Molecular Characterization of the Actin Gene and 5′ Flanking Sequence from Brown Macroalga Saccharina japonica (Laminariales, Phaeophyta)

Abstract

The brown macroalga Saccharina japonica (Laminariales, Phaeophyta) is the most productive cultured seaweed in the world. In order to improve the biosafety of transgenic kelp, it is necessary to develop endogenous constitutive promoters, replacing those of virus origin. In this study, the housekeeping actin gene from S. japonica (SjACT) was found to contain three exons and two introns, representing a unique actin gene structure pattern in brown algae. Additionally, the 5′ upstream region was obtained using genome walking, and fused to the reporter gene lacZ or EGFP to construct promoter-detective vectors. Using an established genetic transformation system, kelps in different life-cycle stages were transformed. The detection results showed that, in the diploid sporophyte stage, the transient expression from the lacZ gene could be observed in the frond, stipe, or holdfast of kelps, indicating a manner of being non-tissue-specific. And, in the haploid gametophyte stage of S. japonica, the fluorescence of the expressed EGFP were detected in vivo in gametophyte cells of both genders. These results indicate that the promoter of the SjACT gene (pSjACT) functions in a constitutive manner and is expected to be a key endogenous element in the genetic manipulation of kelps.

1. Introduction

Seaweeds, or marine macroalgae, are key components of a variety of marine habitats, growing mainly in intertidal and subtidal zones. Several species belonging to brown, red, or green macroalgae are cultivated primarily for use as healthy food, and feedstock for polysaccharides or pharmaceuticals [1,2]. Among them, brown macroalga Saccharina japonica (Laminariales, Phaeophyta) is one of the highly productive cultured seaweed in the world, providing the main raw material for the extraction of the important chemical alginate and its derivatives [3]. Due to the economic importance of kelps, molecular biotechnology is considered an essential tool for studying foundational biology and creating new strains with desirable traits. Based on the life history of S. japonica characterized as the heteromorphic alternation of generations, a genetic transformation model was established to introduce foreign DNA into haploid gametophytes and detect the stable expression in diploid sporophytes [4,5]. However, despite an increase in genomic data from S. japonica [6,7,8], the application of native promoters in kelps has not been reported, and the promoters currently used are mainly from higher plant or animal viruses. In order to prevent biosafety risks that may be caused by the environmental release of the transformants, the stable expression of medical proteins in S. japonica was limited to gametophytes which were proliferated in the photobioreactor [9], or to sporophyte seedlings cultured in safety containers at sea [5]. These measures based on safety considerations will eliminate the advantage of choosing high-yielding kelp as a host for recombinant protein expression and production. Therefore, it is necessary that we develop endogenous constitutive promoters from kelps to improve the biosafety of transgenic seaweed and generate a strong expression efficiency for the introduced genes.

Actin is a prevalent and essential cytoskeletal protein in eukaryotic cells, which plays fundamental roles in facilitating cell motility, regulating cell division, shaping cell morphology, and driving cytoplasmic streaming [10]. In higher plants, actin-encoding genes usually exist in a form of a complex gene family with multiple copies, and the 5′ flanking region from the native actin gene has been widely shown to be more active than the exogenous CaMV35S promoter from plant viruses [11,12]. By contrast, the copy number of the actin gene is low in algae [13]; for instance, a single copy was detected in most diatoms and several tested species of green algae [14,15,16,17], and either a single copy or low multiple copies were found in red algae [18,19]. Considering that the life history of multicellular algae often has multiple generations that can live independently, this suggests that the actin gene promoter is likely to be constitutive and highly active. The tests for the actin gene promoter, which was used as a native element, have been conducted in several algae, indicating that it could drive the successful expression of foreign genes, or to facilitate the survival of positive transformants under pressure by selective reagents [20,21,22,23,24]. However, for multicellular seaweeds, it is still unknown whether the promoter of the actin gene can function at different stages of the life cycle.

In brown algae, the functional verification and characterization for endogenous promoters has not been explored. In this study, both the actin-encoding gene and the 5′ upstream region from S. japonica was cloned for molecular characterization. Additionally, the transient expression system for S. japonica was utilized to verify the promoter function of this region, and the promoter activity was investigated in different tissues and life cycle stages.

