The Potential Effects of Quercetin-Loaded Nanoliposomes on Amoxicillin/Clavulanate-Induced Hepatic Damage: Targeting the SIRT1/Nrf2/NF-κB Signaling Pathway and Microbiota Modulation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Animals
2.3. Preparation of a Nanoliposomal Formulation for Quercetin
2.4. Experimental Design
2.5. Sampling
2.6. Biochemical Analysis
2.7. Determination of the Antioxidant Status
2.8. mRNA Quantification Using Real-Time RT-PCR
2.9. Real-Time Quantitative of Bacterial Population Abundance in Cecal Contents
2.10. Histological Examination of the Rat Liver
2.11. Immunohistochemical Staining
2.12. Molecular Docking Analysis
2.13. Statistical Analysis
3. Results
3.1. Characterization of the Liposomal Formulation of Quercetin
3.2. QR-Lipo Ameliorates Co-Amox-Induced Liver Damage in Rats
3.3. QR-Lipo Ameliorates Oxidative Damage in Liver Tissue Induced by Co-Amox
3.4. QR-Lipo Reduces Keap1 and Ameliorates Gpx mRNA Expression Levels in Co-Amox-Treated Rats
3.5. QR-Lipo Ameliorates Inflammatory Gene Expressions in Liver Tissue in Co-Amox-Treated Rats
3.6. Microbial Populations of Cecal Contents
3.7. Morphological Changes of the Liver Tissues
3.8. Effects of QR-Lipo Treatment on SIRT1 and Nrf2 Protein Expression in Liver Tissues from Co-Amox-Administrated Rats
3.9. Molecular Docking Analysis
3.10. Principal Component Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Villanueva-Paz, M.L.; Morán, N.; López-Alcántara, C.; Freixo, R.J.; Andrade, M.I.; Lucena, F.J. Cubero, Oxidative stress in drug-induced liver injury (Dili): From mechanisms to biomarkers for use in clinical practice. Antioxidants 2021, 10, 390. [Google Scholar] [CrossRef]
- Nakamura, K.; Kageyama, S.; Ito, T.; Hirao, H.; Kadono, K.; Aziz, A.; Dery, K.J.; Everly, M.J.; Taura, K.; Uemoto, S.; et al. Antibiotic pretreatment alleviates liver transplant damage in mice and humans. J. Clin. Investig. 2019, 129, 3420–3434. [Google Scholar] [CrossRef] [Green Version]
- Chalasani, N.; Bonkovsky, H.L.; Fontana, R.; Lee, W.; Stolz, A.; Talwalkar, J.; Reddy, K.R.; Watkins, P.B.; Navarro, V.; Barnhart, H.; et al. Features and outcomes of 899 patients with drug-induced liver injury: The DILIN prospective study. Gastroenterology 2015, 148, 1340–1352. [Google Scholar] [CrossRef] [Green Version]
- Jamshidi, H.R.; Negintaji, S. Effects of Thymol on Co-amoxiclav-Induced Hepatotoxicity in Rats. Int. J. Med. Lab. 2021, 8, 44–54. [Google Scholar] [CrossRef]
- van Eyk, A.D. Treatment of bacterial respiratory infections. S. Afr. Fam. Pract. 2019, 61, 8–15. [Google Scholar] [CrossRef]
- Shi, J.R.; Liu, J.R.; Li, H.M.; Wang, W.; Zhao, S.Y. Clinical features and therapy of persistent bacterial bronchitis in 31 children. Chin. J. Pediatr. 2016, 54, 527–530. [Google Scholar] [CrossRef]
- Petrov, P.D.; Soluyanova, P.; Sánchez-Campos, S.; Castell, J.V.; Jover, R. Molecular mechanisms of hepatotoxic cholestasis by clavulanic acid: Role of NRF2 and FXR pathways. Food Chem. Toxicol. 2021, 158, 112664. [Google Scholar] [CrossRef]
- El-Kholy, W.M.; Hemieda, F.A.E.; Elabani, G.M. Role of Cinnamon Extract in the Protection against Amoxicillin/Clavulanate-Induced Liver Damage in Rats. IOSR J. Pharm. Biol. Sci. 2019, 14, 14–21. [Google Scholar]
- Liu, X.; Zhao, H.; Luo, C.; Du, D.; Huang, J.; Ming, Q.; Jin, F.; Wang, D.; Huang, W. Acetaminophen Responsive miR-19b Modulates SIRT1/Nrf2 Signaling Pathway in Drug-Induced Hepatotoxicity. Toxicol. Sci. 2019, 170, 476–488. [Google Scholar] [CrossRef] [PubMed]
- Yan, T.; Huang, J.; Nisar, M.F.; Wan, C.; Huang, W. The beneficial roles of SIRT1 in drug-induced liver injury. Oxid. Med. Cell. Longev. 2019, 2019, 8506195. [Google Scholar] [CrossRef]
