Curcumin Protects Human Trophoblast HTR8/SVneo Cells from H2O2-Induced Oxidative Stress by Activating Nrf2 Signaling Pathway
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Cell Culture
2.3. Cell Viability Assay
2.4. Analysis of the Contents of CAT, GSH-Px and ROS
2.5. Analysis of Apoptosis by Annexin V-Alexa Fluor 647/Propidium Iodide (PI) Staining
2.6. Quantitative Real-Time PCR
2.7. Nrf2 Immunofluorescence
2.8. Western Blotting
2.9. Small Interfering RNA (siRNA) Transfection
2.10. Statistical Analysis
3. Results
3.1. Curcumin Protected against H2O2-Induced Cytotoxicity in HTR8/SVneo Cells
3.2. Curcumin Increased H2O2-Induced CAT, GSH-Px Activity and Reduced the Level of Intracellular ROS in HTR8/SVneo Cells under Oxidative Stress
3.3. Curcumin Inhibited H2O2-Induced Apoptosis of HTR8/SVneo Cells
3.4. Curcumin Regulated mRNA Expression of Multiple Antioxidant Genes and Nutrient Transporter Genes in HTR8/SVneo Cells under Oxidative Stress
3.5. Curcumin Increased Nrf2, HO-1 and NQO1 Protein Expression and Nrf2 Translocation in HTR8/SVneo Cells under Oxidative Stress
3.6. Nrf2 Knockdown Attenuated the Protective Effect of Curcumin on HTR8/SVneo Cells under Oxidative Stress
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Li, J.; Ding, Z.; Yang, Y.; Mao, B.; Wang, Y.; Xu, X. Lycium barbarum polysaccharides protect human trophoblast HTR8/SVneo cells from hydrogen peroxideinduced oxidative stress and apoptosis. Mol Med Rep 2018, 18, 2581–2588. [Google Scholar] [CrossRef] [PubMed]
- Carter, A.M.; Enders, A.C.; Pijnenborg, R. The role of invasive trophoblast in implantation and placentation of primates. Philos. Trans. R. Soc. Lond B Biol. Sci. 2015, 370, 20140070. [Google Scholar] [CrossRef] [PubMed]
- Longo, S.; Borghesi, A.; Tzialla, C.; Stronati, M. IUGR and infections. Early Hum. Dev. 2014, 90 (Suppl. 1), S42–S44. [Google Scholar] [CrossRef]
- Cap, M.; Vachova, L.; Palkova, Z. Reactive oxygen species in the signaling and adaptation of multicellular microbial communities. Oxidative Med. Cell. Longev. 2012, 2012, 976753. [Google Scholar] [CrossRef]
- Ray, R.; Shah, A.M. NADPH oxidase and endothelial cell function. Clin. Sci. (Lond) 2005, 109, 217–226. [Google Scholar] [CrossRef] [PubMed]
- Torres-Cuevas, I.; Parra-Llorca, A.; Sanchez-Illana, A.; Nunez-Ramiro, A.; Kuligowski, J.; Chafer-Pericas, C.; Cernada, M.; Escobar, J.; Vento, M. Oxygen and oxidative stress in the perinatal period. Redox Biol. 2017, 12, 674–681. [Google Scholar] [CrossRef]
- Chen, Y.; Zhang, H.; Cheng, Y.; Li, Y.; Wen, C.; Zhou, Y. Dietary l-threonine supplementation attenuates lipopolysaccharide-induced inflammatory responses and intestinal barrier damage of broiler chickens at an early age. Br. J. Nutr. 2018, 119, 1254–1262. [Google Scholar] [CrossRef]
