Molecular Technology for Isolation and Characterization of Mitogen-Activated Protein Kinase Kinase 4 from Penaeus monodon, and the Response to Bacterial Infection and Low-Salinity Challenge

Abstract

Mitogen-activated protein kinase kinase 4 (MKK4) is a component of the JNK signaling pathway and plays an important role in immunity and stress resistance. In this study, MKK4 cDNA was cloned, and its bacterial infection and low-salinity challenge responses were researched. The full-length PmMKK4 cDNA was 1582 bp long, with an 858-bp open reading frame (ORF) encoding a 285-amino acid (aa) protein. Results showed that PmMKK-4 was expressed in all examined tissues of P. monodon. The PmMKK4 expression level was found to be lowest in eyestalk ganglion and highest in muscle (approximately 41.25 times than in eyestalk ganglion). Following the infection of Staphylococcus aureus, PmMKK4 was up-regulated in both hepatopancreatic and gill tissues. However, after infection with Vibrio harveyi, PmMKK4 was down-regulated for a period of time in gill tissue, with fluctuating up- and down-regulation in hepatopancreas tissue. Furthermore, after infection with Vibrio anguillarum, gill tissue and hepatopancreas tissue showed a continuous downward trend. The PmMKK4 gene in the gill tissue and hepatopancreas tissue of P. monodon was activated after low-salinity stress. The expression change of PmMKK4 in gill tissue was more significant. The research showed that the PmMKK4 gene plays an important role in both innate immunities after pathogen infection and adaptation in a low-salt environment.

1. Introduction

Mitogen-activated protein kinase kinase 4 (MKK4) is an important regulatory kinase of the JNK signaling pathway. Activation of the JNK signaling pathway is achieved by dual phosphorylation of Thr and Tyr residues of the conserved Thr–Pro–Tyr (T–Y–P) motif [1,2]. MKK4 can alternately activate the two pathways of JNK and p38 [3]. The first successful cloning of the MKK4 gene was in Xenopus laevis, and since then, its role and molecular mechanism functions in both physiological and biochemical areas have been studied more and more deeply. However, the leading research focuses on mammals, such as humans and mice [4,5]. In studies on crustaceans, it was only found in Daphnia pulex, Fenneropenaeus chinensis, Litopenaeus vannamei, and P. monodon [6,7,8]. In a prior study of P. monodon, the expression of MKK4 was only studied in spermatozoa and ovary developmental stages. The MKK4 gene of L. vannamei shows significant changes under the stimulation of various bacteria and is activated by the phosphorylation of upstream genes and then activated JNK, which plays an important role in the antibacterial response [3,9]. The MKK4 gene of Ctenopharyngodon idella is involved in the immune stress response to muramyl dipeptide in the intestinal tissue of C. idella [10].

In order to further improve the molecular function study of the MKK4 gene in P. monodon, this study cloned the entire length of the MKK4 gene in P. monodon, analyzed the expression of MKK4 in various tissues of P. monodon, and explored the effect of different degrees of pathogen stimulation and salinity stress. It is necessary to explore the molecular function and role of MKK4 in low-salinity stress in P. monodon to provide more basic data to determine the molecular mechanism of the response to salinity stress in P. monodon.

2. Materials and Methods

2.1. Experimental Animals and PmMKK4 cDNA Cloning

P. monodon specimens, each with a body length of 7–10 cm and a body weight of 8–12 g, were selected and cultured for 1 week in a 25–28 °C seawater environment with full aeration at the same time. Based on the unpublished transcriptome of P. monodon tissues constructed in our laboratory, specific primers, namely, PmMKK4-F1, PmPKK4-R1, PmMKK4-F2, and PmPKK4-R2 (

Table 1. Sequences of primers used in this study.

