The Effects of In Vivo Exposure to Copper Oxide Nanoparticles on the Gut Microbiome, Host Immunity, and Susceptibility to a Bacterial Infection in Earthworms
Abstract
:1. Introduction
2. Materials and Methods
2.1. Test Organism, Test Chemicals, and Soil Spiking
2.2. Overview of the Experimental Design
2.3. Pre-Treatment Exposure
2.4. Bacterial Challenge
2.5. Recovery Period
2.6. Sample Points
2.7. Sampling of Gut Tissue and Coelomic Fluid
2.8. Histological Analysis
2.9. Soil Metal Measurements
2.10. DNA and RNA Extraction and cDNA Synthesis Procedure
2.11. Earthworm Genotyping
2.12. Gut and Soil 16S Sequencing Metagenomics Bioinformatics
2.13. Quantitative PCR
2.14. Statistical Analysis
3. Results
3.1. Earthworm Population Genotypes
3.2. The Effects of Pre-Treatment Exposure and Bacterial Challenge on the Gut Microbiome
3.3. Relation between Earthworm Genotype and Bacterial Community Structure
3.4. Impact of Treatments on Bacillus Subtilis Abundance in Gut Tissue, Earthworm Survival, Tissue Integrity, and Immune Responses
3.5. Relation between Earthworm Genotype and Gene Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Sun, T.Y.; Bornhöft, N.A.; Hungerbühler, K.; Nowack, B. Dynamic Probabilistic Modeling of Environmental Emissions of Engineered Nanomaterials. Environ. Sci. Technol. 2016, 50, 4701–4711. [Google Scholar] [CrossRef] [PubMed]
- Keller, A.A.; McFerran, S.; Lazareva, A.; Suh, S. Glob al life cycle releases of engineered nanomaterials. J. Nanopart. Res. 2013, 15. [Google Scholar] [CrossRef]
- Colvin, V.L. The potential environmental impact of engineered nanomaterials. Nat. Biotechnol. 2003, 21, 1166–1170. [Google Scholar] [CrossRef]
- Moore, M.N. Do nanoparticles present ecotoxicological risks for the health of the aquatic environment? Environ. Int. 2006, 32, 967–976. [Google Scholar] [CrossRef] [PubMed]
- Handy, R.D.; Owen, R.; Valsami-Jones, E. The ecotoxicology of nanoparticles and nanomaterials: Current status, knowledge gaps, challenges, and future needs. Ecotoxicology 2008, 17, 315–325. [Google Scholar] [CrossRef] [PubMed]
- Dobrovolskaia, M.A.; McNeil, S.E. Immunological properties of engineered nanomaterials. Nat. Nanotechnol. 2007, 2, 469–478. [Google Scholar] [CrossRef] [PubMed]
- Boraschi, D.; Oostingh, G.J.; Casals, E.; Italiani, P.; Nelissen, I.; Puntes, V.F.; Duschl, A. Nano-immunosafety: Issues in assay validation. J. Phys. Conf. Ser. 2011, 304, 012077. [Google Scholar] [CrossRef]
- Boraschi, D.; Alijagic, A.; Auguste, M.; Barbero, F.; Ferrari, E.; Hernadi, S.; Mayall, C.; Michelini, S.; Navarro Pacheco, N.I.; Prinelli, A.; et al. Addressing Nanomaterial Immunosafety by Evaluating Innate Immunity across Living Species. Small 2020, 16. [Google Scholar] [CrossRef]
- Fadeel, B. Hide and seek: Nanomaterial interactions with the immune system. Front. Immunol. 2019, 10, 133. [Google Scholar] [CrossRef]
- Boraschi, D.; Italiani, P.; Palomba, R.; Decuzzi, P.; Duschl, A.; Fadeel, B.; Moghimi, S.M. Nanoparticles and innate immunity: New perspectives on host defence. Semin. Immunol. 2017, 34, 33–51. [Google Scholar] [CrossRef]
- Pallardy, M.J.; Turbica, I.; Biola-Vidamment, A. Why the immune system should be concerned by nanomaterials? Front. Immunol. 2017, 8, 544. [Google Scholar] [CrossRef] [PubMed]
