Long-Term Effects of Ochratoxin A on the Glutathione Redox System and Its Regulation in Chicken
Abstract
:1. Introduction
2. Materials and Methods
2.1. Production and Determination of Ochratoxin A
2.2. Animals, Treatments and Sample Preparations
2.3. Determination of Lipid Peroxidation and Antioxidant Parameters
2.4. Quantitative Real-Time PCR
2.5. Statistical Analysis
3. Results
3.1. Clinical Findings
3.2. Effect of Long-Term Ochratoxin A Exposure on Lipid Peroxidation and Glutathione Redox System in Chicken Liver
3.3. Effect of Long-Term Ochratoxin A Exposure on Expression of Genes Encoding Components of Glutathione System and Required for Their Synthesis or Repair in Liver and Kidney
4. Discussion
Author Contributions
Funding
Acknowledgements
Conflicts of Interest
References
- Van der Merwe, K.J.; Steyn, P.S.; Fourie, L.; Scott, D.B.; Theron, J.J.; Ochratoxin, A. A toxic metabolite produced by Aspergillus ochraceus Wilh. Nature 1965, 205, 1112–1113. [Google Scholar] [CrossRef] [PubMed]
- O’Brien, E.; Dietrich, D.R. Ochratoxin A: The continuing enigma. Crit. Rev. Toxicol. 2005, 35, 33–60. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Marquardt, R.R.; Frohlich, A.A.; Vitti, T.G.; Crow, G. Pharmacokinetics of ochratoxin A and its metabolites in rats. Toxicol. Appl. Pharmacol. 1997, 145, 82–90. [Google Scholar] [CrossRef] [PubMed]
- Biomin World Mycotoxin Survey. Annual Report No. 15. 2018. Available online: https://www.biomin.net/en/articles/biomin-world-mycotoxin-survey-report-2018/?utm_source=AAF&utm_medium=Advertorial&utm_campaign=MTXSurvey (accessed on 2 May 2019).
- Dirheimer, G.; Creppy, E.E. Mechanism of action of ochratoxin A. IARC Sci. Publ. 1991, 115, 171–186. [Google Scholar]
- Huff, W.E.; Wyatt, R.D.; Tucker, T.L.; Hamilton, P.B. Ochratoxicosis in the broiler chicken. Poult. Sci. 1974, 53, 1585–1591. [Google Scholar] [CrossRef] [PubMed]
- Huff, W.W.; Wyatt, R.D.; Hamilton, P.B. Nephrotoxicity of dietary ochratoxin A in broiler chickens. Appl. Microbiol. 1975, 30, 48–51. [Google Scholar] [PubMed]
- Solcan, C.; Timofte, D.; Floristean, V.C.; Carter, S.D.; Solcan, G. Ultrastructural lesions and immunochemical analysis of Bcl-2 protein expression in the kidney of chickens with experimental ochratoxicosis. Acta Vet. Hung. 2013, 61, 344–353. [Google Scholar] [CrossRef]
- Marin-Kuan, M.; Nestler, S.; Verguet, C.; Bezencon, C.; Piguet, D.; Mansourian, R.; Holzwarth, J.; Grigorov, M.; Delatour, T.; Mantle, P.; et al. A toxicogenomics approach to identify new plausible epigenetic mechanisms of ochratoxin a carcinogenicity in rat. Toxicol. Sci. 2006, 89, 120–134. [Google Scholar] [CrossRef] [PubMed]
- Malir, F.; Ostry, V.; Pfohl-Leszkowicz, A.; Novotna, E. Ochratoxin A: Developmental and reproductive toxicity—An overview. Dev. Reprod. Toxicol. 2013, 98, 493–502. [Google Scholar] [CrossRef]
- Gupta, S.; Jindal, N.; Khokhar, R.S.; Gupta, A.K.; Ledoux, D.R.; Rottinghaus, G.E. Effect of ochratoxin A on broiler chicks challenged with Salmonella gallinarum. Br. Poult. Sci. 2005, 46, 443–450. [Google Scholar] [CrossRef]
- Kumar, A.; Jindal, N.; Shukla, C.L.; Pal, Y.; Ledoux, D.R.; Rottinghaus, G.E. Effect of ochratoxin A on Escherichia coli-challenged broiler chicks. Avian Dis. 2003, 47, 415–424. [Google Scholar] [CrossRef]
