfunction. Biol. Trace Elem. Res. 2013, 151, 277–283. [Google Scholar] [CrossRef] [PubMed]
- Zhao, W.X.; Zhang, J.H.; Cao, J.B.; Wang, W.; Wang, D.X.; Zhang, X.Y.; Yu, J.; Zhang, Y.Y.; Zhang, Y.Z.; Mi, W.D. Acetaminophen attenuates lipopolysaccharide-induced cognitive impairment through antioxidant activity. J. Neuroinflamm. 2017, 14, 17. [Google Scholar] [CrossRef]
- Jiang, L.; Dong, R.; Xu, M.; Liu, Y.; Xu, J.; Ma, Z.; Xia, T.; Gu, X. Inhibition of the integrated stress response reverses oxidative stress damage-induced postoperative cognitive dysfunction. Front. Cell Neurosci. 2022, 16, 992869. [Google Scholar] [CrossRef]
- Yang, Y.; Liu, Y.; Zhu, J.; Song, S.; Huang, Y.; Zhang, W.; Sun, Y.; Hao, J.; Yang, X.; Gao, Q.; et al. Neuroinflammation-mediated mitochondrial dysregulation involved in postoperative cognitive dysfunction. Free Radic. Biol. Med. 2022, 178, 134–146. [Google Scholar] [CrossRef]
- Wang, Y.; Machizawa, M.G.; Lisle, T.; Williams, C.L.; Clarke, R.; Anzivino, M.; Kron, I.; Lee, K.S. Suppression of Neuroinflammation Attenuates Persistent Cognitive and Neurogenic Deficits in a Rat Model of Cardiopulmonary Bypass. Front. Cell Neurosci. 2022, 16, 780880. [Google Scholar] [CrossRef]
- Ji, C.; Tang, Y.; Zhang, Y.; Li, C.; Liang, H.; Ding, L.; Xia, X.; Xiong, L.; Qi, X.R.; Zheng, J.C. Microglial glutaminase 1 deficiency mitigates neuroinflammation associated depression. Brain Behav. Immun. 2022, 99, 231–245. [Google Scholar] [CrossRef]
- Wen, L.; Wang, Y.D.; Shen, D.F.; Zheng, P.D.; Tu, M.D.; You, W.D.; Zhu, Y.R.; Wang, H.; Feng, J.F.; Yang, X.F. Exosomes derived from bone marrow mesenchymal stem cells inhibit neuroinflammation after traumatic brain injury. Neural Regen. Res. 2022, 17, 2717–2724. [Google Scholar] [CrossRef]
- Takata, K.; Ginhoux, F.; Shimohama, S. Roles of microglia in Alzheimer’s disease and impact of new findings on microglial heterogeneity as a target for therapeutic intervention. Biochem. Pharmacol. 2021, 192, 114754. [Google Scholar] [CrossRef]
- Qin, C.; Liu, Q.; Hu, Z.W.; Zhou, L.Q.; Shang, K.; Bosco, D.B.; Wu, L.J.; Tian, D.S.; Wang, W. Microglial TLR4-dependent autophagy induces ischemic white matter damage via STAT1/6 pathway. Theranostics 2018, 8, 5434–5451. [Google Scholar] [CrossRef] [PubMed]
- Feng, X.; Valdearcos, M.; Uchida, Y.; Lutrin, D.; Maze, M.; Koliwad, S.K. Microglia mediate postoperative hippocampal inflammation and cognitive decline in mice. JCI Insight 2017, 2, e91229. [Google Scholar] [CrossRef] [PubMed]
- Song, M.Y.; Kim, S.H.; Ryoo, G.H.; Kim, M.K.; Cha, H.N.; Park, S.Y.; Hwang, H.P.; Yu, H.C.; Bae, E.J.; Park, B.H. Adipose sirtuin 6 drives macrophage polarization toward M2 through IL-4 production and maintains systemic insulin sensitivity in mice and humans. Exp. Mol. Med. 2019, 51, 1–10. [Google Scholar] [CrossRef]
- Zhou, Y.; Fan, X.; Jiao, T.; Li, W.; Chen, P.; Jiang, Y.; Sun, J.; Chen, Y.; Chen, P.; Guan, L.; et al. SIRT6 as a key event linking P53 and NRF2 counteracts APAP-induced hepatotoxicity through inhibiting oxidative stress and promoting hepatocyte proliferation. Acta Pharm. Sin. B 2021, 11, 89–99. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.G.; Huang, M.; Xin, Y.; Zhang, Y.; Zhang, X.; Wang, G.; Liu, S.; Wan, J.; Ahmadi, A.R.; Sun, Z.; et al. The epigenetic regulator SIRT6 protects the liver from alcohol-induced tissue injury by reducing oxidative stress in mice. J. Hepatol. 2019, 71, 960–969. [Google Scholar] [CrossRef]
- Cheng, J.; Fan, Y.Q.; Zhang, W.F.; Zhang, G.; Zeng, K.; Ye, Z.; Zhao, D.; Wu, L.Q.; Chen, Z.B. Overexpressing SIRT6 can Attenuate the Injury of Intracerebral Hemorrhage by Down-Regulating NF-kB. Neuromol. Med. 2022. [Google Scholar] [CrossRef]
- Liberale, L.; Gaul, D.S.; Akhmedov, A.; Bonetti, N.R.; Nageswaran, V.; Costantino, S.; Pahla, J.; Weber, J.; Fehr, V.; Vdovenko, D.; et al. Endothelial SIRT6 blunts stroke size and neurological deficit by preserving blood-brain barrier integrity: A translational study. Eur. Heart J. 2020, 41, 1575–1587. [Google Scholar] [CrossRef]