2. Materials and Methods

2.1. Kelp and Conditions for Culture

The filamentous gametophyte strains of Saccharina japonica, including L003♀, L007♂, and L026♂, were kelp germplasm which were collected, isolated, and preserved in our laboratory. Strains LDF01♀ and LDF01♂ were kindly provided by Mrs. Xiaojie Li from Shandong Oriental Ocean Co., Ltd. (Yantai, China). To maintain vegetative growth without reproduction, gametophyte cells were cultured at 10.0 ± 0.5 °C in N/P-enriched seawater medium (1.5 mM NaNO₃, 0.17 mM NaH₂PO₄), and the 10 h (light): 14 h (dark) photoperiod was setup with the light irradiance of about 50 µmol photons m⁻² s⁻¹ [25]. The culture medium was completely replaced weekly.

Different tissues from young and adult sporophytes of S. japonica were tested for genetic transformation. Young sporophytes were prepared following a protocol described previously [4]. Using sterilized slides, clusters of filamentous gametophyte clones were gently ground and broken into short algal filaments. Utilizing a hemocytometer for enumeration, roughly 1.0 × 10⁶ cells from either female or male gametophytes were combined in seawater medium (comprising 0.286 mM NaNO₃, 0.015 mM KH₂PO₄, 0.002 mM iron citrate, and 0.5 μg/L vitamin B₁₂). The process of sexual reproduction was induced at 10.0 ± 0.5 °C, coupled with an increased light intensity of 100 µmol photons m⁻² s⁻¹ and a 12 h (light): 12 h (dark) photoperiod. Subsequently, the emerging sporophyte seedlings were moved to culture conditions identical to those used for the vegetative growth phase of the gametophytes. Adult sporophytes of S. japonica were purchased from Qingdao aquatic product market, and sporophytes of Undaria pinnatifida (Harvey) Suringar (Laminariales, Phaeophyta) were sampled from Taiping Bay of Qingdao in April.

2.2. Characterization of SjACT Gene and Phylogenetic Analysis

Genomic DNA of S. japonica gametophyte was extracted with a Plant Genome DNA Extraction Kit (Tiangen, Beijing, China). Based on the nucleotide sequence alignment of annotated actin genes from various brown algae in GenBank, including Costaria costata (X59937), Lessonia nigrescens (AY823935), Scytosiphon lomentaria (AY823934), Fucus disticus (U11697), and Fucus vesiculosus (X98885), a set of primers actin1~7 were designed and synthesized (Sangon Biotech Co., Ltd., Shanghai, China) (

Table 1. Information of primers.

Purposes	Primers	Sequences (5′-3′)
Genomic DNA	act1	CCTATCGCACCGTCTTGGTTGGAG
	act2	ACAATCGTAAATGATCTTGCTCCA
	act3	TCCTTGTTCGCCTTGGGGTTGAGG
	act4	AGAACCCTCTAGCTCCCTTTAG
	act5	ATGGCGGACGAGGATGTACAA
	act6	GTCGGCATGGACCAGAAGGA
	act7	TCACGCTTAGAAGCACTTGCGG
cDNA fragment	act8	GAACCCCCCACAGCTACACTC
	act9	ATGAGCGACTCATCCTCGCAC
5′-genome walking	SP1	AGCGCACCCAACTCTCGTGAGTAC
	SP2	CAAAGGACTCACCATGATTCCGG
	SP3	CGTTGTCCACCACCAAGGCTTGTA
Vector	lacZ-5′-Nhe I	gtgagctagcCGAACGCATCAAAATTCC 1
	lacZ-3′-Bgl II	gaagatctGATAAAAAGAGAGTGTAGCT
	EGFP-5′-Xho I	ccgctcgagTCGAACGCATCAAAATTCC
	EGFP-3′-BamH I	cgggatccGATAAAAAGAGAGTGTAGCT

¹ The underlined letters indicated the recognition sites of restriction endonuclease flanked by protected bases in lowercase letters.

). Using different primer pairs and the genomic DNA as templates, polymerase chain reaction (PCR) was carried out to amplify fragments of actin gene of S. japonica (SjACT), with a thermocycler (T-Gradient, Biometra, Göttingen, Germany). The protocol for the amplification process involved an initial denaturation step at 94 °C for a duration of 5 min, followed by 35 repeated cycles, each consisting of denaturation at 94 °C for 60 s, annealing at 58 °C for 30 s, and extension at 72 °C for 1 min, concluding with a final extension phase at 72 °C for 10 min. PCR-generated fragments were inserted separately into a pMD18-T vector (TaKaRa, Dalian, China) for subsequent sequencing (Sangon Biotech Co., Ltd., Shanghai, China) using the chain termination method, and overlapped fragments were used for the assembly of genomic SjACT gene.