- Pozzo, L.; Salamano, G.; Mellia, E.; Gennero, M.S.; Doglione, L.; Cavallarin, L.; Tarantola, M.; Forneris, G.; Schiavone, A. Feeding a diet contaminated with ochratoxin A for chickens at the maximum level recommended by the EU for poultry feeds (0.1 mg/kg). 1. Effects on growth and slaughter performance, haematological and serum traits. J. Anim. Physiol. Anim. Nutr. 2013, 97, 13–22. [Google Scholar] [CrossRef] [PubMed]
- Gareis, M.; Scheuer, R. Ochratoxin A in meat and meat products. Arch. Lebensm. 2000, 51, 102–104. [Google Scholar]
- Gentles, A.; Smith, E.E.; Kubena, L.F.; Duffus, E.; Johnson, P.; Thompson, J.; Harvey, R.B.; Edrington, T.S. Toxicological evaluations of cyclopiazonic acid and ochratoxin A in broilers. Poult. Sci. 1999, 78, 1380–1384. [Google Scholar] [CrossRef] [PubMed]
- Luhe, A.; Hildebrand, H.; Bach, U.; Dingermann, T.; Ahr, H.J. A new approach to studying ochratoxin A (OTA)-induced nephrotoxicity: Expression profiling in vivo and in vitro employing cDNA microarrays. Toxicol. Sci. 2003, 73, 315–328. [Google Scholar] [CrossRef] [PubMed]
- Schaaf, G.J.; Nijmeijer, S.M.; Maas, R.F.; Roestenberg, P.; de Groene, E.M.; Fink-Gremmels, J. The role of oxidative stress in the ochratoxin A-mediated toxicity in proximal tubular cells. Biochim. Biophys. Acta 2002, 1588, 149–158. [Google Scholar] [CrossRef] [Green Version]
- Hoehler, D.; Marquardt, R.R. Influence of vitamins E and C on the toxic effects of ochratoxin A and T-2 toxin in chicks. Poult. Sci. 1996, 75, 1508–1515. [Google Scholar] [CrossRef]
- Kensler, T.W.; Wakabayashi, N.; Biswal, S. Cell survival responses to environmental stresses via the Keap1-Nrf2-ARE pathway. Annu. Rev. Pharmacol. Toxicol. 2007, 47, 89–116. [Google Scholar] [CrossRef]
- Suzuki, T.; Yamamoto, M. Molecular basis of the Keap1–Nrf2 system. Free Radic. Biol. Med. 2015, 88 Pt B, 93–100. [Google Scholar] [CrossRef]
- Cavin, C.; Delatour, T.; Marin-Kuan, M.; Holzhauser, D.; Higgins, L.; Bezencon, C.; Guignard, G.; Junod, S.; Richoz-Payot, J.; Gremaud, E.; et al. Reduction in antioxidant defenses may contribute to ochratoxin A toxicity and carcinogenicity. Toxicol. Sci. 2007, 96, 30–39. [Google Scholar] [CrossRef]
- Boesch-Saadatmandi, C.; Wagner, A.E.; Graeser, A.C.; Hundhausen, C.; Wolffram, S.; Rimbach, G. Ochratoxin A impairs Nrf2-dependent gene expression in porcine kidney tubulus cells. J. Anim. Physiol. Anim. Nutr. 2009, 93, 547–554. [Google Scholar] [CrossRef] [PubMed]
- Wild, A.C.; Moinova, H.R.; Mulcahy, R.T. Regulation of gamma-glutamylcysteine synthetase subunit gene expression by the transcription factor Nrf2. J. Biol. Chem. 1999, 274, 33627–33636. [Google Scholar] [CrossRef] [PubMed]
- Motohashi, H.; Yamamoto, M. Nrf2-Keap1 defines a physiologically important stress response mechanism. Trends Mol. Med. 2004, 10, 549–557. [Google Scholar] [CrossRef] [PubMed]
- Dinkova-Kostova, A.T.; Holtzclaw, W.D.; Cole, R.N.; Itoh, K.; Wakabayashi, N.; Katoh, Y.; Yamamoto, M.; Talalay, P. Direct evidence that sulfhydryl groups of Keap1 are the sensors regulating induction of phase 2 enzymes that protect against carcinogens and oxidants. Proc. Natl. Acad. Sci. USA 2002, 99, 11908–11913. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- NCIB (National Center for Biotechnology Information) RefSeq: NCBI Reference Sequence Database. 2014. Available online: http://www.ncbi. nlm.nih.gov/refseq (accessed on 15 April 2019).