Primer	Sequence (5′-3′)	Function
PmMKK4-F1	AATAACGACCGTCCACAGAAC	ORF validation
PmMKK4-R1	AATAACGACCGTCCACAGAAC
PmMKK4-F2	TGCGCTCTCCACAAGTGTCTC
PmMKK4-R2	AAACCTCCTCTTCCAATCTCCC
PmMKK4-5G1	AAGTCAAGGTTGTTCTGTGGACGGTCG	5′ clone
PmMKK4-5G2	CATGCTGAGAGTCCCTGGCCTGG
PmMKK4-3G1	TGGTGCCATATTCAAGGAGGGTGAC	3′ clone
PmMKK4-3G2	GCTCTGTGATTTCGGCATTTCTGGC
UPM Long	CTAATACGACTCACTATAGGGCAAGCAGTG GTATCAACGCAGAGT	Universal primer
UPM Short	CTAATACGACTCACTATAGGGC
NUP	AAGCAGTGGTATCAACGCAGAGT
qMKK4-F	GCCACACTAACAGCACTA	qRT-PCR
qMKK4-R	GTCTACATCCAGCATCTCT
qEF-1α-F	AAGCCAGGTATGGTTGTCAACTTT	Reference gene
qEF-1α-R	CGTGGTGCATCTCCACAGACT
MKK4-f:	TCGCAAGAGCAACACAATC	RNAi
MKK4-r	GAACATCATATCCTCGGGC
dsMKK4-f	TAATACGACTCACTATAGGGTCGCAAGAGCAACACAATC	RNAi
dsMKK4-r	TAATACGACTCACTATAGGGGAACATCATATCCTCGGGC
dsGFP-F	TGGAGTGGTCCCAGTTCTTGTTGA	RNAi
dsGFP-R	GCCATTCTTTGGTTTGTCTCCCAT
qMKK7-F	TAACCTAGAAGAGACCAAGC	qRT-PCR
qMKK7-R	CTGTGACGAAGCATCCTA
qJNK-F	CCGTCCCCGCTACCCTGGCTATTC	qRT-PCR
qJNK-R	AGGTCTCGTGCTTGACTCGCTTTG

), were designed by Primer Premier 5.0 (RuiBiotech, Guangzhou, China). The 5′ and 3′ ends of PmMKK4 were acquired by using the rapid amplification of the cDNA end (RACE) method (Clonetech, Tokyo, Japan). Through the 5′ or 3′ RACE-PCR, PCR was performed initially with PmMKK4-5G1 (PmMKK4-3G1 for 3′) and universal primers UPM Long and UPM Short, followed by semi-nested PCR with PmMKK4-5G2 (PmMKK4-3G2 for 3′) and a nested universal primer NUP (Table 1). The PCR conditions were designed as follows: one cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30 s, 67 °C for 30 s, and 72 °C for 45 s, followed by a final cycle of 72 °C for 10 min. The PCR products were then gel-purified and sequenced, and the sequences were determined after the analysis.

2.2. Bioinformatic Analysis

The ORF Finder (http://www.ncbi.nlm.nih.gov/orffinder/, accessed on 10 May 2021) was used to predict the open reading frame. The transeq in EMBOSS (http://www.bioinformatics.nl/emboss-explorer/, accessed on 10 May 2021) was utilized to translate its amino acid sequence. The predicted amino acid sequence was compared with the protein database by using the BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 20 May 2021) tool in NCBI. Multiple sequence alignments were performed using Clustal X V1.83 software. ExPASy ProtParam (https://web.expasy.org/protparam/, accessed on 20 May 2021) was used to predict the isoelectric point and the theoretical molecular mass. Protein domain analysis was performed using SMART 4.0 (http://smart.embl-heidelberg.de/smart/set_mode.cgi?GENOMIC=1, accessed on 20 May 2021). Glycosylation sites were predicted using the NetNGlyc 1.0 Server (http://www.cbs.dtu.dk/services/NetNGlyc/, accessed on 20 May 2021). Phosphorylation sites were predicted using the NetPhos 3.1 Server (http://www.cbs.dtu.dk/services/NetPhos/, accessed on 20 May 2021). The phylogenetic tree was constructed based on the maximum likelihood method using Clustal X and MEGA 6.0 software.