- Yu, H.; Lin, L.; Zhang, Z.; Zhang, H.; Hu, H. Targeting NF-κB pathway for the therapy of diseases: Mechanism and clinical study. Signal Transduct. Target. Ther. 2020, 5, 209. [Google Scholar] [CrossRef] [PubMed]
- Abou-Zeid, S.M.; Ahmed, A.I.; Awad, A.; Mohammed, W.A.; Metwally, M.M.M.; Almeer, R.; Abdel-Daim, M.M.; Khalil, S.R. Moringa oleifera ethanolic extract attenuates tilmicosin-induced renal damage in male rats via suppression of oxidative stress, inflammatory injury, and intermediate filament proteins mRNA expression. Biomed. Pharmacother. 2021, 133, 110997. [Google Scholar] [CrossRef] [PubMed]
- El Bohi, K.M.; Abdel-Motal, S.M.; Khalil, S.R.; Abd-Elaal, M.M.; Metwally, M.M.M.; Elhady, W.M. The efficiency of pomegranate (Punica granatum) peel ethanolic extract in attenuating the vancomycin-triggered liver and kidney tissues injury in rats. Environ. Sci. Pollut. Res. 2021, 28, 7134–7150. [Google Scholar] [CrossRef]
- Llorente, C.; Schnabl, B. The Gut Microbiota and Liver Disease. Cell. Mol. Gastroenterol. Hepatol. 2015, 1, 275–284. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, T.; Li, R.; Chen, P. Gut Microbiota and Chemical-Induced Acute Liver Injury. Front. Physiol. 2021, 12, 688780. [Google Scholar] [CrossRef] [PubMed]
- Henao-Mejia, J.; Elinav, E.; Jin, C.; Hao, L.; Mehal, W.Z.; Strowig, T.; Thaiss, C.A.; Kau, A.L.; Eisenbarth, S.C.; Jurczak, M.J.; et al. Inflammasome-mediated dysbiosis regulates progression of NAFLD and obesity. Nature 2012, 482, 179–185. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qin, N.; Yang, F.; Li, A.; Prifti, E.; Chen, Y.; Shao, L.; Guo, J.; Le Chatelier, E.; Yao, J.; Wu, L.; et al. Alterations of the human gut microbiome in liver cirrhosis. Nature 2014, 513, 59–64. [Google Scholar] [CrossRef] [PubMed]
- Aljazzar, A.; El-Hamid, M.I.A.; El-Malt, R.M.S.; El-Gharreb, W.R.; Abdel-Raheem, S.M.; Ibrahim, A.M.; Abdelaziz, A.M.; Ibrahim, D. Prevalence and Antimicrobial Susceptibility of Campylobacter Species with Particular Focus on the Growth Promoting, Immunostimulant and Anti-Campylobacter jejuni Activities of Eugenol and Trans-Cinnamaldehyde Mixture in Broiler Chickens. Animals 2022, 12, 905. [Google Scholar] [CrossRef]
- Xu, T.; Hu, S.; Liu, Y.; Sun, K.; Luo, L.; Zeng, L. Hawk Tea Flavonoids as Natural Hepatoprotective Agents Alleviate Acute Liver Damage by Reshaping the Intestinal Microbiota and Modulating the Nrf2 and NF-κB Signaling Pathways. Nutrients 2022, 14, 3662. [Google Scholar] [CrossRef]
- Ismail, H.; Ibrahim, D.; El Sayed, S.; Wahdan, A.; El-Tarabili, R.M.; El-Ghareeb, W.R.; Alhawas, B.A.; Alahmad, B.A.-H.Y.; Abdel-Raheem, S.M.; El-Hamid, M.I.A. Prospective Application of Nanoencapsulated Bacillus amyloliquefaciens on Broiler Chickens’ Performance and Gut Health with Efficacy against Campylobacter jejuni Colonization. Animals 2023, 13, 775. [Google Scholar] [CrossRef]
- Lin, R.; Piao, M.; Song, Y. Dietary Quercetin Increases Colonic Microbial Diversity and Attenuates Colitis Severity in Citrobacter rodentium-Infected Mice. Front. Microbiol. 2019, 10, 1092. [Google Scholar] [CrossRef] [Green Version]
- Shi, T.; Bian, X.; Yao, Z.; Wang, Y.; Gao, W.; Guo, C. Quercetin improves gut dysbiosis in antibiotic-treated mice. Food Funct. 2020, 11, 8003–8013. [Google Scholar] [CrossRef]
- Wang, T.T.; Liu, L.; Deng, J.; Jiang, Y.; Yan, X.; Liu, W. Analysis of the mechanism of action of quercetin in the treatment of hyperlipidemia based on metabolomics and intestinal flora. Food Funct. 2023, 14, 2112–2127. [Google Scholar] [CrossRef] [PubMed]