- Zeferino, C.P.; Wells, K.D.; Moura, A.S.A.M.T.; Murarolli, R.A.; Rottinghaus, G.E.; Ledoux, D.R. Gene expression in the kidneys of broilers fed ochratoxin A for different time periods. World Mycotox J. 2016, 9, 257–268. [Google Scholar] [CrossRef]
- Stroka, J.; Ambrosio, M.; Doncheva, I.; Lerda, D.; Mischke, C.; Breidbach, A. Validation of an Analytical Method to Determine the Content of Ochratoxin A in Animal Feed; European Commission Joint Research Centre Institute for Reference Materials and Measurements; Office for Official Publications of the European Communities: Luxembourg, 2009; p. 54. [Google Scholar]
- Buege, J.A.; Aust, S.D. Microsomal lipid peroxidation. Methods Enzymol. 1978, 52, 302–310. [Google Scholar] [PubMed]
- Botsoglou, N.A.; Fletouris, D.J.; Papageorgiou, G.E.; Vassilopoulos, V.N.; Mantis, A.J.; Trakatellis, A.G. Rapid, sensitive and specific thiobarbituric acid method for measuring lipid peroxidation in animal tissue, food and feedstuff samples. J. Agric. Food Chem. 1994, 42, 1931–1937. [Google Scholar] [CrossRef]
- Rahman, I.; Biswas, S.K.; Kode, A. Oxidant and antioxidant balance in the airways and airway diseases. Eur. J. Pharmacol. 2006, 533, 222–239. [Google Scholar] [CrossRef]
- Lawrence, R.A.; Burk, R.F. Glutathione peroxidase activity in selenium deficient rat liver. Biochem. Biophys. Res. Commun. 1976, 71, 952–956. [Google Scholar] [CrossRef]
- Weichselbaum, T.E. An accurate and rapid method for the determination of protein in small amounts of serum and plasma. Am. J. Clin. Pathol. 1948, 16, 40–43. [Google Scholar] [CrossRef]
- Lowry, O.H.; Rosebrough, N.J.; Farr, A.L.; Randall, R.J. Protein measurement with the Folin phenol reagent. J. Biol. Chem. 1951, 193, 265–275. [Google Scholar] [PubMed]
- Yarru, L.P.; Settivari, R.S.; Antoniou, E.; Ledoux, D.R.; Rottinghaus, G. Toxicological and gene expression analysis of the impact of aflatoxin B1 on hepatic function of male broiler chicks. Poult. Sci. 2009, 88, 360–371. [Google Scholar] [CrossRef] [PubMed]
- Salem, R.; El-Habashi, N.; Fadl, S.E.; Sakr, O.A.; Elbialy, Z.I. Effect of probiotic supplement on aflatoxicosis and gene expression in the liver of broiler chicken. Environ. Toxicol. Pharmacol. 2018, 60, 118–127. [Google Scholar] [CrossRef] [PubMed]
- Erdélyi, M.; Balogh, K.; Pelyhe, C.; Kövesi, B.; Nakade, M.; Zándoki, E.; Mézes, M.; Kovács, B. Changes in the regulation and activity of glutathione redox system, and lipid peroxidation processes in short-term aflatoxin B1 exposure in liver of laying hens. J. Anim. Physiol. Anim. Nutr. 2018, 102, 947–952. [Google Scholar] [CrossRef] [PubMed]