2.3. Sample Collection and cDNA Synthesis

After 1 week of seawater culturing, healthy male and female P. monodon were randomly selected. Hepatopancreas, gills, intestines, stomach, lymph, heart, muscle, epidermis, eye stalk nerve, cranial nerve, thoracic nerve, ventral nerve, and ovary (testis) tissue were dissected for collection. The same tissue samples from 3 shrimps were mixed into one tube. Furthermore, during summer, the mating season of P. monodon, samples of shrimp larvae at different stages of development were collected. Those samples including zygote, nauplius, zoea, mysis, and postlarval stages. Zygote stage samples were collected immediately after egg laying. When 80% of the population had reached the objective stage according to their morphologies, as observed using an optical microscope, samples of the larvae of different stages were collected. The samples mentioned above were organized into three parallel groups, stored in RNAlater^® RNA stabilization solution (Invitrogen, Carlsbad, CA, USA) at 4 °C overnight, and then stored at −80 °C.

Following the manufacturer’s instructions of Trizol reagent (Invitrogen, USA), the total RNA of all collected samples was extracted. The ratios of ultraviolet absorbance at 260/280 nm were measured using a NanoDrop2000 device (NanoDrop Technologies, Waltham, MA, USA); 1.5% agarose gel electrophoresis was used to ensure the integrity. A template of cDNA was synthesized from the RNA using the PrimeScript II 1st strand cDNA synthesis kit (Takara, Tokyo, Japan). For the sake of real-time quantitative PCR (qRT-PCR), cDNA was synthesized in accordance with the manufacturer’s instructions for the PrimeScript TM RT reagent kit with a gDNA eraser (Perfect Real-time, Takara, Japan) and diluted to 50 ng/μL for use as the template.

2.4. Bacterial Infection Challenge

In total, 200 healthy P. monodon with an average weight of 15–18 g were selected for immune challenge experiments. Three pathogenic bacteria provided by the Key Laboratory of South China Sea Fishery Resources Exploitation and Utilization were used. According to a previous study [11], the culture schedule and injection concentration for each strain were determined. Four experimental groups were included: PBS (shrimp specimen injected with sterile phosphate-buffered saline as control), Staphylococcus aureus, Vibrio harveyi, and Vibrio anguillarum groups. Each group of 50 shrimp specimens was injected into the second abdominal segment with 100 μL of sterile phosphate-buffered saline (PBS, pH 7.4) or 100 μL (1.0 × 10⁸ cfu/mL) of S. aureus, Vibrio harveyi, and V. anguillarum, respectively. Healthy and intact shrimp were randomly selected at 0 h, 3 h, 6 h, 12 h, 24 h, 48 h, and 72 h after injection for the dissection of hepatopancreas and gill tissues. Hepatopancreas and gill tissues were stored overnight in RNAlater solution at 4 °C and then kept at −80 °C.

2.5. Low-Salinity Stress

The experiment site of the low-salt stress test was in the South China Sea Fisheries Research Institute (Shenzhen City, Guangdong Province, China). A total of 360 shrimps (7–10 cm) was selected for these experiments. The salinity concentration was adjusted to the target salinity by mixing the cultured seawater with freshwater using a salinity meter (AZ8371, Hengxin, Taiwan). According to the pre-test results, the 96 h half-lethal salinity was 3 psu [12]. Therefore, the stress salinity was set to 3 psu. Another experimental group with salinity of 17 psu was set up, and conventional aquaculture seawater (about 25 psu) was used as the control group [13]. Three parallel groups (n = 40/group) were created. The incubation temperature and pH were maintained at 25–28 °C and 7.0 ± 0.5, respectively, and 0 h, 3 h, 6 h, 12 h, 24 h, 48 h, 72 h, and 96 h after exposure to different salinity stresses, shrimp specimens with optimal activity during the intermolt were selected for dissection to collect gills and hepatopancreas tissues, and they were preserved in RNAlater solution. The tissues were then maintained at −80 °C after overnight storage at 4 °C.