Total RNA was extracted from gametophytes of S. japonica following the guidelines provided by the pBIOZOL Reagent (Bioflux, Beijing, China). The assessment of RNA purity and concentration was performed using a NanoDrop2000 (Thermo Fisher Scientific, Waltham, MA, USA). Furthermore, the confirmation of RNA integrity was achieved through electrophoresis in 1% (w/v) agarose gel. Following the manufacturer’s instructions, the synthesis of cDNA was performed with a PrimeScript^TM II 1st Strand cDNA Synthesis Kit (TaKaRa, Dalian, China). To amplify the cDNA fragments of SjACT including the full length of coding sequences (CDSs), primers actin8~9 were designed for PCR following the same protocol described previously (Table 1). Finally, the structural analysis of the SjACT gene was conducted by comparing the SjACT cDNA sequence with its corresponding genomic sequence using the BLASTN tool available on the NCBI website (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 6 December 2023). Subsequently, the structure was graphically represented with the aid of IBS 1.0, a platform accessible through the BioCuckoo network (http://ibs.biocuckoo.org, accessed on 6 December 2023).

A phylogenetic examination was conducted using the CDSs derived from actin genes of plants, which included the SjACT gene and reference sequences obtained from various sources such as other seaweeds, microalgae, liverwort, and higher plants. The construction of a Maximum Likelihood (ML)-based phylogenetic tree was facilitated through the use of the G + I model within the MEGA 6.0 software [26]. Additionally, the reliability of each branch in the tree was ascertained by performing 1000 iterations of bootstrapping.

2.3. Isolation of the 5′ Upstream Region of SjACT Gene and Analysis for Regulatory Elements

To obtain the genomic 5′ upstream sequence of SjACT gene, a set of three specific primers, namely, SP1, SP2, and SP3 (Table 1), were used with a Genome Walking Kit (TaKaRa, Dalian, China). The resulting DNA fragments were then inserted into pMD18-T vectors to facilitate sequencing. Subsequently, the analysis for potential regulatory elements was conducted using the PlantCARE tool (http://bioinformatics.psb.ugent.be/webtools/plantcare/html, accessed on 21 April 2023) [27].

2.4. Vector Constructions

Two commercial plasmids, pβ-gal-Basic and pEGFP-1 (TaKaRa Bio USA, Inc., San Jose, CA, USA), were selected as backbone vectors to construct promoter-detective vectors, since both plasmids have a multiple cloning site (MCS) region just in front of the reporter gene lacZ or EGFP, respectively. Based on the determined sequence of 5′ flanking region of SjACT gene, specific primers were designed and synthesized with recognition sites of restriction endonuclease added to the 5′ ends of primers (Table 1). After PCR amplification with primer pairs lacZ-5′-Nhe I/lacZ-3′-Bgl II, both products and the pβ-gal-Basic plasmid were subjected to double restriction endonuclease digestion, respectively, with Nhe I and Bgl II, and then the main residual fragments from each reaction were recovered and linked by T4 DNA Ligase to construct the pActin-βGal vector. Similarly, the pActin-EGFP vector was generated by inserting the 5′ flanking region of SjACT gene into the pEGFP-1 plasmid through double restriction endonuclease digestion with Xho I and BamH I. The T4 DNA Ligase and restriction endonucleases were all products of TaKaRa (Dalian, China), and the Kits for Plasmid Extraction and Agarose Gel DNA Recovery were purchased from Tiangen (Beijing, China).

2.5. Biolistic Transformation

The genetic transformation to both sporophytes and gametophytes of kelps was conducted with a Biolistic PDS-1000/He Particle Delivery System (Bio-Rad Laboratories, Hercules, CA, USA). Before the bombardment to sporophytes with pActin-βGal, healthy fronds of S. japonica and U. pinnatifida were washed with autoclaved seawater to remove any contamination, and then were cut into smaller tissue pieces with a sterilized blade and placed in the center of the Petri dish to form circular areas less than 2 cm in diameter. The preparation of golden particles (1.0 μm in diameter) and operation of instrument were all based on the manufactory’s instruction, and approximately 1.0 μg plasmid DNA was used for each bombardment. Different parts or tissues of kelp sporophyte fronds, including the blade, stipe, and holdfast, were tested for their ability to recognize the promoter of SjACT gene and initiate transcription. All treated groups were repeated in triplicate, with those bombarded with pSV-β-Galactosidase Control (Promega, Madison, WI, USA) as positive controls, and those transformed with naked DNA particles as negative controls. For bombardments to microscopic gametophytes of S. japonica L003♀ or L007♂ with pActin-EGFP, whole procedures including the preparation of target cells and operation parameters followed a previous description [4].