- Nakade, M.; Pelyhe, C.; Kövesi, B.; Balogh, K.; Kovács, B.; Szabó-Fodor, J.; Zándoki, E.; Mézes, M.; Erdélyi, M. Short-term effects of T-2 toxin or deoxynivalenol on glutathione status and expression of its regulatory genes in chicken. Acta Vet. Hung. 2018, 66, 28–39. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Frye, C.E.; Chu, F.S. Distribution of ochratoxin A in chicken tissues and eggs. J. Food Saf. 1977, 1, 147–159. [Google Scholar] [CrossRef]
- Soyöz, M.; Özçelik, N.; Kihnç, I.; Altuntaş, I. The effects of ochratoxin A on lipid peroxidation and antioxidant enzymes: A protective role of melatonin. Cell Biol. Toxicol. 2004, 20, 213–219. [Google Scholar] [CrossRef]
- Abdel-Wahhab, M.A.; Abdel-Galil, M.M.; El-Lithey, M. Melatonin counteracts oxidative stress in rats fed an ochratoxin A contaminated diet. J. Pineal Res. 2005, 38, 130–135. [Google Scholar] [CrossRef] [PubMed]
- Omar, R.F.; Hasinoff, B.B.; Mejilla, F.; Rahimtula, A.D. Mechanism of ochratoxin A stimulated lipid peroxidation. Biochem. Pharmacol. 1990, 40, 1183–1191. [Google Scholar] [CrossRef]
- Petrik, J.; Zanic-Grubisic, T.; Barisic, K.; Pepeljnjak, S.; Radic, B.; Ferencic, Z.; Cepelak, I. Apoptosis and oxidative stress induced by ochratoxin A in rat kidney. Arc. Toxicol. 2003, 77, 685–693. [Google Scholar] [CrossRef] [PubMed]
- Tozlovanu, M.; Canadas, D.; Pfohl-Leszkowicz, A.; Frenette, C.; Paugh, R.J.; Manderville, R.A. Glutathione conjugates of ochratoxin A as biomarkers of exposure. Arch. Ind. Hyg. Toksikol. 2012, 63, 417–427. [Google Scholar] [CrossRef] [PubMed]
- Espinosa-Diez, C.; Miguel, V.; Mennerich, D.; Kietzmann, T.; Sánchez-Pérez, P.; Cadenas, S.; Lamas, S. Antioxidant responses and cellular adjustments to oxidative stress. Redox Biol. 2015, 6, 183–197. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Avissar, N.; Ornt, D.B.; Yagil, Y.; Horowitz, S.; Watkins, R.H.; Kerl, E.A.; Takahashi, K.; Palmer, I.S.; Cohen, H.J. Effect of renal failure on blood plasma glutathione peroxidase activity in dialysed patients. Am. J. Physiol. 1994, 266, C367–C372. [Google Scholar] [CrossRef] [PubMed]
- Imai, H.; Nakagawa, Y. Biological significance of phospholipid hydroperoxide glutathione peroxidase (PHGPx,GPx4) in mammalian cells. Free Radic. Biol. Med. 2003, 34, 145–169. [Google Scholar] [CrossRef]