- Mehta, J.; Rayalam, S.; Wang, X. Cytoprotective Effects of Natural Compounds against Oxidative Stress. Antioxidants 2018, 7, 147. [Google Scholar] [CrossRef]
- Kiokias, S.; Proestos, C.; Oreopoulou, V. Effect of Natural Food Antioxidants against LDL and DNA Oxidative Changes. Antioxidants 2018, 7, 133. [Google Scholar] [CrossRef]
- Sahin, K.; Orhan, C.; Tuzcu, Z.; Tuzcu, M.; Sahin, N. Curcumin ameloriates heat stress via inhibition of oxidative stress and modulation of Nrf2/HO-1 pathway in quail. Food Chem. Toxicol. 2012, 50, 4035–4041. [Google Scholar] [CrossRef]
- Anand, P.; Thomas, S.G.; Kunnumakkara, A.B.; Sundaram, C.; Harikumar, K.B.; Sung, B.; Tharakan, S.T.; Misra, K.; Priyadarsini, I.K.; Rajasekharan, K.N.; et al. Biological activities of curcumin and its analogues (Congeners) made by man and Mother Nature. Biochem. Pharmacol. 2008, 76, 1590–1611. [Google Scholar] [CrossRef] [PubMed]
- Ak, T.; Gulcin, I. Antioxidant and radical scavenging properties of curcumin. Chem. Biol. Interact. 2008, 174, 27–37. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Xu, L.; Zhang, L.; Ying, Z.; Su, W.; Wang, T. Curcumin attenuates D-galactosamine/lipopolysaccharide-induced liver injury and mitochondrial dysfunction in mice. J. Nutr. 2014, 144, 1211–1218. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Ibtisham, F.; Niu, Y.F.; Wang, Z.; Li, G.H.; Zhao, Y.; Nawab, A.; Xiao, M.; An, L. Curcumin inhibits heat-induced oxidative stress by activating the MAPK-Nrf2 / ARE signaling pathway in chicken fibroblasts cells. J. Therm. Biol. 2019, 79, 112–119. [Google Scholar] [CrossRef]
- Zhang, J.; Hou, X.; Ahmad, H.; Zhang, H.; Zhang, L.; Wang, T. Assessment of free radicals scavenging activity of seven natural pigments and protective effects in AAPH-challenged chicken erythrocytes. Food Chem. 2014, 145, 57–65. [Google Scholar] [CrossRef]
- Xie, Z.; Wu, B.; Shen, G.; Li, X.; Wu, Q. Curcumin alleviates liver oxidative stress in type 1 diabetic rats. Mol. Med. Rep. 2018, 17, 103–108. [Google Scholar] [CrossRef]
- Motterlini, R.; Foresti, R.; Bassi, R.; Green, C.J. Curcumin, an antioxidant and anti-inflammatory agent, induces heme oxygenase-1 and protects endothelial cells against oxidative stress. Free Radic. Biol. Med. 2000, 28, 1303–1312. [Google Scholar] [CrossRef]
- Gao, S.; Duan, X.X.; Wang, X.; Dong, D.D.; Liu, D.; Li, X.; Sun, G.F.; Li, B. Curcumin attenuates arsenic-induced hepatic injuries and oxidative stress in experimental mice through activation of Nrf2 pathway, promotion of arsenic methylation and urinary excretion. Food Chem. Toxicol. 2013, 59, 739–747. [Google Scholar] [CrossRef]
- Balogun, E.; Hoque, M.; Gong, P.; Killeen, E.; Green, C.J.; Foresti, R.; Alam, J.; Motterlini, R. Curcumin activates the haem oxygenase-1 gene via regulation of Nrf2 and the antioxidant-responsive element. Biochem. J. 2003, 371, 887–895. [Google Scholar] [CrossRef]