2.6. qRT-PCR Analysis of PmMKK4 mRNA Expression

In this study, qRT-PCR was used to detect PmMKK4 mRNA expression in different tissues at different developmental stages following bacterial challenge and low-salinity stress exposure. Since the reaction component and cycle condition for EF1a are consistent with PmMKK, the reference gene was chosen to be 1α (EF1a) (Table 1). The solution in each hole (12.5 μL) was a mixture of 6.25 μL of 2 × TB GreenTM Premix ExTaq (Takara, Beijing, China), 0.5 μL each of PmMKK4-qF and PmMKK4-qR (50 μmol/L), 1 μL qRT-PCR diluted cDNA, and 4.25 μL double-distilled water. Green fluorescence measurement qRT-PCR was carried out in the quantitative real-time PCR system, Roche Light Cycler^® 480II. The following four steps were conducted: degeneration for 30 s at 95 °C, a quantitative analysis stage with 40 cycles of 94 °C for 5 s and 60 °C for 30 s, dissolution curve analysis for 5 s at 95 °C and 60 °C and up to 95 °C for 1 min, and an according stage of 30 s at 50 °C. The relative CT method (2^−ΔΔCT) was used to obtain the PCR data. One-way ANOVA was used to work on statistical analysis. SPSS statistics version 23.0 software (IBM, Armonk, New York, USA) was used to carry out the Tukey’s multiple range test. The differences were considered to be significant at p < 0.05. Tested data were presented as mean ± SD (standard deviation).

2.7. Low-Salinity Stress Testing in P. monodon following RNA Interference (RNAi)-Mediated Knockdown of PmMKK4

Primer Premier 5.0 was used to design the following primers: dsMKK-f, dsMKK-r, dsMKK-T7-f, and dsMKK-T7-r (Table 1). A DNA fragment containing the T7 promoter was amplified by Ex Taq using normal cDNA as a template. PCR conditions were as follows: 3 min at 94 °C, 35 cycles of 30 s at 94 °C, 30 s at 58 °C, 1 min at 72 °C, and a final cycle of 10 min at 72 °C. Excess bands were clipped after agarose gel electrophoresis, leaving clear and bright bands. DNA fragments were recovered according to the gel recovery kit instructions. dsRNA synthesis was performed according to the T7 RiboMAXTMExpress RNAi System kit instructions. Reaction system: RiboMAXTM Express T7 2X Buffer 10.0 μL, linear DNA template (total 1 μg) 1.0–8.0 μL, Nuclease-Free Water 0–7.0 μL (8 μL-DNA volume), Enzyme Mix-T7 Express 2.0 μL. A final volume of 20.0 μL was incubated at 37 °C for 30 min to obtain single-stranded RNA (ssRNA). Then, equal volumes of complementary ssRNA were mixed and incubated at 70 °C for 10 min, 65 °C for 10 min, and 25 °C for 10 min. Then, 2.0 μL of freshly diluted RNase solution (1 μL RNase solution: 199 μL Nuclease-Free Water) and 2.0 μL RQ1 RNase-Free DNase was added and incubated at 37 °C for 30 min. The obtained dsRNA was purified for later use. dsGFP-F/R primers and pD-GFP recombinant vectors were used to synthesize green fluorescent protein (GFP) double-stranded RNA in the same way.

The weight of P. monodon was 5.0 ± 1.0 g, and the dsRNA injection volume was 3–5 μg/g shrimp. Each shrimp was injected intramuscularly in the second abdominal segment. The injection experiments were divided into three groups: PBS group, dsGFP group, and dsMKK group. Before injection, samples of healthy shrimp in the intermolt phase were randomly collected, and their gill tissues were placed in RNAlater as a 0 h sample to check the RNAi efficiency. Twenty-four hours after injection, the three groups of shrimp specimens were transferred to plastic buckets adjusted to salinity of 3 psu. The dead shrimps of each group were collected and recorded every 3 h.

After 3 h, 6 h, 9 h, 12 h, 24 h, 48 h, 72 h, and 96 h exposure to salt stress, healthy shrimp specimens were collected from each treatment group, and their gill tissues were dissected and placed in RNAlater. Furthermore, 10 shrimp injected with dsGFP and dsMKK, respectively, were placed in two separate plastic buckets filled with seawater (about 25 psu). After 24 and 48 h, gill tissues were randomly collected and placed in RNAlater as samples to measure dsRNA interference efficiency. All RNA samples were mixed in RNAlater and stored at 4 °C overnight, then kept at −80 °C.