- Alsaleh, N.B.; Brown, J.M. Immune responses to engineered nanomaterials: Current understanding and challenges. Curr. Opin. Toxicol. 2018, 10, 8–14. [Google Scholar] [CrossRef]
- Bhattacharya, K.; Kiliç, G.; Costa, P.M.; Fadeel, B. Cytotoxicity screening and cytokine profiling of nineteen nanomaterials enables hazard ranking and grouping based on inflammogenic potential. Nanotoxicology 2017, 11, 809–826. [Google Scholar] [CrossRef]
- Simonin, M.; Richaume, A. Impact of engineered nanoparticles on the activity, abundance, and diversity of soil microbial communities: A review. Environ. Sci. Pollut. Res. 2015, 22, 13710–13723. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McKee, M.S.; Filser, J. Impacts of metal-based engineered nanomaterials on soil communities. Environ. Sci. Nano 2016, 3, 506. [Google Scholar] [CrossRef] [Green Version]
- Courtois, P.; Rorat, A.; Lemiere, S.; Guyoneaud, R.; Attard, E.; Levard, C.; Vandenbulcke, F. Ecotoxicology of silver nanoparticles and their derivatives introduced in soil with or without sewage sludge: A review of effects on microorganisms, plants and animals. Environ. Pollut. 2019, 253, 578–598. [Google Scholar] [CrossRef]
- Judy, J.D.; McNear, D.H.; Chen, C.; Lewis, R.W.; Tsyusko, O.V.; Bertsch, P.M.; Rao, W.; Stegemeier, J.; Lowry, G.V.; McGrath, S.P.; et al. Nanomaterials in Biosolids Inhibit Nodulation, Shift Microbial Community Composition, and Result in Increased Metal Uptake Relative to Bulk/Dissolved Metals. Environ. Sci. Technol. 2015, 49, 8751–8758. [Google Scholar] [CrossRef]
- Brestoff, J.R.; Artis, D. Commensal bacteria at the interface of host metabolism and the immune system. Nat. Immunol. 2013, 14, 676–684. [Google Scholar] [CrossRef] [Green Version]
- Buffie, C.G.; Pamer, E.G. Microbiota-mediated colonization resistance against intestinal pathogens. Nat. Rev. Immunol. 2013, 13, 790–801. [Google Scholar] [CrossRef] [Green Version]
- Nyholm, S.V.; Graf, J. Knowing your friends: Invertebrate innate immunity fosters beneficial bacterial symbioses. Nat. Rev. Microbiol. 2012, 10, 815–827. [Google Scholar] [CrossRef] [Green Version]
- Koch, H.; Schmid-Hempel, P. Socially transmitted gut microbiota protect bumble bees against an intestinal parasite. Proc. Natl. Acad. Sci. USA 2011, 108, 19288–19292. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dillon, R.J.; Vennard, C.T.; Buckling, A.; Charnley, A.K. Diversity of locust gut bacteria protects against pathogen invasion. Ecol. Lett. 2005, 8, 1291–1298. [Google Scholar] [CrossRef]
- Cirimotich, C.M.; Dong, Y.; Clayton, A.M.; Sandiford, S.L.; Souza-Neto, J.; Mulenga, M.; Dimopoulos, G. Natural microbe-mediated refractoriness to Plasmodium infection in Anopheles gambiae. Science 2011, 332, 855–858. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kwong, W.K.; Mancenido, A.L.; Moran, N.A. Immune system stimulation by the native gut microbiota of honey bees. R. Soc. Open Sci. 2017, 4, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Weiss, B.L.; Maltz, M.; Aksoy, S. Obligate symbionts activate immune system development in the tsetse fly. J. Immunol. 2012, 188, 3395–3403. [Google Scholar] [CrossRef] [PubMed]