- Karimi, A.; Naeini, F.; Azar, V.A.; Hasanzadeh, M.; Ostadrahimi, A.; Niazkar, H.R.; Mobasseri, M.; Tutunchi, H. A comprehensive systematic review of the therapeutic effects and mechanisms of action of quercetin in sepsis. Phytomedicine 2021, 86, 153567. [Google Scholar] [CrossRef] [PubMed]
- Moujahed, S.; Ruiz, A.; Hallegue, D.; Sakly, M. Quercetin alleviates styrene oxide-induced cytotoxicity in cortical neurons in vitro via modulation of oxidative stress and apoptosis. Drug Chem. Toxicol. 2022, 45, 1634–1643. [Google Scholar] [CrossRef]
- Wang, G.; Li, Y.; Lei, C.; Lei, X.; Zhu, X.; Yang, L.; Zhang, R. Quercetin exerts antidepressant and cardioprotective effects in estrogen receptor α-deficient female mice via BDNF-AKT/ERK1/2 signaling. J. Steroid Biochem. Mol. Biol. 2021, 206, 105795. [Google Scholar] [CrossRef] [PubMed]
- Soliman, M.M.; Gaber, A.; Alsanie, W.F.; Mohamed, W.A.; Metwally, M.M.M.; Abdelhadi, A.A.; Elbadawy, M.; Shukry, M. Gibberellic acid-induced hepatorenal dysfunction and oxidative stress: Mitigation by quercetin through modulation of antioxidant, anti-inflammatory, and antiapoptotic activities. J. Food Biochem. 2022, 46, e14069. [Google Scholar] [CrossRef]
- Pingili, R.B.; Challa, S.R.; Pawar, A.K.; Toleti, V.; Kodali, T.; Koppula, S. A systematic review on hepatoprotective activity of quercetin against various drugs and toxic agents: Evidence from preclinical studies. Phytotherapy Res. 2020, 34, 5–32. [Google Scholar] [CrossRef]
- Palle, S.; Neerati, P. Quercetin nanoparticles attenuates scopolamine induced spatial memory deficits and pathological damages in rats. Bull. Fac. Pharmacy, Cairo Univ. 2017, 55, 101–106. [Google Scholar] [CrossRef] [Green Version]
- Mostafa, M.; Alaaeldin, E.; Aly, U.F.; Sarhan, H.A. Optimization and Characterization of Thymoquinone-Loaded Liposomes with Enhanced Topical Anti-inflammatory Activity. AAPS PharmSciTech 2018, 19, 3490–3500. [Google Scholar] [CrossRef]
- Khater, S.I.; Almanaa, T.N.; Fattah, D.M.A.; Khamis, T.; Seif, M.M.; Dahran, N.; Alqahtani, L.S.; Metwally, M.M.M.; Mostafa, M.; Albedair, R.A.; et al. Liposome-Encapsulated Berberine Alleviates Liver Injury in Type 2 Diabetes via Promoting AMPK/mTOR-Mediated Autophagy and Reducing ER Stress: Morphometric and Immunohistochemical Scoring. Antioxidants 2023, 12, 1220. [Google Scholar] [CrossRef] [PubMed]
- Che, J.; Najer, A. Europe PMC Funders Group Neutrophils Enable Local and Non-Invasive Liposome Delivery to Inflamed Skeletal Muscle and Ischemic Heart. Adv. Mater. 2022, 32, 2003598. [Google Scholar] [CrossRef]
- Shen, P.; Lin, W.; Ba, X.; Huang, Y.; Chen, Z.; Han, L.; Qin, K.; Huang, Y.; Tu, S. Quercetin-mediated SIRT1 activation attenuates collagen-induced mice arthritis. J. Ethnopharmacol. 2021, 279, 114213. [Google Scholar] [CrossRef]
- Cao, D.; Wang, M.; Qiu, X.; Liu, D.; Jiang, H.; Yang, N.; Xu, R.-M. Structural basis for allosteric, substrate-dependent stimulation of SIRT1 activity by resveratrol. Genes Dev. 2015, 29, 1316–1325. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Iside, C.; Scafuro, M.; Nebbioso, A.; Altucci, L. SIRT1 Activation by Natural Phytochemicals: An Overview. Front. Pharmacol. 2020, 11, 1225. [Google Scholar] [CrossRef] [PubMed]
- Toniazzo, T.; Peres, M.S.; Ramos, A.P.; Pinho, S.C. Encapsulation of quercetin in liposomes by ethanol injection and physicochemical characterization of dispersions and lyophilized vesicles. Food Biosci. 2017, 19, 17–25. [Google Scholar] [CrossRef]
- Alaaeldin, E.; Mostafa, M.; Mansour, H.F.; Soliman, G.M. Spanlastics as an efficient delivery system for the enhancement of thymoquinone anticancer efficacy: Fabrication and cytotoxic studies against breast cancer cell lines. J. Drug Deliv. Sci. Technol. 2021, 65, 102725. [Google Scholar] [CrossRef]