- Rhee, S.G.; Yang, K.-S.; Kang, S.W.; Woo, H.A.; Chang, T.-S. Controlled elimination of intracellular H2O2: Regulation of peroxiredoxin, catalase, and glutathione peroxidase via post-translational modification. Antioxid. Redox Signal. 2005, 7, 619–626. [Google Scholar] [CrossRef] [PubMed]
- Franz, C.; Baser, K.H.C.; Windisch, W. Essential oils and aromatic plants in animal feeding—A European perspective. A review. Flavour Fragr. J. 2010, 25, 327–340. [Google Scholar] [CrossRef]
Group | Predicted OTA (μg/kg) | Measured OTA (μg/kg) |
---|---|---|
Control | 0 | <57 |
O1 | 100 | 106 ± 10.5 |
O2 | 500 | 654 ± 65.2 |
O3 | 1000 | 1126 ± 93.7 |
Gene | Forward (5’-3’) | Reverse (5’-3’) | GenBank Accession Nr. |
---|---|---|---|
GAPDH | TGACCTGCCGTCTGGAGAAA | TGTGTATCCTAGGATGCCCTTCAG | NM_204305.1 |
KEAP1 | CATCGGCATCGCCAACTT | TGAAGAACTCCTCCTGCTTGGA | XM_025145847.1 |
NRF2 | TTTTCGCAGAGCACAGATAC | GGAGAAGCCTCATTGTCATC | NM_205117.1 |
GPX3 | ATCCCCTTCCGAAAGTACGC | GACGACAAGTCCATAGGGCC | NM_001163232.2 |
GPX4 | AGTGCCATCAAGTGGAACTTCAC | TTCAAGGCAGGCCGTCAT | NM_001346448.1 |
GSS | GTACTCACTGGATGTGGGTGAAGA | CGGCTCGATCTTGTCCATCAG | XM_425692.6 |
GSR | CCACCAGAAAGGGGATCTACG | ACAGAGATGGCTTCATCTTCAGTG | XM_015276627.2 |
Gene | MGM-NFQ Dual Labelled Probe 5’-3’ | Fluorescent Dye |
---|---|---|
GAPDH | CCAGCCAAGTATGATGAT | VIC |
GPX4 | CAGCCCAATGGAG | FAM |
GSS | AGGAGGGAACAACCTG | FAM |
GSR | CTGGACTTCGGCTC | FAM |
Malondialdehyde in Liver Homogenate (μmol/g Wet Weight Tissue) | ||||
Day 0 | Day 7 | Day 14 | Day 21 | |
Control | 64.46 ± 11.23 | 49.89 ± 6.49 a | 43.71 ± 14.24 a | 58.21 ± 5.89 a |
O1 | 57.21 ± 11.54 ab | 59.83 ± 7.31 ab | 61.54 ± 14.95 ab | |
O2 | 56.79 ± 13.57 ab | 62.34 ± 15.11 ab | 56.53 ± 9.91 a | |
O3 | 77.59 ± 28.07 b | 74.28 ± 18.64 b | 77.41 ± 8.39 b | |
Malondialdehyde in Kidney Homogenate (μmol/g Wet Weight Tissue) | ||||
Day 0 | Day 7 | Day 14 | Day 21 | |
Control | 36.32 ± 10.10 | 41.11 ± 7.98 a | 41.03 ± 12.27 | 46.19 ± 5.37 |
O1 | 42.38 ± 9.19 ab | 42.55 ± 12.39 | 44.14 ± 2.67 | |
O2 | 46.25 ± 11.94 ab | 43.65 ± 9.19 | 41.32 ± 9.68 | |
O3 | 57.93 ± 7.44 b | 50.75 ± 8.14 | 45.23 ± 3.08 |
Blood Plasma (μmol/g Protein) | ||||
Day 0 | Day 7 | Day 14 | Day 21 | |
Control | 11.47 ± 1.91 | 11.70 ± 1.65 a | 11.91 ± 2.67 | 11.68 ± 1.00 |
O1 | 12.15 ± 2.42 a | 12.10 ± 1.74 | 12.42 ± 2.16 | |
O2 | 14.51 ± 1.89 a | 13.28 ± 1.58 | 11.80 ± 1.50 | |
O3 | 17.78 ± 1.29 b | 12.75 ± 2.00 | 13.26 ± 1.60 | |
Liver (μmol/g 10,000 g Supernatant Protein) | ||||
Day 0 | Day 7 | Day 14 | Day 21 | |
Control | 3.25 ± 0.37 | 5.22 ± 1.30 | 5.24 ± 0.53 a | 4.08 ± 0.53 ab |