- Motta, E.V.S.; Raymann, K.; Moran, N.A. Glyphosate perturbs the gut microbiota of honey bees. Proc. Natl. Acad. Sci. USA 2018, 115, 10305–10310. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.K.; Lee, J.B.; Huh, Y.R.; Jang, H.A.; Kim, C.H.; Yoo, J.W.; Lee, B.L. Burkholderia gut symbionts enhance the innate immunity of host Riptortus pedestris. Dev. Comp. Immunol. 2015, 53, 265–269. [Google Scholar] [CrossRef]
- Chen, H.; Zhao, R.; Wang, B.; Cai, C.; Zheng, L.; Wang, H.; Wang, M.; Ouyang, H.; Zhou, X.; Chai, Z.; et al. The effects of orally administered Ag, TiO2 and SiO2 nanoparticles on gut microbiota composition and colitis induction in mice. NanoImpact 2017, 8, 80–88. [Google Scholar] [CrossRef]
- Williams, K.; Milner, J.; Boudreau, M.D.; Gokulan, K.; Cerniglia, C.E.; Khare, S. Effects of subchronic exposure of silver nanoparticles on intestinal microbiota and gut-associated immune responses in the ileum of Sprague-Dawley rats. Nanotoxicology 2015, 9, 279–289. [Google Scholar] [CrossRef]
- Auguste, M.; Balbi, T.; Montagna, M.; Fabbri, R.; Sendra, M.; Blasco, J.; Canesi, L. In vivo immunomodulatory and antioxidant properties of nanoceria (nCeO2) in the marine mussel Mytilus galloprovincialis. Comp. Biochem. Physiol. Part—C Toxicol. Pharmacol. 2019, 219, 95–102. [Google Scholar] [CrossRef]
- Auguste, M.; Lasa, A.; Pallavicini, A.; Gualdi, S.; Vezzulli, L.; Canesi, L. Exposure to TiO2 nanoparticles induces shifts in the microbiota composition of Mytilus galloprovincialis hemolymph. Sci. Total Environ. 2019, 670, 129–137. [Google Scholar] [CrossRef] [PubMed]
- Alijagic, A.; Pinsino, A. Probing safety of nanoparticles by outlining sea urchin sensing and signaling cascades. Ecotoxicol. Environ. Saf. 2017, 144, 416–421. [Google Scholar] [CrossRef]
- Hayashi, Y.; Heckmann, L.H.; Simonsen, V.; Scott-Fordsmand, J.J. Time-course profiling of molecular stress responses to silver nanoparticles in the earthworm Eisenia fetida. Ecotoxicol. Environ. Saf. 2013, 98, 219–226. [Google Scholar] [CrossRef] [PubMed]
- Edwards, C.A.; Bohlen, P.J. The role of earthworms in organic matter and nutrient cycles. In Biology and Ecology of Earthworms; Chapman & Hall: London, UK, 1996; pp. 155–180. [Google Scholar]
- Beschin, A.; Bilej, M.; Hanssens, F.; Raymakers, J.; Van Dyck, E.; Revets, H.; Brys, L.; Gomez, J.; De Baetselier, P.; Timmermans, M. Identification and Cloning of a Glucan- and Lipopolysaccharide-binding Protein from Eisenia foetida Earthworm Involved in the Activation of Prophenoloxidase Cascade. J. Biol. Chem. 1998, 273, 24948–24954. [Google Scholar] [CrossRef] [Green Version]
- Bilej, M.; De Baetselier, P.; Van Dijck, E.; Stijlemans, B.; Colige, A.; Beschin, A. Distinct Carbohydrate Recognition Domains of an Invertebrate Defense Molecule Recognize Gram-negative and Gram-positive Bacteria. J. Biol. Chem. 2001, 276, 45840–45847. [Google Scholar] [CrossRef] [Green Version]
- Šilerová, M.; Procházková, P.; Josková, R.; Josens, G.; Beschin, A.; De Baetselier, P.; Bilej, M. Comparative study of the CCF-like pattern recognition protein in different Lumbricid species. Dev. Comp. Immunol. 2006, 30, 765–771. [Google Scholar] [CrossRef]