- Odeh, F.; Ismail, S.I.; Abu-Dahab, R.; Mahmoud, I.S.; Al Bawab, A. Thymoquinone in liposomes: A study of loading efficiency and biological activity towards breast cancer. Drug Deliv. 2012, 19, 371–377. [Google Scholar] [CrossRef]
- Huang, J.; Wang, Q.; Chu, L.; Xia, Q. Liposome-chitosan hydrogel bead delivery system for the encapsulation of linseed oil and quercetin: Preparation and in vitro characterization studies. LWT 2020, 117, 108615. [Google Scholar] [CrossRef]
- Aebi, H. Catalase in vitro. In Methods in Enzymology; Academic Press: Cambridge, MA, USA, 1984; pp. 121–126. [Google Scholar] [CrossRef]
- Ohkawa, H.; Ohishi, N.; Yagi, K. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem. 1979, 95, 351–358. [Google Scholar] [CrossRef]
- Tietze, F. Enzymic method for quantitative determination of nanogram amounts of total and oxidized glutathione: Applications to mammalian blood and other tissues. Anal. Biochem. 1969, 27, 502–522. [Google Scholar] [CrossRef]
- Yuan, J.S.; Reed, A.; Chen, F.; Stewart, C.N., Jr. Statistical analysis of real-time PCR data. BMC Bioinform. 2006, 7, 85. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhong, Q.; Mishra, M.; Kowluru, R.A. Transcription Factor Nrf2-Mediated Antioxidant Defense System in the Development of Diabetic Retinopathy. Investig. Opthalmology Vis. Sci. 2013, 54, 3941–3948. [Google Scholar] [CrossRef] [PubMed]
- Al-Rejaie, S.S.; Aleisa, A.M.; Sayed-Ahmed, M.M.; Al-Shabanah, O.A.; Abuohashish, H.M.; Ahmed, M.M.; Al-Hosaini, K.A.; Hafez, M.M. Protective effect of rutin on the antioxidant genes expression in hypercholestrolemic male Westar rat. BMC Complement. Altern. Med. 2013, 13, 136. [Google Scholar] [CrossRef] [Green Version]
- Peinnequin, A.; Mouret, C.; Birot, O.; Alonso, A.; Mathieu, J.; Clarençon, D.; Agay, D.; Chancerelle, Y.; Multon, E. Rat pro-inflammatory cytokine and cytokine related mRNA quantification by real-time polymerase chain reaction using SYBR green. BMC Immunol. 2004, 5, 3. [Google Scholar] [CrossRef] [Green Version]
- O’Bryan, M.K.; Gerdprasert, O.; Nikolic-Paterson, D.J.; Meinhardt, A.; Muir, J.A.; Foulds, L.M.; Phillips, D.J.; de Kretser, D.M.; Hedger, M.P. Cytokine profiles in the testes of rats treated with lipopolysaccharide reveal localized suppression of inflammatory responses. Am. J. Physiol. Integr. Comp. Physiol. 2005, 288, R1744–R1755. [Google Scholar] [CrossRef]
- Habibi, F.; Soufi, F.G.; Ghiasi, R.; Khamaneh, A.M.; Alipour, M.R. Alteration in Inflammation-related miR-146a Expression in NF-KB Signaling Pathway in Diabetic Rat Hippocampus. Adv. Pharm. Bull. 2016, 6, 99–103. [Google Scholar] [CrossRef] [PubMed]
- Sobajima, S.; Shimer, A.L.; Chadderdon, R.C.; Kompel, J.F.; Kim, J.S.; Gilbertson, L.G.; Kang, J.D. Quantitative analysis of gene expression in a rabbit model of intervertebral disc degeneration by real-time polymerase chain reaction. Spine J. 2005, 5, 14–23. [Google Scholar] [CrossRef]
- Bartosch, S.; Fite, A.; Macfarlane, G.T.; McMurdo, M.E.T. Characterization of Bacterial Communities in Feces from Healthy Elderly Volunteers and Hospitalized Elderly Patients by Using Real-Time PCR and Effects of Antibiotic Treatment on the Fecal Microbiota. Appl. Environ. Microbiol. 2004, 70, 3575–3581. [Google Scholar] [CrossRef] [Green Version]
- Layton, A.; McKay, L.; Williams, D.; Garrett, V.; Gentry, R.; Sayler, G. Development of Bacteroides 16S rRNA Gene TaqMan-Based Real-Time PCR Assays for Estimation of Total, Human, and Bovine Fecal Pollution in Water. Appl. Environ. Microbiol. 2006, 72, 4214–4224. [Google Scholar] [CrossRef] [Green Version]