3. Results

3.1. PmMKK4 Sequence Analysis

The mitogen-activated protein kinase kinase 4 (PmMKK4) cDNA of P. monodon was obtained by cloning. The full-length was 1582 bp, the GenBank accession number: MN909956, and the 5′ and 3′ non-coding regions (UTRs) were 567 bp and 157 bp, respectively; the open reading frame (ORF) was 858 bp long and encoded 285 amino acids (Figure 1). ExPASy ProtParam predicted a molecular weight of 32.87 kD and a theoretical isoelectric point of 6.46. It was predicted that PmMKK4 would have a total of 22 phosphorylation sites, including 15 serine sites, 4 threonine sites, and 3 tyrosine sites. In addition, the predicted results showed that PmMKK4 had no glycosylation site, no signal peptide, and no transmembrane structure. PmMKK4 contained a conserved serine/threonine protein kinase (S–I–A–K–T) region, which is a characteristic kinase domain for MKKK phosphorylation.

3.2. Sequence Alignment and Analysis

Using NCBI BLASTP to compare the identity of the MKK4 gene between P. monodon and other species, the results showed that the PmMKK4 gene had the highest similarity with P. chinensis and P. vannamei (Figure 2), both of which were 99.65%, which were similar to Armadillidium vulgare, Ooceraea biroi, Harpegnathos saltator, Solenopsis invicta, Nylanderia fulva, Camponotus floridanus, and Formica exsecta, with a similarity of 82.39%, 82.08%, 81.49%, 81.36%, 81.49%, 82.08%, and 81.36%, respectively. Using MEGA6.06 software, the phylogenetic tree of PmMKK4 and other species was constructed based on the NJ (neighbor-joining) method, and the Bootstrap method was repeated 1000 times (Figure 3). It can be seen from Figure 3 that the MKK4 gene of P. monodon had the closest genetic relationship with P. vannamei and P. chinensis and was firstly clustered into one branch.

3.3. Tissue Expression Analysis of PmMKK4

Using real-time quantitative PCR technology, the expression differences of the PmMKK4 gene in different tissues of P. monodon were explored. The results showed that the PmMKK4 gene was expressed in all the tested tissues. Among them, the expression level was the highest in muscle tissue, and the lowest expression level occurred in the eye stalk nerve. The expression level in muscle was 41.25 times of that in the eye stalk nerve. Secondly, the expression was also higher in the thoracic nerve, intestine, epidermis, heart, gill, and lymphoid tissues, which was higher than that in other tested tissues (Figure 4).

3.4. Expression Analysis of PmMKK4 under Bacterial Stimulation

In gill tissues, the expression of PmMKK4 showed different changes after injection of PBS, S. aureus, Vibrio harveyi, and V. anguillarum (Figure 5A). Taking the PBS group as the control, the S. aureus infection group was significantly up-regulated at 6 h and 24 h and reached the highest value at 24 h, which was 2.42 times that of the PBS group at this time, and there was a significant difference (p < 0.05). Significant down-regulation occurred at 48h, and there was no significant difference between the rest of the time and the PBS group. The group infected with Vibrio harveyi showed down-regulation from 12 h and returned to normal level at 72 h. In the group infected with V. anguillarum, the expression level remained down-regulated from 6 h, which was significantly different from that in the control group (p < 0.05).

In the hepatopancreas tissue, each experimental group showed different trends (Figure 5). Taking the PBS group as the control, after infection with S. aureus, except for 12 h, it maintained an upward trend, and there was a very significant difference at 3 h and 48 h. Compared with the control group, the V. harveyi infection group fluctuated; it was up-regulated at 3 h and 48 h and down-regulated at 12 h, 24 h, and 72 h (p < 0.05). There was no significant change within 9 h after infection with V. anguillarum, and it was down-regulated from 12 h.