- Taguchi, K.; Motohashi, H.; Yamamoto, M. Molecular mechanisms of the Keap1-Nrf2 pathway in stress response and cancer evolution. Genes Cells 2011, 16, 123–140. [Google Scholar] [CrossRef]
- Buendia, I.; Michalska, P.; Navarro, E.; Gameiro, I.; Egea, J.; Leon, R. Nrf2-ARE pathway: An emerging target against oxidative stress and neuroinflammation in neurodegenerative diseases. Pharmacol. Ther. 2016, 157, 84–104. [Google Scholar] [CrossRef] [PubMed]
- Nakai, K.; Fujii, H.; Kono, K.; Goto, S.; Kitazawa, R.; Kitazawa, S.; Hirata, M.; Shinohara, M.; Fukagawa, M.; Nishi, S. Vitamin D activates the Nrf2-Keap1 antioxidant pathway and ameliorates nephropathy in diabetic rats. Am. J. Hypertens. 2014, 27, 586–595. [Google Scholar] [CrossRef] [PubMed]
- Woo, J.M.; Shin, D.Y.; Lee, S.J.; Joe, Y.; Zheng, M.; Yim, J.H.; Callaway, Z.; Chung, H.T. Curcumin protects retinal pigment epithelial cells against oxidative stress via induction of heme oxygenase-1 expression and reduction of reactive oxygen. Mol. Vis. 2012, 18, 901–908. [Google Scholar] [PubMed]
- Yu, M.; Chen, L.; Peng, Z.; Wang, D.; Song, Y.; Wang, H.; Yao, P.; Yan, H.; Nussler, A.K.; Liu, L.; et al. Embryotoxicity Caused by DON-Induced Oxidative Stress Mediated by Nrf2/HO-1 Pathway. Toxins 2017, 9, 188. [Google Scholar] [CrossRef]
- Qi, L.; Jiang, J.; Zhang, J.; Zhang, L.; Wang, T. Maternal curcumin supplementation ameliorates placental function and fetal growth in mice with intrauterine growth retardation. Biol. Reprod. 2020. [Google Scholar] [CrossRef]
- Dhanasekaran, S. Augmented cytotoxic effects of paclitaxel by curcumin induced overexpression of folate receptor-α for enhanced targeted drug delivery in HeLa cells. Phytomedicine 2019, 56, 279–285. [Google Scholar] [CrossRef]
- Myatt, L.; Cui, X. Oxidative stress in the placenta. Histochem. Cell Biol. 2004, 122, 369–382. [Google Scholar] [CrossRef]
- Dai, C.; Li, D.; Gong, L.; Xiao, X.; Tang, S. Curcumin Ameliorates Furazolidone-Induced DNA Damage and Apoptosis in Human Hepatocyte L02 Cells by Inhibiting ROS Production and Mitochondrial Pathway. Molecules 2016, 21, 1061. [Google Scholar] [CrossRef]
- Marchiani, A.; Rozzo, C.; Fadda, A.; Delogu, G.; Ruzza, P. Curcumin and curcumin-like molecules: from spice to drugs. Curr. Med. Chem. 2014, 21, 204–222. [Google Scholar] [CrossRef]
- Jin, X.; Wang, K.; Liu, H.; Hu, F.; Zhao, F.; Liu, J. Protection of Bovine Mammary Epithelial Cells from Hydrogen Peroxide-Induced Oxidative Cell Damage by Resveratrol. Oxidative Med. Cell. Longev. 2016, 2016, 2572175. [Google Scholar] [CrossRef]
- Bettaib, J.; Talarmin, H.; Droguet, M.; Magne, C.; Boulaaba, M.; Giroux-Metges, M.A.; Ksouri, R. Tamarix gallica phenolics protect IEC-6 cells against H2O2 induced stress by restricting oxidative injuries and MAPKs signaling pathways. Biomed. Pharmacother. 2017, 89, 490–498. [Google Scholar] [CrossRef]