- Stollings, L.M.; Jia, L.J.; Tang, P.; Dou, H.; Lu, B.; Xu, Y. Immune Modulation by Volatile Anesthetics. Anesthesiology 2016, 125, 399–411. [Google Scholar] [CrossRef]
- Yang, T.; Velagapudi, R.; Terrando, N. Neuroinflammation after surgery: From mechanisms to therapeutic targets. Nat. Immunol. 2020, 21, 1319–1326. [Google Scholar] [CrossRef]
- Hao, R.; Song, X.; Li, F.; Tan, X.; Sun-Waterhouse, D.; Li, D. Caffeic acid phenethyl ester reversed cadmium-induced cell death in hippocampus and cortex and subsequent cognitive disorders in mice: Involvements of AMPK/SIRT1 pathway and amyloid-tau-neuroinflammation axis. Food Chem. Toxicol. 2020, 144, 111636. [Google Scholar] [CrossRef]









| Antibody | Species | IF | FCM | Source | Catalogue |
|---|---|---|---|---|---|
| Nrf2 | Rabbit | 1:200 | Proteintech | 16396-1-AP | |
| Sirt6 | Rabbit | 1:300 | Proteintech | 13572-1-AP | |
| Iba-1 | Goat | 1:100 | Abcam | ab5067 | |
| CD86 | Rabbit | 1:100 | Abclonal | A16805 | |
| CD206 | Rabbit | 1:100 | Proteintech | 18704-1-AP | |
| CoraLite594-conjugated Donkey Anti-Rabbit lgG (H + L) | 1:100 | Proteintech | SA00013-8 | ||
| FITC-conjugated Affinipure Donkey Anti-Goat lgG (H + L) | 1:50 | Proteintech | SA00003-3 | ||
| Mouse B7-2/CD86 PE-conjugated Antibody | Rat | 1:20 | R & D Systems | FAB741P | |
| Mouse MMR/CD206 APC-conjugated Antibody | Goat | 1:20 | R & D Systems | FAB2535A | |
| Rat IgG2A PE-conjugated Antibody | Rat | 1:20 | R & D Systems | IC006P | |
| Goat IgG APC-conjugated Antibody | Goat | 1:20 | R & D Systems | IC108A |
| Primer Name | Primer Sequences (5′-3′) | |
|---|---|---|
| Forward | Reverse | |
| Sirt6 | CTCCAGCGTGGTTTTCCACA | GCCCATGCGTTCTAGCTGA |
| Nrf2 | CTGAACTCCTGGACGGGACTA | CGGTGGGTCTCCGTAAATGG |
| CD86 | GGTGGCCTTTTTGACACTCTC | TGAGGTAGAGGTAGGAGGATCTT |
| CD206 | GCTTCCGTCACCCTGTATGC | TCATCCGTGGTTCCATAGACC |
| iNOS | CAAGCACCTTGGAAGAGGAG | AAGGCCAAACACAGCATACC |
| CD32 | GGAATCCTGCCGTTCCTACTG | ATGGCACAAAGTCCGTGAGAA |
| ARG1 | TGTCCCTAATGACAGCTCCTT | GCATCCACCCAAATGACACAT |
| TGFβ1 | CCACCTGCAAGACCATCGAC | CTGGCGAGCCTTAGTTTGGAC |
| TNF-α | CAGGCGGTGCCTATGTCTC | CGATCACCCCGAAGTTCAGTAG |
| IL-4 | GGTCTCAACCCCCAGCTAGT | GCCGATGATCTCTCTCAAGTGAT |
| IL-1β | TTCAGGCAGGCAGTATCACTC | GAAGGTCCACGGGAAAGACAC |
| IL-10 | AGCCTTATCGGAAATGATCCAGT | GGCCTTGTAGACACCTTGGT |
| GAPDH | AGTGCCAGCCTCGTCCCGTAGACAA | CAGGCGCCCAATACGGCCAAAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Cai, Z.; Zhan, G.; Li, X.; Li, S.; Wang, X.; Li, S.; Luo, A. Caffeic Acid Phenethyl Ester Suppresses Oxidative Stress and Regulates M1/M2 Microglia Polarization via Sirt6/Nrf2 Pathway to Mitigate Cognitive Impairment in Aged Mice following Anesthesia and Surgery. Antioxidants 2023, 12, 714. https://doi.org/10.3390/antiox12030714
Wang Y, Cai Z, Zhan G, Li X, Li S, Wang X, Li S, Luo A. Caffeic Acid Phenethyl Ester Suppresses Oxidative Stress and Regulates M1/M2 Microglia Polarization via Sirt6/Nrf2 Pathway to Mitigate Cognitive Impairment in Aged Mice following Anesthesia and Surgery. Antioxidants. 2023; 12(3):714. https://doi.org/10.3390/antiox12030714
Chicago/Turabian StyleWang, Yue, Ziwen Cai, Gaofeng Zhan, Xing Li, Shan Li, Xuan Wang, Shiyong Li, and Ailin Luo. 2023. "Caffeic Acid Phenethyl Ester Suppresses Oxidative Stress and Regulates M1/M2 Microglia Polarization via Sirt6/Nrf2 Pathway to Mitigate Cognitive Impairment in Aged Mice following Anesthesia and Surgery" Antioxidants 12, no. 3: 714. https://doi.org/10.3390/antiox12030714
APA StyleWang, Y., Cai, Z., Zhan, G., Li, X., Li, S., Wang, X., Li, S., & Luo, A. (2023). Caffeic Acid Phenethyl Ester Suppresses Oxidative Stress and Regulates M1/M2 Microglia Polarization via Sirt6/Nrf2 Pathway to Mitigate Cognitive Impairment in Aged Mice following Anesthesia and Surgery. Antioxidants, 12(3), 714. https://doi.org/10.3390/antiox12030714