- Josková, R.; Šilerová, M.; Procházková, P.; Bilej, M. Identification and cloning of an invertebrate-type lysozyme from Eisenia andrei. Dev. Comp. Immunol. 2009, 33, 932–938. [Google Scholar] [CrossRef]
- Sekizawa, Y.; Hagiwara, K.; Nakajima, T.; Kobayashi, H. A novel protein, lysenin, that causes contraction of the isolated rat aorta: Its purification from the coelomic fluid of the earthworm Eisenia foetida. Biomed. Res. 1996, 17, 197–203. [Google Scholar] [CrossRef] [Green Version]
- Lassegues, M.; Milochau, A.; Doignon, F.; Du Pasquier, L.; Valembois, P. Sequence and expression of an Eisenia-fetida-derived cDNA clone that encodes the 40-kDa fetidin antibacterial protein. Eur. J. Biochem. 1997, 246, 756–762. [Google Scholar] [CrossRef]
- Cooper, E.L.; Roch, P. Earthworm immunity: A model of immune competence. Pedobiologia 2003, 47, 676–688. [Google Scholar] [CrossRef]
- Bruhn, H.; Winkelmann, J.; Andersen, C.; Andrä, J.; Leippe, M. Dissection of the mechanisms of cytolytic and antibacterial activity of lysenin, a defence protein of the annelid Eisenia fetida. Dev. Comp. Immunol. 2006, 30, 597–606. [Google Scholar] [CrossRef]
- Dvořák, J.; Mančíková, V.; Pižl, V.; Elhottová, D.; Šilerová, M.; Roubalová, R.; Škanta, F.; Procházková, P.; Bilej, M. Microbial environment affects innate immunity in two closely related earthworm species Eisenia andrei and Eisenia fetida. PLoS ONE 2013, 8, e0079257. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dvořák, J.; Roubalová, R.; Procházková, P.; Rossmann, P.; Škanta, F.; Bilej, M. Sensing microorganisms in the gut triggers the immune response in Eisenia andrei earthworms. Dev. Comp. Immunol. 2016, 57, 67–74. [Google Scholar] [CrossRef] [PubMed]
- Hayashi, Y.; Engelmann, P.; Foldbjerg, R.; Szabó, M.; Somogyi, I.; Pollák, E.; Molnár, L.; Autrup, H.; Sutherland, D.S.; Scott-Fordsmand, J.; et al. Earthworms and humans in vitro: Characterizing evolutionarily conserved stress and immune responses to silver nanoparticles. Environ. Sci. Technol. 2012, 46, 4166–4173. [Google Scholar] [CrossRef]
- Hayashi, Y.; Miclaus, T.; Engelmann, P.; Autrup, H.; Sutherland, D.S.; Scott-Fordsmand, J.J. Nanosilver pathophysiology in earthworms: Transcriptional profiling of secretory proteins and the implication for the protein corona. Nanotoxicology 2016, 10, 303–311. [Google Scholar] [CrossRef] [PubMed]
- Zeibich, L.; Schmidt, O.; Drake, H.L. Fermenters in the earthworm gut: Do transients matter? FEMS Microbiol. Ecol. 2019, 95, 1–12. [Google Scholar] [CrossRef]
- Singleton, D.R.; Hendrix, P.F.; Coleman, D.C.; Whitman, W.B. Identification of uncultured bacteria tightly associated with the intestine of the earthworm Lumbricus rubellus (Lumbricidae; Oligochaeta). Soil Biol. Biochem. 2003, 35, 1547–1555. [Google Scholar] [CrossRef]
- Thakuria, D.; Schmidt, O.; Finan, D.; Egan, D.; Doohan, F.M. Gut wall bacteria of earthworms: A natural selection process. ISME J. 2010, 4, 357–366. [Google Scholar] [CrossRef] [Green Version]
- Swart, E.; Newbold, L.; Kille, P.; Spurgeon, D.; Svendsen, C. The midgut of the earthworm Eisenia fetida harbours a resident host specific bacterial community independent from soil. Environ. Microbiol. under review.