- Zhuang, S.; Yu, R.; Zhong, J.; Liu, P.; Liu, Z. Rhein from Rheum rhabarbarum Inhibits Hydrogen-Peroxide-Induced Oxidative Stress in Intestinal Epithelial Cells Partly through PI3K/Akt-Mediated Nrf2/HO-1 Pathways. J. Agric. Food Chem. 2019, 67, 2519–2529. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Wu, G.; Qin, X.; Ma, Q.; Zhou, Y.; Liu, S.; Tan, Y. Expression of Nodal on Bronchial Epithelial Cells Influenced by Lung Microbes Through DNA Methylation Modulates the Differentiation of T-Helper Cells. Cell Physiol. Biochem. 2015, 37, 2012–2022. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.F.; Bai, K.W.; He, J.T.; Niu, Y.; Lu, Y.; Zhang, L.K.; Wang, T. Curcumin attenuates hepatic mitochondrial dysfunction through the maintenance of thiol pool, inhibition of mtDNA damage, and stimulation of the mitochondrial thioredoxin system in heat-stressed broilers. J. Anim. Sci. 2018, 96, 867–879. [Google Scholar] [CrossRef] [PubMed]
- Bjorklund, G.; Chirumbolo, S. Role of oxidative stress and antioxidants in daily nutrition and human health. Nutrition 2017, 33, 311–321. [Google Scholar] [CrossRef]
- Flohé, L. Glutathione Peroxidases. Encycl. Biol. Chem. 2013, 1830, 399–404. [Google Scholar]
- Zhong, W.; Qian, K.; Xiong, J.; Ma, K.; Wang, A.; Zou, Y. Curcumin alleviates lipopolysaccharide induced sepsis and liver failure by suppression of oxidative stress-related inflammation via PI3K/AKT and NF-kappaB related signaling. Biomed Pharmacother 2016, 83, 302–313. [Google Scholar] [CrossRef]
- Sinha, K.; Das, J.; Pal, P.B.; Sil, P.C. Oxidative stress: the mitochondria-dependent and mitochondria-independent pathways of apoptosis. Arch. Toxicol. 2013, 87, 1157–1180. [Google Scholar] [CrossRef]
- Namazi, N.S.; Saberi, S.F.; Falak, R.; Karimi, M.Y.; Davoodzadeh, M.G.; Rangbar, A.; Hosseini, A. Phosphodiesterase 4 and 7 inhibitors produce protective effects against high glucose-induced neurotoxicity in PC12 cells via modulation of the oxidative stress, apoptosis and inflammation pathways. Metab. Brain Dis. 2018, 1–14. [Google Scholar]
- Siddiqui, W.A.; Ahad, A.; Ahsan, H. The mystery of BCL2 family: Bcl-2 proteins and apoptosis: An update. Arch. Toxicol. 2015, 89, 289–317. [Google Scholar] [CrossRef]
- Mou, K.; Pan, W.; Han, D.; Wen, X.; Cao, F.; Miao, Y.; Li, P. Glycyrrhizin protects human melanocytes from H2O2-induced oxidative damage via the Nrf2dependent induction of HO1. Int. J. Mol. Med. 2019, 44, 253–261. [Google Scholar] [CrossRef] [PubMed]
- Bucolo, C.; Drago, F.; Maisto, R.; Romano, G.L.; D’Agata, V.; Maugeri, G.; Giunta, S. Curcumin prevents high glucose damage in retinal pigment epithelial cells through ERK1/2-mediated activation of the Nrf2/HO-1 pathway. J. Cell Physiol. 2019, 234, 17295–17304. [Google Scholar] [CrossRef] [PubMed]