O1 | 5.69 ± 0.78 | 5.21 ± 0.62 a | 3.44 ± 0.32 a | |
O2 | 6.58 ± 1.04 | 6.04 ± 1.33 ab | 4.39 ± 1.27 ab | |
O3 | 6.73 ± 1.77 | 7.73 ± 1.85 b | 5.42 ± 0.93 b |
Liver (U/g 10,000 g Supernatant Protein) | ||||
Day 0 | Day 7 | Day 14 | Day 21 | |
Control | 1.76 ± 0.63 | 3.13 ± 1.17 | 3.15 ± 1.40 | 2.70 ± 0.99 |
O1 | 3.01 ± 0.96 | 3.05 ± 0.71 | 2.01 ± 0.71 | |
O2 | 4.21 ± 1.59 | 3.91 ± 1.55 | 2.35 ± 1.27 | |
O3 | 4.13 ± 1.45 | 4.76 ± 2.23 | 3.40 ± 1.04 | |
Kidney (U/g 10,000 g Supernatant Protein) | ||||
Day 0 | Day 7 | Day 14 | Day 21 | |
Control | 2.26 ± 0.43 | 2.24 ± 0.27 a | 2.79 ± 0.22 | 2.27 ± 0.71 |
O1 | 2.60 ± 0.26 ab | 2.69 ± 0.47 | 2.39 ± 0.11 | |
O2 | 2.63 ± 0.28 ab | 2.59 ± 0.66 | 2.72 ± 0.28 | |
O3 | 2.94 ± 0.26 b | 2.75 ± 0.48 | 2.62 ± 0.31 |
Kelch-Like ECH-Associated Protein 1 (KEAP1) | ||||
Day 0 | Day 7 | Day 14 | Day 21 | |
Liver | ||||
Control | 1.00 ± 0.05 | 0.71 ± 0.08 | 0.90 ± 0.08 a | 1.00 ± 0.16 |
O1 | 0.71 ± 0.10 | 0.93 ± 0.13 a | 0.91 ± 0.18 | |
O2 | 0.69 ± 0.06 | 1.19 ± 0.15 b | 1.01 ± 0.14 | |
O3 | 0.76 ± 0.14 | 1.27 ± 0.08 b | 1.09 ± 0.24 | |
Kidney | ||||
Control | 1.00 ± 0.06 | 1.00 ± 0.14 b | 1.15 ± 0.09 b | 1.39 ± 0.22 b |
O1 | 0.97 ± 0.11 b | 0.95 ± 0.10 ab | 1.11 ± 0.20 a | |
O2 | 0.73 ± 0.07 a | 0.92 ± 0.21 a | 0.94 ± 0.08 a | |
O3 | 0.85 ± 0.05 ab | 0.96 ± 0.06 ab | 1.17 ± 0.13 ab | |
Nuclear Factor-Erythroid 2 p45-Related Factor 2 (NRF2) | ||||
Day 0 | Day 7 | Day 14 | Day 21 | |
Liver | ||||
Control | 1.00 ± 0.06 | 1.19 ± 0.24 a | 1.52 ± 0.27 ab | 1.20 ± 0.20 a |
O1 | 1.07 ± 0.23 a | 1.21 ± 0.23 a | 1.21 ± 0.22 a | |
O2 | 1.36 ± 0.28 ab | 1.23 ± 0.24 a | 1.46 ± 0.30 a | |
O3 | 1.68 ± 0.25 b | 1.87 ± 0.22 b | 1.85 ± 0.31 b | |
Kidney | ||||
Control | 1.01 ± 0.12 | 0.89 ± 0.07 a | 0.95 ± 0.19 a | 1.04 ± 0.12 a |
O1 | 0.79 ± 0.14 a | 0.92 ± 0.15 a | 0.95 ± 0.16 a | |
O2 | 0.80 ± 0.13 a | 0.98 ± 0.15 a | 0.96 ± 0.09 a | |
O3 | 1.22 ± 0.14 b | 1.39 ± 0.25 b | 1.29 ± 0.23 b |
Glutathione Peroxidase 3 (GPX3) | ||||
Day 0 | Day 7 | Day 14 | Day 21 | |
Liver | ||||
Control | 1.00 ± 0.03 | 0.84 ± 0.10 b | 0.99 ± 0.16 a | 1.49 ± 0.14 c |
O1 | 0.59 ± 0.15 a | 0.95 ± 0.18 a | 0.86 ± 0.10 a | |
O2 | 0.73 ± 0.11 ab | 1.05 ± 0.11 ab | 0.89 ± 0.12 a | |
O3 | 0.84 ± 0.19 b | 1.24 ± 0.09 a | 1.24 ± 0.13 b | |
Kidney | ||||
Control | 1.00 ± 0.03 | 0.83 ± 0.06 a | 0.94 ± 0.08 a | 1.05 ± 0.06 a |
O1 | 0.90 ± 0.08 a | 0.99 ± 0.01 ab | 1.10 ± 0.11 a | |
O2 | 0.96 ± 0.11 a | 0.99 ± 0.09 ab | 1.00 ± 0.08 a | |