- Lund, M.B.; Holmstrup, M.; Lomstein, B.A.; Damgaard, C.; Schramm, A. Beneficial effect of verminephrobacter nephridial symbionts on the fitness of the earthworm aporrectodea tuberculata. Appl. Environ. Microbiol. 2010, 76, 4738–4743. [Google Scholar] [CrossRef] [Green Version]
- Viana, F.; Paz, L.C.; Methling, K.; Damgaard, C.F.; Lalk, M.; Schramm, A.; Lund, M.B. Distinct effects of the nephridial symbionts Verminephrobacter and Candidatus Nephrothrix on reproduction and maturation of its earthworm host Eisenia andrei. FEMS Microbiol. Ecol. 2018, 94, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Šrut, M.; Menke, S.; Höckner, M.; Sommer, S. Earthworms and cadmium—Heavy metal resistant gut bacteria as indicators for heavy metal pollution in soils? Ecotoxicol. Environ. Saf. 2019, 171, 843–853. [Google Scholar] [CrossRef] [PubMed]
- Yausheva, E.; Sizova, E.; Lebedev, S.; Skalny, A.; Miroshnikov, S.; Plotnikov, A.; Khlopko, Y.; Gogoleva, N.; Cherkasov, S. Influence of zinc nanoparticles on survival of worms Eisenia fetida and taxonomic diversity of the gut microflora. Environ. Sci. Pollut. Res. 2016, 23, 13245–13254. [Google Scholar] [CrossRef] [PubMed]
- Ma, L.; Xie, Y.; Han, Z.; Giesy, J.P.; Zhang, X. Responses of earthworms and microbial communities in their guts to Triclosan. Chemosphere 2017, 168, 1194–1202. [Google Scholar] [CrossRef]
- Swart, E.; Goodall, T.; Kille, P.; Spurgeon, D.; Svendsen, C. The earthworm microbiome is resilient to exposure to biocidal metal nanoparticles. Environ. Pollut. accepted.
- Pass, D.A.; Morgan, A.J.; Read, D.S.; Field, D.; Weightman, A.J.; Kille, P. The effect of anthropogenic arsenic contamination on the earthworm microbiome. Environ. Microbiol. 2015, 17, 1884–1896. [Google Scholar] [CrossRef]
- Ma, J.; Chen, Q.-L.; O’Connor, P.; Sheng, G.D. Does soil CuO nanoparticles pollution alter the gut microbiota and resistome of Enchytraeus crypticus? Environ. Pollut. 2019, 113463. [Google Scholar] [CrossRef]
- Zhu, D.; Zheng, F.; Chen, Q.-L.; Yang, X.-R.; Christie, P.; Ke, X.; Zhu, Y.-G. Exposure of a soil collembolan to Ag nanoparticles and AgNO3 disturbs its associated microbiota and lowers the incidence of antibiotic resistance genes in the gut. Environ. Sci. Technol. 2018, 52, 12748–12756. [Google Scholar] [CrossRef]
- Ma, J.; Sheng, G.D.; Chen, Q.L.; O’Connor, P. Do combined nanoscale polystyrene and tetracycline impact on the incidence of resistance genes and microbial community disturbance in Enchytraeus crypticus? J. Hazard. Mater. 2020, 387, 122012. [Google Scholar] [CrossRef]
- Keller, A.A.; Adeleye, A.S.; Conway, J.R.; Garner, K.L.; Zhao, L.; Cherr, G.N.; Hong, J.; Gardea-Torresdey, J.L.; Godwin, H.A.; Hanna, S.; et al. Comparative environmental fate and toxicity of copper nanomaterials. NanoImpact 2017, 7, 28–40. [Google Scholar] [CrossRef] [Green Version]
- Mincarelli, L.; Tiano, L.; Craft, J.; Marcheggiani, F.; Vischetti, C. Evaluation of gene expression of different molecular biomarkers of stress response as an effect of copper exposure on the earthworm Eisenia Andrei. Ecotoxicology 2019, 28, 938–948. [Google Scholar] [CrossRef] [PubMed]