3.5. Expression Analysis of PmMKK4 under Low Salt Stress

The overall expression level of PmMKK4 after low-salt stress showed that gill tissue was more sensitive to low-salt stress than hepatopancreas tissue. In the gill tissue (Figure 6A), the overall change trend of salinity, which dropped sharply to 17 groups, was a very significant up-regulation and then turned to a significant up-regulation, which remained up-regulated except for 72 h. PmMKK4 was up-regulated within 96 h after salinity suddenly dropped to the three groups, and the difference was extremely significant at 12 h, 24 h, and 72 h. In the hepatopancreas tissue (Figure 6B), the salinity 7 group was significantly up-regulated at 3 h, 12 h, and 72 h, and there was no significant difference between the expression levels at other time points and the control group. The salinity 3 groups were significantly up-regulated at 12 h and 96 h, and there was no significant difference at other time points.

3.6. Expression Analysis after PmMKK4 Interference

According to the quantitative results of whole tissue expression, the expression of PmMKK4 was the highest in muscle, so after the RNA interference test, muscle tissue was selected for subsequent quantitative research. Quantitative detection of the PmMKK4 gene was performed at 24 h, 48 h, and 72 h after RNA interference to verify the interference efficiency. Taking the non-injected group as the control, as shown in Figure 7, the expression of PmMKK4 in the dsMKK4 group was only 35.7% of that in the non-injected group at 24 h after injection. At 48 h, the expression level of the injected dsMKK4 group was 54.1% of that of the non-injected group, and at 72 h, the expression level of the injected dsMKK4 group was 16.9% of that of the non-injected group, indicating that the interference efficiency of dsPmMKK4 was obvious, and the interference was effective during the experiment. The mortality rate of each group in the RNAi experiment at each time point after low salt stress is shown in Figure 8. The mortality rate of the dsPmMKK4 injection group was always higher than that of the other three groups. At 18 h, the mortality rate started to exceed 20%, and the final mortality rate was 25.58%. The lowest mortality rate was in the PBS injection group, with a final mortality rate of 13.04%. The three experimental groups under low-salt stress had more death in the first 24 h, and less death after that.

Figure 9 shows the expression levels of PmMKK7 and PmJNK in the muscles under acute low-salt stress after the injection of dsPmMKK4. Taking the PBS injection group as the control, the expression of the MKK7 gene in P. monodon showed a significant upward-regulated trend as a whole, except for 3 h and 24 h, and the expression was significantly up-regulated at other time points. The expression level of PmJNK fluctuated throughout the experiment. After acute low-salt stress, the dsMKK4 group first increased at 3 h, then decreased at 6 h, then increased expression, down-regulated at 24 h, and then continued to increase until the end of the experiment.

4. Discussion

The MKK4 gene of P. monodon was cloned in this study. The results of amino acid sequence analysis showed that PmMKK4 has 22 phosphorylation sites. The phosphate groups can regulate different functions of the protein and may play a synergistic or reverse role in various reactions [14]. Structural prediction indicated that PmMKK4 contains a conserved serine/threonine protein kinase (S–T–T–K–C) region, which is a potential double phosphorylation site. The MKK4 gene has two downstream pathways: the JNK signaling pathway, and the p38 signaling pathway. These two branch pathways play important roles in immunity and anti-stress processes in organisms. Phylogenetic tree analysis showed that the MKK4 gene of P. monodon was most closely related to P. vannamei and P. chinensis, clustered into a clade. The results of multiple sequence alignment showed that PmMKK4 has a high similarity with MKK4 genes of other species, among which the similarity with P. vannamei and P. chinensis was the highest (99.65%), indicating that MKK4 genes were relatively similar among closely related species. It is speculated that its conserved protein kinase domain may play an important role in many aspects such as physiology and biochemistry.

Through quantitative tissue analysis, it was determined that PmMKK4 was expressed in all tested tissues, which is the same as the tissue distribution results of other species. In the detected tissues, the expression level of PmMKK4 in muscle was the highest, which was significantly higher than other tissues. Similarly, in the study of P. chinensis, the expression level of MKK4 in muscle tissue was also significantly higher than that in other tissues [7], suggesting that muscle may be an important tissue for the function of the MKK4 gene. In addition to muscle, PmMKK4 was also highly expressed in tissues such as intestine, heart, gill, and lymph. Intestine and lymph were important immune tissues, and gills were important tissues for crustaceans to exchange ions with the environment and regulate osmotic pressure. Therefore, it was speculated that PmMKK4 plays an important role in the immune and salinity stress responses of P. monodon.