2.6. Detection for Transient Expression

Following the transformation process, all bombarded samples were recovered in dark for a period of 8 h before being transferred to normal culture conditions. All detections for transient expression of reporter gene lacZ or EGFP were carried out 48 h after transformation. In situ histochemical staining was performed according to the described method to detect the transient expression of β-galactosidase (LacZ), which was the product of introduced lacZ gene [4]. The compound 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal), which is known to turn blue upon interaction with β-galactosidase, was produced from BBI Life Sciences Corp. (Shanghai, China). The process of cleaning, fixation, histochemical staining, and observation of algal materials were carried out following a detailed protocol previously described [4]. The images captured under the microscope were obtained with a CCD camera (Scope Tek MDC200, Mingshi, Ningbo, China), and processed with the ScopePhoto 3.0 software. To detect the transient expression of EGFP gene in kelp gametophyte cells, a Confocal Microscope (ZEISS LSM 900, Munich, Germany) was applied to identify the fluorescent signals.

3. Results

3.1. Isolation and Phylogenetic Analysis of the SjACT Gene

Using the genomic DNA of S. japonica gametophyte L003♀ as the PCR template, a series of homologous products were obtained with primers actin1~7 (Table 1) which generated a single genomic fragment after the analysis of overlapped sequences (GenBank accession No.: PP502934). In addition, the full length of the cDNA of the SjACT gene (GenBank accession No.: PP502932) was amplified utilizing the primers actin8~9, which contained the complete 1131 bp of the coding sequence (CDS). In order to elucidate the structure of the SjACT gene, both the CDS sequence and the assembled genomic fragment mentioned above were subjected to a BLASTN comparison. The results indicated that the genomic DNA sequence of SjACT comprises three exons and two introns (Figure 1). A ML phylogenetic tree was assembled using the full-length CDS of SjACT along with 14 reference sequences from a selection of representative species. As shown in Figure 2, the actin gene sequences of all species are very conserved overall. SjACT was the closest to those actin genes from brown algae Fucus, and then clustered with the actin genes from diatoms, which also belonged to the Stramenopiles with brown algae.

In order to investigate whether such a pattern of actin gene structure is universal in brown algae, all available brown algae genome data for which complete supposed ACTIN genomic sequence can be obtained were used for a comparative analysis of the gene structure. As shown in Figure 3, among all 12 ACTIN genes from 10 species, most of them follow the pattern of three exons and two introns, with the exception of that from Internoretia fryeana, where exon1 and exon2 are directly connected due to the absence of an intron between them.

In addition, the genomic DNA or CDS sequence of the SjACT gene from the other gender or strains of gametophytes were also obtained (GenBank accession No.: DQ272502, DQ192649, PP502931), and were used for a sequence polymorphism analysis together with another reference (FJ375360). The results showed that only three sites of single-nucleotide polymorphism (SNP) were detected in exon2 in the coding region, and all of them were nonsense mutations, indicating that the coding region was under strong selection pressure, while a total of seven SNPs was identified within the intron regions, including six SNPs in intron1 and one SNP in intron2.

3.2. Prediction of Regulatory Elements within the 5′ Upstream Sequence of SjACT Gene

Using universal primers provided by the Genome Walking Kit (TaKaRa, Dalian, China) and specific primers including SP1, SP2, and SP3, an 868 bp of the fragment corresponding to the genomic 5′ flanking region of SjACT gene from L003♀ was obtained (GenBank accession No.: PP502933). The PlantCARE analysis was conducted with this sequence to predict potential functional regulatory elements. As shown in Figure 4, besides the core elements like the TATA-Box and CAAT-Box, additional regulatory elements, especially for phytohormones such as MeJA (TGACG-motif), auxin (TGA-element), and abscisic acid (ABRE); for abiotic stress such as drought (MBS, and DRE-core), anaerobic (ARE), and wound (WUN-motif); and for light (I-box, Sp1, GATA-motif), were also found in this region. The findings imply that the regulation of the SjACT gene expression could be influenced by multiple factors.