- Requena, T.; Burton, J.; Matsuki, T.; Munro, K.; Simon, M.A.; Tanaka, R.; Watanabe, K.; Tannock, G.W. Identification, Detection, and Enumeration of Human Bifidobacterium Species by PCR Targeting the Transaldolase Gene. Appl. Environ. Microbiol. 2002, 68, 2420–2427. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rinttila, T.; Kassinen, A.; Malinen, E.; Krogius, L.; Palva, A. Development of an extensive set of 16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in faecal samples by real-time PCR. J. Appl. Microbiol. 2004, 97, 1166–1177. [Google Scholar] [CrossRef] [PubMed]
- Mirhosseini, S.Z.; Seidavi, A.; Shivazad, M.; Chamani, M.; Sadeghi, A.A.; Pourseify, R. Detection of Clostridium sp. and its Relation to Different Ages and Gastrointestinal Segments as Measured by Molecular Analysis of 16S rRNA Genes. Braz. Arch. Biol. Technol. 2010, 53, 69–76. [Google Scholar] [CrossRef] [Green Version]
- Patel, T.P.; Soni, S.; Parikh, P.; Gosai, J.; Chruvattil, R.; Gupta, S. Swertiamarin: An Active Lead from Enicostemma littorale Regulates Hepatic and Adipose Tissue Gene Expression by Targeting PPAR-γand Improves Insulin Sensitivity in Experimental NIDDM Rat Model. Evidence-Based Complement. Altern. Med. 2013, 2013, 358673. [Google Scholar] [CrossRef] [Green Version]
- Suvarna, K.S.; Layton, C.; Bancroft, J.D. Bancroft’s Theory and Practice of Histological Techniques, 8th ed.; E. Book Elsevier Health Sciences: Amsterdam, The Netherlands, 2008. [Google Scholar]
- Gibson-Corley, K.N.; Olivier, A.K.; Meyerholz, D.K. Principles for Valid Histopathologic Scoring in Research. Vet. Pathol. 2013, 50, 1007–1015. [Google Scholar] [CrossRef] [Green Version]
- Elsayed, H.E.; Ebrahim, H.Y.; Mady, M.S.; Khattab, M.A.; El-Sayed, E.K.; Moharram, F.A. Ethnopharmacological impact of Melaleuca rugulosa (Link) Craven leaves extract on liver inflammation. J. Ethnopharmacol. 2022, 292, 115215. [Google Scholar] [CrossRef]
- El Sayed, A.M.; El Hawary, S.; Elimam, H.; Saleh, A.M.; Zokalih, A.H.; Mohyeldin, M.M.; Bassam, S.M. ESI-LC-MS/MS based comparative multivariate metabolomic and biological profiling with dynamic molecular docking of Gmelina arborea Roxb different organs. Fitoterapia 2023, 168, 105540. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Deng, Y.; Hu, S.; Hu, X.; Ma, J.; Hu, J.; Hu, B.; He, H.; Li, L.; Liu, H.; et al. Comparative analysis of amino acid content and protein synthesis-related genes expression levels in breast muscle among different duck breeds/strains. Poult. Sci. 2023, 102, 102277. [Google Scholar] [CrossRef] [PubMed]
- Appiah, J.; Prasad, A.; Shah, V.; Patel, V.; Fareen, N.; Marin, A.C.; Cheriyath, P. Amoxicillin-Clavulanate Induced Liver Injury in a Young Female. Cureus 2023, 15, e33445. [Google Scholar] [CrossRef]
- Byrne, N.J.; Rajasekaran, N.S.; Abel, E.D.; Bugger, H. Therapeutic potential of targeting oxidative stress in diabetic cardiomyopathy. Free. Radic. Biol. Med. 2021, 169, 317–342. [Google Scholar] [CrossRef]
- Akbarian, A.; Michiels, J.; DeGroote, J.; Majdeddin, M.; Golian, A.; De Smet, S. Association between heat stress and oxidative stress in poultry; mitochondrial dysfunction and dietary interventions with phytochemicals. J. Anim. Sci. Biotechnol. 2016, 7, 37. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yaman, S.O.; Ayhanci, A. Lipid Peroxidation; IntechOpen: London, UK, 2021; pp. 1–11. [Google Scholar] [CrossRef]