In order to explore the role of the PmMKK4 gene in the innate immunity of P. monodon, we carried out pathogen infection experiments. Although the expression of PmMKK4 was the highest in muscle, considering that it had been widely accepted that gill and hepatopancreas were important immune organs in previous studies, while muscle and nerve were rarely considered immune-related tissues, we chose gill and hepatopancreas. Tissue responses to bacterial stimulation were studied. The experimental results showed that PmMKK4 was up-regulated in hepatopancreas and gill tissues after infection with S. aureus, which is similar to the MKK4 gene in L. vannamei in response to S. aureus [3]. After infection with Vibrio harveyi, PmMKK4 was down-regulated for a period of time in gill tissue, while fluctuating between up- and down-regulation in hepatopancreas tissue. After P. monodon was infected with Vibrio harveyi, the expression levels of three related genes in the JNK pathway were significantly reduced, indicating that some effector molecules of the JNK signaling pathway may be involved in the process of immune regulation, which is consistent with the research results of Shi et al. [15]. After infection with V. anguillarum, gill tissue and hepatopancreas tissue showed a continuous downward trend. However, the MKK4 gene was significantly up-regulated after L. vannamei infection with the Gram-negative bacteria Vibrio parahaemolyticus [3]. The physiological role of the post-MKK4 gene is different, and therefore the response mode is different. In addition, when Pinctada fucata are infested by exogenous pathogens, the expression level of MKK4 gene is significantly changed and phosphorylated, suggesting that it is involved in the self-protection mechanism of Pinctada fucata to defend against the occurrence of diseases [16,17].

Changes in salinity can cause changes in the osmotic pressure and the activities of various non-specific immune enzymes in the shrimp, affecting the immune defense ability of the shrimp. The experimental results of acute low-salt stress in this study showed that the PmMKK4 gene in the gill tissue and hepatopancreas tissue of P. monodon was activated after stress, resulting in different degrees of up-regulation. Among them, the expression change of PmMKK4 in gill tissue was more significant. It can be speculated that under low salt stress, the gill tissue undertakes more physiological and biochemical reactions related to the MKK4 gene. In the process of ammonia nitrogen stress in P. chinensis, the expression of the MKK4 gene in muscle, hepatopancreas, gill, and other tissues is significantly increased, suggesting that the MKK4 gene is involved in the stress resistance process of P. chinensis. MKK4 can activate downstream JNK signaling pathway. Studies have confirmed that the JNK branch pathway plays an important role in the salinity adaptation process of aquatic animals. Under salinity stress, the expression of MAPK 8 (JNK1) and MAPK 9 (JNK 2) was significantly up-regulated [18,19,20]. To further explore the role of the PmMKK4 gene in low-salt stress, we performed double-stranded RNA injection experiments. In a low-salt environment, the mortality rate after knocking down the PmMKK4 gene increased rapidly in a short period of time, while the mortality rates of the other two groups were lower. It is speculated that the low expression of the MKK4 gene reduces the adaptability of P. monodon to the low-salt environment and causes more deaths. The PmMKK4 gene may play an important role in adaptation to the low-salt environment. After the interference, we further conducted a quantitative study on other genes in the JNK signaling pathway. The results showed that the expression of the MKK7 gene in P. monodon showed a significant upward trend as a whole, while the expression of PmJNK fluctuated in the early stage and stably increased in the later stage. It is speculated that the JNK signaling pathway is further activated under low-salt stress, and the PmMKK7 gene maintains high expression, while the PmMKK4 gene is expressed less to ensure the stable functioning of the JNK signaling pathway.

5. Conclusions

In conclusion, in this study, we cloned the PmMKK4 gene sequence of P. monodon, which was ubiquitously expressed in all tissues of P. monodon and play an important role in the innate immunity after pathogen infection and the adaptation process in low-salt environments. The role of the mitogen-activated protein kinase signaling pathway in the process of low-salt stress and the immune response in P. monodon was provided.