3.3. Detection of Promoter Function for the Upstream Sequence of SjACT Gene

Two promoter-detective vectors, pActin-βGal (8.3 kb) and pActin-EGFP (5.0 kb), were constructed. Both harbored the 868 bp of the 5′ flanking region of the SjACT gene to test the potential promoter function, followed by a reporter gene (lacZ in pActin-βGal, and EGFP in pActin-EGFP), respectively. The clones of the two plasmids have been identified by restriction enzyme double digestion and agarose gel electrophoresis. The final selected plasmids have been sequenced for the full length to keep from any mutations especially within the inserted 5′ upstream sequence of the SjACT gene, as well as the reporter gene coding regions.

At 48 h after transformation, the transient expression of the introduced reporter gene lacZ or EGFP was detected, and the results were shown in Figure 5, Figure 6 and Figure 7. In situ histochemical staining was used to evaluate the expression of the lacZ gene in different parts of kelp sporophytes, including the frond, stipe, and holdfast, by observing blue signals generated by lacZ-encoding β-galactosidase on substrate X-gal. For S. japonica (Figure 5), it was found that, in all negative control groups which were bombarded with naked golden particles without the coating of vector DNA, no blue signals were detected in any parts of the plantlet, indicating that no false-positive results existed. In contrast, in all positive control groups which were transformed with the pSV-β-Galactosidase Control vector, the staining results showed that blue signals were detectable in a total of 86.3% of tissue slices, distributed at all three tested parts of kelp (77.8% frond, 100% stipe, and 83.3% holdfast), and golden particles bombarded into the cells were often clearly visible at the sites of blue plaques. Similar results were achieved in treatment groups; from a total of 77.3% of tissue slices, blue signals could be detected in the frond (77.8%), stipe (85.7%), or holdfast (66.7%), usually accompanied by the presence of golden powders. And, in another kelp U. pinnatifida (Figure 6), the staining results were consistent with those in S. japonica, except that the staining signal seemed to be less strong than that in S. japonica. We suggested that this might be due to interspecific differences, as the supposed actin gene promoter sequences in two species were found to be only about 80% identity. These findings indicated that the promoter of the SjACT gene (pSjACT) is not tissue-specific and could be recognized by transcription systems in different brown algae.

The kelp life cycle involves an alternation of generations between the macroscopic and diploid sporophyte stage and the microscopic and haploid gametophyte stage. The gametophyte is in the shape of branched uniseriate filaments, making it easy to observe the expression of the EGFP gene in vivo by a fluorescence microscope. As shown in Figure 7 under an excitation light of 488 nm, it was found that the untransformed gametophyte cells exhibited strong spontaneous red fluorescence which was generated by the chlorophyll background, while those of transformed cells showed obvious yellow-green fluorescence. Additionally, the results were the same in the male and female gametophyte treatment groups, and no significant sex difference was noticed. These results indicate that the 5′ upstream sequence of the SjACT gene can drive the expression of a foreign gene in the sexual gametophyte stage of kelps.

4. Discussion

In this study, the SjACT gene was cloned and a new pattern of gene structure was revealed, which provides new insights into the phylogeny and evolution of plant actin-encoding genes. The Viridiplantae are subdivided into two groups: the Chlorophyta and the Streptophyta. In Streptophyta, which comprises all land plants, the gene structure of ACTIN is very conserved, with a typical pattern consisting of four exons and three introns [13]. This pattern is divergent to a certain extent in Chlorophyta, where the multicellular green algae in Ulva, like Streptophyta, also contains three introns [16,22], whereas, in unicellular green algae including Chlamydomonas reinhardtii and Volvox carteri, the actin genes were interrupted by eight introns [28]. The gene structure divergency was shown to be much more significant in other algae. For instance, diatom actin genes generally contained a small number of introns, ranging from one to two [17], and, in most tested red algae, the introns varied from zero to two [19,29]. In brown algae, only a partial cDNA sequence from C. costata actin gene (GenBank accession No.: X59937) was formally reported, from which at least two introns were suggested according to a comparative analysis with an incomplete genomic fragment (not deposited in GenBank) [30]. In this study, it was proven that the SjACT gene consists of three exons and two introns. Through the mining and analysis of genomic data, it was found that most homologous actin genes in brown algae also follow the same rule, which suggested a special gene structure pattern of the actin gene characterized by the number and position of introns.