- Circu, M.L.; Aw, T.Y. Reactive oxygen species, cellular redox systems, and apoptosis. Free Radic Biol. Med. 2010, 48, 749–762. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.S.; Surh, Y.J. Nrf2 as a novel molecular target for chemoprevention. Cancer Lett. 2005, 224, 171–184. [Google Scholar] [CrossRef]
- Tao, S.; Justiniano, R.; Zhang, D.D.; Wondrak, G.T. The Nrf2-inducers tanshinone I and dihydrotanshinone protect human skin cells and reconstructed human skin against solar simulated UV. Redox Biol. 2013, 1, 532–541. [Google Scholar] [CrossRef]
- Jeong, J.Y.; Cha, H.J.; Choi, E.O.; Kim, C.H.; Kim, G.Y.; Yoo, Y.H.; Hwang, H.J.; Park, H.T.; Yoon, H.M.; Choi, Y.H. Activation of the Nrf2/HO-1 signaling pathway contributes to the protective effects of baicalein against oxidative stress-induced DNA damage and apoptosis in HEI193 Schwann cells. Int. J. Med. Sci. 2019, 16, 145–155. [Google Scholar] [CrossRef]
- Yang, X.; Yao, W.; Shi, H.; Liu, H.; Li, Y.; Gao, Y.; Liu, R.; Xu, L. Paeoniflorin protects Schwann cells against high glucose induced oxidative injury by activating Nrf2/ARE pathway and inhibiting apoptosis. J. Ethnopharmacol. 2016, 185, 361–369. [Google Scholar] [CrossRef]
- Ndisang, J.F. Synergistic Interaction Between Heme Oxygenase (HO) and Nuclear-Factor E2- Related Factor-2 (Nrf2) against Oxidative Stress in Cardiovascular Related Diseases. Curr. Pharm. Des. 2017, 23, 1465–1470. [Google Scholar] [CrossRef]
- Motohashi, H.; Yamamoto, M. Nrf2-Keap1 defines a physiologically important stress response mechanism. Trends Mol. Med. 2004, 10, 549–557. [Google Scholar] [CrossRef]
- Jaiswal, A.K. Nrf2 signaling in coordinated activation of antioxidant gene expression. Free Radic. Biol. Med. 2004, 36, 1199–1207. [Google Scholar] [CrossRef]
- Sun, W.; Meng, J.; Wang, Z.; Yuan, T.; Qian, H.; Chen, W.; Tong, J.; Xie, Y.; Zhang, Y.; Zhao, J.; et al. Proanthocyanidins Attenuation of H2O2-Induced Oxidative Damage in Tendon-Derived Stem Cells via Upregulating Nrf-2 Signaling Pathway. Biomed. Res. Int. 2017, 2017, 7529104. [Google Scholar] [CrossRef] [PubMed]
- Zeng, C.; Zhong, P.; Zhao, Y.; Kanchana, K.; Zhang, Y.; Khan, Z.A.; Chakrabarti, S.; Wu, L.; Wang, J.; Liang, G. Curcumin protects hearts from FFA-induced injury by activating Nrf2 and inactivating NF-κB both in vitro and in vivo. J. Mol. Cell. Cardiol. 2015, 79, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Lu, C.; Xu, W.; Zhang, F.; Shao, J.; Zheng, S. Nrf2 Knockdown Disrupts the Protective Effect of Curcumin on Alcohol-Induced Hepatocyte Necroptosis. Mol. Pharm. 2016, 13, 4043–4053. [Google Scholar] [CrossRef] [PubMed]
- Kwan, S.T.C.; King, J.H.; Yan, J.; Wang, Z.; Jiang, X.; Hutzler, J.S.; Klein, H.R.; Brenna, J.T.; Roberson, M.S.; Caudill, M.A. Maternal Choline Supplementation Modulates Placental Nutrient Transport and Metabolism in Late Gestation of Mouse Pregnancy. J. Nutr. 2017, 147, 2083–2092. [Google Scholar] [CrossRef] [PubMed]