O3 | 1.60 ± 0.10 b | 1.56 ± 0.14 b | 1.47 ± 0.15 b | |
Glutathione Peroxidase 4 (GPX4) | ||||
Day 0 | Day 7 | Day 14 | Day 21 | |
Liver | ||||
Control | 1.00 ± 0.05 | 0.51 ± 0.02 | 0.40 ± 0.03 ab | 0.53 ± 0.03 |
O1 | 0.49 ± 0.02 | 0.32 ± 0.01 a | 0.51 ± 0.03 | |
O2 | 0.50 ± 0.05 | 0.42 ± 0.03 b | 0.54 ± 0.04 | |
O3 | 0.51 ± 0.06 | 0.42 ± 0.10 ab | 0.49 ± 0.01 | |
Kidney | ||||
Control | 1.00 ± 0.05 | 0.48 ± 0.03 b | 0.52 ± 0.03 c | 1.25 ± 0.04 c |
O1 | 0.49 ± 0.02 b | 0.32 ± 0.01 a | 0.90 ± 0.03 b | |
O2 | 0.40 ± 0.02 a | 0.35 ± 0.02 ab | 0.72 ± 0.04 a | |
O3 | 0.37 ± 0.03 a | 0.36 ± 0.03 b | 0.75 ± 0.04 a |
Glutathione Synthetase (GSS) | ||||
Day 0 | Day 7 | Day 14 | Day 21 | |
Liver | ||||
Control | 1.00 ± 0.03 | 0.73 ± 0.09 | 1.25 ± 0.17 b | 0.93 ± 0.13 |
O1 | 0.71 ± 0.09 | 0.83 ± 0.09 a | 0.76 ± 0.31 | |
O2 | 0.74 ± 0.10 | 1.06 ± 0.19 ab | 0.78 ± 0.20 | |
O3 | 0.70 ± 0.12 | 1.19 ± 0.25 b | 0.57 ± 0.10 | |
Kidney | ||||
Control | 1.00 ± 0.08 | 0.96 ± 0.14 ab | 1.11 ± 0.07 b | 0.84 ± 0.17 |
O1 | 1.08 ± 0.17 b | 0.83 ± 0.09 a | 0.79 ± 0.14 | |
O2 | 0.81 ± 0.15 a | 1.01 ± 0.10 b | 0.82 ± 0.08 | |
O3 | 0.82 ± 0.16 a | 0.98 ± 0.13 ab | 0.80 ± 0.07 | |
Glutathione Reductase (GSR) | ||||
Day 0 | Day 7 | Day 14 | Day 21 | |
Liver | ||||
Control | 1.00 ± 0.10 | 0.48 ± 0.04 | 0.60 ± 0.06 b | 0.47 ± 0.05 |
O1 | 0.51 ± 0.09 | 0.34 ± 0.06 a | 0.52 ± 0.06 | |
O2 | 0.54 ± 0.04 | 0.60 ± 0.09 b | 0.48 ± 0.03 | |
O3 | 0.50 ± 0.08 | 0.54 ± 0.05 b | 0.47 ± 0.08 | |
Kidney | ||||
Control | 1.00 ± 0.04 | 0.99 ± 0.10 | 0.95 ± 0.13 b | 1.10 ± 0.16 |
O1 | 1.06 ± 0.21 | 0.75 ± 0.12 a | 1.04 ± 0.16 | |
O2 | 0.94 ± 0.12 | 0.93 ± 0.04 b | 0.99 ± 0.16 | |
O3 | 1.11 ± 0.19 | 0.91 ± 0.09 b | 1.04 ± 0.20 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kövesi, B.; Cserháti, M.; Erdélyi, M.; Zándoki, E.; Mézes, M.; Balogh, K. Long-Term Effects of Ochratoxin A on the Glutathione Redox System and Its Regulation in Chicken. Antioxidants 2019, 8, 178. https://doi.org/10.3390/antiox8060178
Kövesi B, Cserháti M, Erdélyi M, Zándoki E, Mézes M, Balogh K. Long-Term Effects of Ochratoxin A on the Glutathione Redox System and Its Regulation in Chicken. Antioxidants. 2019; 8(6):178. https://doi.org/10.3390/antiox8060178
Chicago/Turabian StyleKövesi, Benjámin, Mátyás Cserháti, Márta Erdélyi, Erika Zándoki, Miklós Mézes, and Krisztián Balogh. 2019. "Long-Term Effects of Ochratoxin A on the Glutathione Redox System and Its Regulation in Chicken" Antioxidants 8, no. 6: 178. https://doi.org/10.3390/antiox8060178