- Smit, C.E.; Van Gestel, C.A.M. Effects of soil type, prepercolation, and ageing on bioaccumulation and toxicity of zinc for the springtail Folsomia candida. Environ. Toxicol. Chem. 1998, 17, 1132–1141. [Google Scholar] [CrossRef]
- Waalewijn-Kool, P.L.; Ortiz, M.D.; Van Gestel, C.A.M. Effect of different spiking procedures on the distribution and toxicity of ZnO nanoparticles in soil. Ecotoxicology 2012, 21, 1797–1804. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kiernan, J.A. Histological and Histochemical Methods: Theory and Practice, 4th ed.; Scion Publishing Ltd.: Banbury, UK, 2008; ISBN 9781904842422. [Google Scholar]
- Gibson-Corley, K.N.; Olivier, A.K.; Meyerholz, D.K. Principles for Valid Histopathologic Scoring in Research. Vet. Pathol. 2013, 50, 1007–1015. [Google Scholar] [CrossRef] [Green Version]
- Novo, M.; Almodóvar, A.; Fernández, R.; Trigo, D.; Díaz Cosín, D.J. Cryptic speciation of hormogastrid earthworms revealed by mitochondrial and nuclear data. Mol. Phylogenet. Evol. 2010, 56, 507–512. [Google Scholar] [CrossRef]
- King, R.A.; Tibble, A.L.; Symondson, W.O.C. Opening a can of worms: Unprecedented sympatric cryptic diversity within British lumbricid earthworms. Mol. Ecol. 2008, 17, 4684–4698. [Google Scholar] [CrossRef]
- Anderson, C.; Cunha, L.; Sechi, P.; Kille, P.; Spurgeon, D. Genetic variation in populations of the earthworm, Lumbricus rubellus, across contaminated mine sites. BMC Genet. 2017, 18. [Google Scholar] [CrossRef] [Green Version]
- Pérez-Losada, M.; Eiroa, J.; Mato, S.; Domínguez, J. Phylogenetic species delimitation of the earthworms Eisenia fetida (Savigny, 1826) and Eisenia andrei Bouché, 1972 (Oligochaeta, Lumbricidae) based on mitochondrial and nuclear DNA sequences. Pedobiologia 2005, 49, 317–324. [Google Scholar] [CrossRef]
- Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar] [CrossRef]
- Sharma, A.; Sonah, H.; Deshmukh, R.K.; Gupta, N.K.; Singh, N.K.; Sharma, T.R. Analysis of Genetic Diversity in Earthworms using DNA Markers. Zool. Sci. 2010, 28, 25. [Google Scholar] [CrossRef]
- Paradis, E.; Schliep, K. ape 5.0: An environment for modern phylogenetics and evolutionary analyses in R. Bioinformatics 2019, 35, 526–528. [Google Scholar] [CrossRef] [PubMed]
- Kozich, J.J.; Westcott, S.L.; Baxter, N.T.; Highlander, S.K.; Schloss, P.D. Development of a dual-index sequencing strategy and curation pipeline for analyzing amplicon sequence data on the MiSeq Illumina sequencing platform. Appl. Environ. Microbiol. 2013, 79, 5112–5120. [Google Scholar] [CrossRef] [Green Version]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Callahan, B. Silva taxonomic training data formatted for DADA2 (Silva version 132) [Data set]. Zenodo 2018. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Oksanen, J.; Blanchet, F.G.; Friendly, M.; Kindt, R.; Legendre, P.; McGlinn, D.; Minchin, P.R.; O’Hara, R.B.; Simpson, G.L.; Solymos, P.; et al. Vegan: Community Ecology Package. R Package Version 2.5-3. 2018. Available online: https://CRAN.R-project.org/package=vegan (accessed on 25 October 2018).