- Rosario, F.J.; Kanai, Y.; Powell, T.L.; Jansson, T. Mammalian target of rapamycin signalling modulates amino acid uptake by regulating transporter cell surface abundance in primary human trophoblast cells. J. Physiol. 2013, 591, 609–625. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Yi, X.; Su, X.; Jian, Z.; Cui, T.; Guo, S.; Gao, T.; Li, C.; Li, S.; Xiao, Q. Ginkgo biloba extract protects human melanocytes from H2O2-induced oxidative stress by activating Nrf2. J. Cell. Mol. Med. 2019, 23, 5193–5199. [Google Scholar] [CrossRef]








| Genes (GenBank) | Primer Sequences (5’-3’) | Product Size (bp) |
|---|---|---|
| Nrf2 | F: CTTGGCCTCAGTGATTCTGAAGTG | 124 |
| (NM_006164.5) | R: CCTGAGATGGTGACAAGGGTTGTA | |
| HO-1 | F: CAGGAGCTGCTGACCCATGA | 195 |
| (NM_002133.3) | R: AGCAACTGTCGCCACCAGAA | |
| GCLC | F: GAAGTGGATGTGGACACCAGATG | 128 |
| (NM_001498.4) | R: TTGTAGTCAGGATGGTTTGCGATAA | |
| GCLM | F: GGAGTTCCCAAATCAACCCAGA | 71 |
| (NM_002061.4) | R: TGCATGAGATACAGTGCATTCCAA | |
| NQO1 | F: GGATTGGACCGAGCTGGAA | 140 |
| (NM_000903.3) | R: AATTGCAGTGAAGATGAAGGCAAC | |
| Bcl-2 | F: ATAACGGAGGCTGGGTAGGT | 127 |
| (NM_000657.2) | R: TTTATTTCGCCGGCTCCACA | |
| Bax | F: GCCCTTTTGCTTCAGGGGATG | 76 |
| (NM_138763.4) | R: CAGCTGCCACTCGGAAAAAG | |
| SLC2A1 | F: TGAGCATCGTGGCCATCTTT | 298 |
| (NM_006516.3) | R: CCGGAAGCGATCTCATCGAA | |
| SLC2A3(NM_006931.3) | F: GCACATAGCTATCAAGTGTGCTT R: CCTGCCTTACTGCCAACCTA | 97 |
| GAPDH | F: GACAGTCAGCCGCATCTTCT | 104 |
| (NM_002046.7) | R: GCGCCCAATACGACCAAATC |
| Name | Primer Sequences (5–3 Orientation) |
|---|---|
| siRNA-Nrf2 | Sense: GGUUGAGACUACCAUGGUUTT Antisense: AACCAUGGUAGUCUCAACCTT |
| siRNA-NC | Sense: UUCUCCGAACGUGUCACGUTT Antisense: ACGUGACACGUUCGGAGAATT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qi, L.; Jiang, J.; Zhang, J.; Zhang, L.; Wang, T. Curcumin Protects Human Trophoblast HTR8/SVneo Cells from H2O2-Induced Oxidative Stress by Activating Nrf2 Signaling Pathway. Antioxidants 2020, 9, 121. https://doi.org/10.3390/antiox9020121
Qi L, Jiang J, Zhang J, Zhang L, Wang T. Curcumin Protects Human Trophoblast HTR8/SVneo Cells from H2O2-Induced Oxidative Stress by Activating Nrf2 Signaling Pathway. Antioxidants. 2020; 9(2):121. https://doi.org/10.3390/antiox9020121
Chicago/Turabian StyleQi, Lina, Jingle Jiang, Jingfei Zhang, Lili Zhang, and Tian Wang. 2020. "Curcumin Protects Human Trophoblast HTR8/SVneo Cells from H2O2-Induced Oxidative Stress by Activating Nrf2 Signaling Pathway" Antioxidants 9, no. 2: 121. https://doi.org/10.3390/antiox9020121
APA StyleQi, L., Jiang, J., Zhang, J., Zhang, L., & Wang, T. (2020). Curcumin Protects Human Trophoblast HTR8/SVneo Cells from H2O2-Induced Oxidative Stress by Activating Nrf2 Signaling Pathway. Antioxidants, 9(2), 121. https://doi.org/10.3390/antiox9020121