- Delemos, A.S.; Ghabril, M.; Rockey, D.C.; Gu, J.; Barnhart, H.X.; Fontana, R.J.; Kleiner, D.E.; Bonkovsky, H.L. Amoxicillin–Clavulanate-Induced Liver Injury. Dig. Dis. Sci. 2016, 61, 2406–2416. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, D.; Shi, W.; Lu, X.; Liu, Z.; Zhang, S.; Sun, Y.; Zhu, X. A Protective Role of Okadaic Acid in Liver Injury Induced by Amoxicillin. Bull. Exp. Biol. Med. 2022, 172, 328–331. [Google Scholar] [CrossRef] [PubMed]
- Yang, D.; Tan, X.; Lv, Z.; Liu, B.; Baiyun, R.; Lu, J.; Zhang, Z. Regulation of Sirt1/Nrf2/TNF-α signaling pathway by luteolin is critical to attenuate acute mercuric chloride exposure induced hepatotoxicity. Sci. Rep. 2016, 6, 37157. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, X.; Wang, P.; Yao, L.-P.; Wang, W.; Gao, Y.-M.; Zhang, J.; Fu, Y.-J. Paeonol alleviated acute alcohol-induced liver injury via SIRT1/Nrf2/NF-κB signaling pathway. Environ. Toxicol. Pharmacol. 2018, 60, 110–117. [Google Scholar] [CrossRef]
- Zhang, Y.; Liang, J.; Cao, N.; Gao, J.; Song, L.; Tang, X. Coal dust nanoparticles induced pulmonary fibrosis by promoting inflammation and epithelial-mesenchymal transition via the NF-κB/NLRP3 pathway driven by IGF1/ROS-mediated AKT/GSK3β signals. Cell Death Discov. 2022, 8, 500. [Google Scholar] [CrossRef]
- Yu, Z.; Guo, F.; Zhang, Z.; Luo, X.; Tian, J.; Li, H. Protective Effects of Glycyrrhizin on LPS and Amoxicillin/Potassium Clavulanate-Induced Liver Injury in Chicken. Pak. Vet. J. 2017, 37, 13–18. [Google Scholar]
- Afifi, N.A.; Ibrahim, M.A.; Galal, M.K. Hepatoprotective influence of quercetin and ellagic acid on thioacetamide-induced hepatotoxicity in rats. Can. J. Physiol. Pharmacol. 2018, 96, 624–629. [Google Scholar] [CrossRef]
- Liu, L.; Liu, Y.; Cheng, X.; Qiao, X. The Alleviative Effects of Quercetin on Cadmium-Induced Necroptosis via Inhibition ROS/iNOS/NF-κB Pathway in the Chicken Brain. Biol. Trace Element Res. 2021, 199, 1584–1594. [Google Scholar] [CrossRef]
- Zheng, Y.; Haworth, I.S.; Zuo, Z.; Chow, M.S.; Chow, A.H. Physicochemical and Structural Characterization of Quercetin-β-Cyclodextrin Complexes. J. Pharm. Sci. 2005, 94, 1079–1089. [Google Scholar] [CrossRef]
- Tang, L.; Li, K.; Zhang, Y.; Li, H.; Li, A.; Xu, Y.; Wei, B. Quercetin liposomes ameliorate streptozotocin-induced diabetic nephropathy in diabetic rats. Sci. Rep. 2020, 10, 2440. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, H.; Yang, T.; Heng, C.; Zhou, Y.; Jiang, Z.; Qian, X.; Du, L.; Mao, S.; Yin, X.; Lu, Q. Quercetin improves nonalcoholic fatty liver by ameliorating inflammation, oxidative stress, and lipid metabolism in db/db mice. Phytother. Res. 2019, 33, 3140–3152. [Google Scholar] [CrossRef] [PubMed]
- Alqahtani, S.M.; Dawood, A.F.; Kamar, S.S.; Haidara, M.A.; ShamsEldeen, A.M.; Dallak, M.; Al-Ani, B.; Ebrahim, H.A. Quercetin and Resveratrol are Associated with the Downregulation of TNF-α/NF-kB/iNOS Axis-Mediated Acute Liver Injury in Rats Induced by Paracetamol Poisoning. Int. J. Morphol. 2023, 41, 79–84. [Google Scholar] [CrossRef]
- Ehteshamfar, S.; Akhbari, M.; Afshari, J.T.; Seyedi, M.; Nikfar, B.; Shapouri-Moghaddam, A.; Ghanbarzadeh, E.; Momtazi-Borojeni, A.A. Anti-inflammatory and immune-modulatory impacts of berberine on activation of autoreactive T cells in autoimmune inflammation. J. Cell. Mol. Med. 2020, 24, 13573–13588. [Google Scholar] [CrossRef] [PubMed]
- Hussein, R.M.; Sawy, D.M.; Kandeil, M.A.; Farghaly, H.S. Chlorogenic acid, quercetin, coenzyme Q10 and silymarin modulate Keap1-Nrf2/heme oxygenase-1 signaling in thioacetamide-induced acute liver toxicity. Life Sci. 2021, 277, 119460. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, O.M.; Elkomy, M.H.; Fahim, H.I.; Ashour, M.B.; Naguib, I.A.; Alghamdi, B.S.; Mahmoud, H.U.R.; Ahmed, N.A. Rutin and Quercetin Counter Doxorubicin-Induced Liver Toxicity in Wistar Rats via Their Modulatory Effects on Inflammation, Oxidative Stress, Apoptosis, and Nrf2. Oxidative Med. Cell. Longev. 2022, 2022, 2710607. [Google Scholar] [CrossRef]