The main purpose of this study was to verify the function of the SjACT gene promoter (pSjACT). After the fusion of the 5′ upstream sequence of SjACT gene to a reporter gene (lacZ or EGFP), the constructed promoter-detective vectors were transformed to kelps in different life-cycle stages, using an established genetic transformation system for kelps [4]. The detection results clearly showed that, in the diploid sporophyte stage of the life history, this particular sequence could drive the successful expression of the lacZ reporter gene in the frond, stipe, or holdfast of kelp, in a manner that is non-tissue-specific. Additionally, in the haploid gametophyte stage, the expression of the EGFP gene could be detected in vivo in gametophyte cells of S. japonica, without a remarkable variation between genders. These results indicated that the obtained 5′ upstream sequence of the SjACT gene could function as a typical constitutive promoter in both generation stages of kelps. To our knowledge, this was the first report on the function characterization of an endogenous promoter in kelps.

Actin is a crucial protein that is expressed throughout the entirety of the plant and is involved in a variety of basic cellular processes. However, not every gene copy is constitutively expressed. Undoubtedly, the application of actin gene promoters depends on a clear understanding of their expression characteristics. Studies on the duplication of the actin gene family and the potential function diversification have been intensively investigated in green plants lineage [13,31,32]. It was found that the unicellular green algae Chlamydomonas and Volvox contain a single actin gene [14,15]. In angiosperms, however, there are a dozen or even dozens of actin gene family members which could be phylogenetically separated into two classes. One class is mainly expressed in reproductive organs and the other type in vegetative organs, exhibiting its obvious tissue-specific manner [13]. In contrast, the understanding on the actin gene family in multicellular algae is very limited. Multiple gene copies were identified in some red seaweeds [18,19,33,34], and evidence for both single and multiple copies in green seaweed Ulva were provided [16,35], while, in brown algae, there was only one report in which a single copy was suggested in C. costata [30]. In this study, efforts have also been made to search for actin gene copy numbers in GenBank genomic data from E. siliculosus (CABU00000000.1) and U. pinnatifida (JAJAEI000000000.1) that had been assembled to the chromosome level, and the data from S. japonica (MEHQ00000000.1, JXRI00000000.1) and a dozen of other brown algae assembled to the scaffold level. Only a single actin gene copy can be found in each brown algae species, and we believe this finding could go some way to explaining why the SjACT gene is constitutively expressed throughout the life history of kelps. It should be emphasized that the kelp genetic manipulation model, including newly developed CRISPR-Cas9 genome editing techniques, utilizes the complete life history of kelp [5,36]. Genetic transformation is carried out in the microscopic gametophyte stage, while the target genes are expressed to achieve the desired traits in the macroscopic sporophyte stage, and the screening process for transformants can be performed in either of two stages [9]. Therefore, pSjACT can meet the need for available promoters at both stages in kelps. The study of aquatic organisms has entered the era of omics, and genetic manipulation technology has been widely established in fish, shrimp, shellfish, and algae, which has promoted the verification of gene functions [37,38,39]. Although the techniques have been established earlier in kelps [5], only heterologous promoters have been applied so far, such as the CAMV35S promoter from the cauliflower virus which has been commonly used in higher plants, and the FCP promoter from the diatom Phaeodactyla tricornutum [40]. In particular, the SV40 promoter from the primate virus has repeatedly been shown to achieve a stable expression of the introduced genes in kelps, including the non-chimeric integration and expression of the lacZ gene [4], or a sufficient expression of resistant proteins to allow the transformants to survive the selective pressure of herbicides [9]. Moreover, it has been found to be universally applicable in red or green algae in addition to kelps [41], and we suspect that virus-derived promoters may contain core elements that are efficient and suitable for a wide range of hosts. Compared with heterologous promoters, endogenous, especially constitutive promoter-driven gene transcription might provide a comparable strength of activities [12]. In addition, when it comes to the environmental release of transgenic marine algae, it is clear that the use of endogenous genetic elements, such as pSjACT, will significantly reduce the possible biosafety risks compared with carrying foreign viral fragments [42].

The improvement of algal genetic manipulation technology relies on building a toolkit containing plenty of endogenous regulatory elements for gene expression like promoters, with a clear understanding of their regulatory characteristics [23]. In this sense, the findings in this study are only a small step towards this direction. Although pSjACT was found to drive the constitutive expression of downstream genes throughout the life history of kelps, many elements within the promoter were also predicted to respond to abiotic or biotic induction, suggesting that the regulation of SjACT gene expression could also be influenced by multiple factors. Further research, such as the analysis of potential changes in promoter activity under different environmental conditions or stressors, and possible interactions between regulatory elements, is also undoubtedly highly worthwhile. This will deepen our understanding of this promoter to better serve the optimization of genetic manipulation techniques in kelps.