- Liu, P.; Li, J.; Liu, M.; Zhang, M.; Xue, Y.; Zhang, Y.; Han, X.; Jing, X.; Chu, L. Hesperetin modulates the Sirt1/Nrf2 signaling pathway in counteracting myocardial ischemia through suppression of oxidative stress, inflammation, and apoptosis. Biomed. Pharmacother. 2021, 139, 111552. [Google Scholar] [CrossRef]
- Arioz, B.I.; Taştan, B.; Tarakcioglu, E.; Tufekci, K.U.; Olcum, M.; Ersoy, N.; Bagriyanik, A.; Genc, K.; Genc, S. Melatonin Attenuates LPS-Induced Acute Depressive-Like Behaviors and Microglial NLRP3 Inflammasome Activation Through the SIRT1/Nrf2 Pathway. Front. Immunol. 2019, 10, 1511. [Google Scholar] [CrossRef]
- Atici, B.; Uyumlu, A.B.; Taslidere, A. The role of Nrf2/SIRT1 pathway in the hepatoprotective effect of PEITC against HFD/STZ-induced diabetic liver disease. Ann. Med. Res. 2022, 12, 1348–1353. [Google Scholar]
- Liu, C.-M.; Ma, J.-Q.; Xie, W.-R.; Liu, S.-S.; Feng, Z.-J.; Zheng, G.-H.; Wang, A.-M. Quercetin protects mouse liver against nickel-induced DNA methylation and inflammation associated with the Nrf2/HO-1 and p38/STAT1/NF-κB pathway. Food Chem. Toxicol. 2015, 82, 19–26. [Google Scholar] [CrossRef]
- Zhao, P.; Hu, Z.; Ma, W.; Zang, L.; Tian, Z.; Hou, Q. Quercetin alleviates hyperthyroidism-induced liver damage via Nrf2 Signaling pathway. Biofactors 2020, 46, 608–619. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Qu, X.; Gao, H.; Zhai, J.; Tao, L.; Sun, J.; Song, Y.; Zhang, J. Quercetin attenuates NLRP3 inflammasome activation and apoptosis to protect INH-induced liver injury via regulating SIRT1 pathway. Int. Immunopharmacol. 2020, 85, 106634. [Google Scholar] [CrossRef]
- Ciccone, L.; Piragine, E.; Brogi, S.; Camodeca, C.; Fucci, R.; Calderone, V.; Nencetti, S.; Martelli, A.; Orlandini, E. Resveratrol-like Compounds as SIRT1 Activators. Int. J. Mol. Sci. 2022, 23, 15105. [Google Scholar] [CrossRef] [PubMed]
- Mi, W.; Hu, Z.; Xu, L.; Bian, X.; Lian, W.; Yin, S.; Zhao, S.; Gao, W.; Guo, C.; Shi, T. Quercetin positively affects gene expression profiles and metabolic pathway of antibiotic-treated mouse gut microbiota. Front. Microbiol. 2022, 13, 983358. [Google Scholar] [CrossRef]
- Yassour, M.; Lim, M.Y.; Yun, H.S.; Tickle, T.L.; Sung, J.; Song, Y.-M.; Lee, K.; Franzosa, E.A.; Morgan, X.C.; Gevers, D.; et al. Sub-clinical detection of gut microbial biomarkers of obesity and type 2 diabetes. Genome Med. 2016, 8, 17. [Google Scholar] [CrossRef] [Green Version]
- Porras, D.; Nistal, E.; Martínez-Flórez, S.; Pisonero-Vaquero, S.; Olcoz, J.L.; Jover, R.; González-Gallego, J.; García-Mediavilla, M.V.; Sánchez-Campos, S. Protective effect of quercetin on high-fat diet-induced non-alcoholic fatty liver disease in mice is mediated by modulating intestinal microbiota imbalance and related gut-liver axis activation. Free. Radic. Biol. Med. 2017, 102, 188–202. [Google Scholar] [CrossRef]
- Xie, J.; Song, W.; Liang, X.; Zhang, Q.; Shi, Y.; Liu, W.; Shi, X. Protective effect of quercetin on streptozotocin-induced diabetic peripheral neuropathy rats through modulating gut microbiota and reactive oxygen species level. Biomed. Pharmacother. 2020, 127, 110147. [Google Scholar] [CrossRef]
- Li, X.; Wang, E.; Yin, B.; Fang, D.; Chen, P.; Wang, G.; Zhao, J.; Zhang, H.; Chen, W. Effects of Lactobacillus casei CCFM419 on insulin resistance and gut microbiota in type 2 diabetic mice. Benef. Microbes 2017, 8, 421–432. [Google Scholar] [CrossRef]
- Gryaznova, M.; Dvoretskaya, Y.; Burakova, I.; Syromyatnikov, M.; Popov, E.; Kokina, A.; Mikhaylov, E.; Popov, V. Dynamics of Changes in the Gut Microbiota of Healthy Mice Fed with Lactic Acid Bacteria and Bifidobacteria. Microorganisms 2022, 10, 1020. [Google Scholar] [CrossRef] [PubMed]
- Schulthess, J.; Pandey, S.; Capitani, M.; Rue-Albrecht, K.C.; Arnold, I.; Franchini, F.; Chomka, A.; Ilott, N.E.; Johnston, D.G.W.; Pires, E.; et al. The Short Chain Fatty Acid Butyrate Imprints an Antimicrobial Program in Macrophages. Immunity 2019, 50, 432–445.e437. [Google Scholar] [CrossRef] [Green Version]
Genes | Primer | Sequence (5′-3′) | Accession Number/References |
---|---|---|---|
Keap1 | Forward | TGGGCGTGGCAGTGCTCAAC | NM_057152/[44] |
Reverse | GCCCATCGTAGCCTCCTGCG | ||
Gpx | Forward | GGTGTTCCAGTGCGCAGAT | X12367.1/[45] |
Reverse | AGGGCTTCTATATCGGGTTCGA | ||
IL-6 | Forward | TCCTACCCCAACTTCCAATGCTC | NM_012589.2/[46] |
Reverse | TTGGATGGTCTTGGTCCTTAGCC | ||
IL-1β | Forward | CACCTCTCAAGCAGAGCACAG | NM_031512.2/[46] |
Reverse | GGGTTCCATGGTGAAGTCAAC | ||
TNF-α | Forward | AAATGGGCTCCCTCTCATCAGTTC | L19123.1/[46] |
Reverse | TCTGCTTGGTGGTTTGCTACGAC | ||
IL-10 | Forward | GCAGGACTTTAAGGGTTACTTGG | L02926.1/[47] |
Reverse | GGGGAGAAATCGATGACAGC | ||
NF-κB | Forward | AATTGCCCCGGCAT | XM_342346.4/[48] |
Reverse | TCCCGTAACCGCGTA | ||
iNOS | Forward | CACCACCCTCCTTGTTCAAC | NM_012611/[49] |
Reverse | CAATCCACAACTCGCTCCAA | ||
Enterobacteriaceae | Forward | CATTGACGTTACCCGCAGAAGAAGC | CU928145/[50] |
Reverse | CTCTACGAGACTCAAGCTTGC | ||
Bacteroides | Forward | GAGAGGAAGGTCCCCCAC | NC_003228/[51] |
Reverse | CGCTACTTGGCTGGTTCAG | ||
Bifidobacterium | Forward | CTC CTG GAA ACG GGT GG | CP001213/[52] |
Reverse | GGT GTT CTT CCC GAT ATC TAC A | ||
Lactobacillus | Forward | AGCAGTAGGGAATCTTCCA | NC_015213/[53] |
Reverse | CACCGCTACACATGGAG | ||
Clostridium | Forward | AAAGGAAGATTAATACCGCATAA | KF929215/[54] |
Reverse | ATCTTGCGACCGTACTCCCC | ||
β-actin | Forward | CCTGCTTGCTGATCCACA | V01217.1/[55] |
Reverse | CTGACCGAGCGTGGCTAG |
Targets | Tested Compounds | RMSD Value (Å) | Docking (Affinity) Score (kcal/mol) | Interactions | |
---|---|---|---|---|---|
H. B | Pi-Interaction | ||||
SIRT-1 | Resveratrol (Reference) | 0.75 | −6.90 | 3 | 2 |
QR | 1.220 | −9.93 | 3 | 7 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abd El-Emam, M.M.; Mostafa, M.; Farag, A.A.; Youssef, H.S.; El-Demerdash, A.S.; Bayoumi, H.; Gebba, M.A.; El-Halawani, S.M.; Saleh, A.M.; Badr, A.M.; et al. The Potential Effects of Quercetin-Loaded Nanoliposomes on Amoxicillin/Clavulanate-Induced Hepatic Damage: Targeting the SIRT1/Nrf2/NF-κB Signaling Pathway and Microbiota Modulation. Antioxidants 2023, 12, 1487. https://doi.org/10.3390/antiox12081487
Abd El-Emam MM, Mostafa M, Farag AA, Youssef HS, El-Demerdash AS, Bayoumi H, Gebba MA, El-Halawani SM, Saleh AM, Badr AM, et al. The Potential Effects of Quercetin-Loaded Nanoliposomes on Amoxicillin/Clavulanate-Induced Hepatic Damage: Targeting the SIRT1/Nrf2/NF-κB Signaling Pathway and Microbiota Modulation. Antioxidants. 2023; 12(8):1487. https://doi.org/10.3390/antiox12081487
Chicago/Turabian StyleAbd El-Emam, Mahran Mohamed, Mahmoud Mostafa, Amina A. Farag, Heba S. Youssef, Azza S. El-Demerdash, Heba Bayoumi, Mohammed A. Gebba, Sawsan M. El-Halawani, Abdulrahman M. Saleh, Amira M. Badr, and et al. 2023. "The Potential Effects of Quercetin-Loaded Nanoliposomes on Amoxicillin/Clavulanate-Induced Hepatic Damage: Targeting the SIRT1/Nrf2/NF-κB Signaling Pathway and Microbiota Modulation" Antioxidants 12, no. 8: 1487. https://doi.org/10.3390/antiox12081487