- Procházková, P.; Hanč, A.; Dvořák, J.; Roubalová, R.; Drešlová, M.; Částková, T.; Šustr, V.; Škanta, F.; Pacheco, N.I.N.; Bilej, M. Contribution of Eisenia andrei earthworms in pathogen reduction during vermicomposting. Environ. Sci. Pollut. Res. 2018, 25, 26267–26278. [Google Scholar] [CrossRef]
- Hayashi, Y.; Miclaus, T.; Scavenius, C.; Kwiatkowska, K.; Sobota, A.; Engelmann, P.; Scott-Fordsmand, J.J.; Enghild, J.J.; Sutherland, D.S. Species differences take shape at nanoparticles: Protein corona made of the native repertoire assists cellular interaction. Environ. Sci. Technol. 2013, 47, 14367–14375. [Google Scholar] [CrossRef]
- Bigorgne, E.; Foucaud, L.; Caillet, C.; Giambérini, L.; Nahmani, J.; Thomas, F.; Rodius, F. Cellular and molecular responses of E. fetida cœlomocytes exposed to TiO 2 nanoparticles. J. Nanoparticle Res. 2012, 14. [Google Scholar] [CrossRef]
- Patricia, C.S.; Nerea, G.V.; Erik, U.; Elena, S.M.; Eider, B.; Darío, D.M.W.; Manu, S. Responses to silver nanoparticles and silver nitrate in a battery of biomarkers measured in coelomocytes and in target tissues of Eisenia fetida earthworms. Ecotoxicol. Environ. Saf. 2017, 141, 57–63. [Google Scholar] [CrossRef]
- Garcia-Velasco, N.; Irizar, A.; Urionabarrenetxea, E.; Scott-Fordsmand, J.J.; Soto, M. Selection of an optimal culture medium and the most responsive viability assay to assess AgNPs toxicity with primary cultures of Eisenia fetida coelomocytes. Ecotoxicol. Environ. Saf. 2019, 183, 109545. [Google Scholar] [CrossRef]
- Alijagic, A.; Gaglio, D.; Napodano, E.; Russo, R.; Costa, C.; Benada, O.; Kofroňová, O.; Pinsino, A. Titanium dioxide nanoparticles temporarily influence the sea urchin immunological state suppressing inflammatory-relate gene transcription and boosting antioxidant metabolic activity. J. Hazard. Mater. 2020, 384, 121389. [Google Scholar] [CrossRef]
- Meier, C.; Voegelin, A.; Pradas Del Real, A.; Sarret, G.; Mueller, C.R.; Kaegi, R. Transformation of Silver Nanoparticles in Sewage Sludge during Incineration. Environ. Sci. Technol. 2016, 50, 3503–3510. [Google Scholar] [CrossRef]
- Sekine, R.; Marzouk, E.R.; Khaksar, M.; Scheckel, K.G.; Stegemeier, J.P.; Lowry, G.V.; Donner, E.; Lombi, E. Aging of dissolved copper and copper-based nanoparticles in five different soils: Short-term kinetics vs. long-term fate. J. Environ. Qual. 2017, 46, 1198–1205. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Levard, C.; Hotze, E.M.; Lowry, G.V.; Brown, G.E. Environmental Transformations of Silver Nanoparticles: Impact on Stability and Toxicity. Environ. Sci. Technol. 2012, 46, 6900–6914. [Google Scholar] [CrossRef]
- Baccaro, M.; Undas, A.K.; De Vriendt, J.; Van Den Berg, J.H.J.; Peters, R.J.B.; Van Den Brink, N.W. Ageing, dissolution and biogenic formation of nanoparticles: How do these factors affect the uptake kinetics of silver nanoparticles in earthworms? Environ. Sci. Nano 2018, 5, 1107–1116. [Google Scholar] [CrossRef]
- Peng, C.; Duan, D.; Xu, C.; Chen, Y.; Sun, L.; Zhang, H.; Yuan, X.; Zheng, L.; Yang, Y.; Yang, J.; et al. Translocation and biotransformation of CuO nanoparticles in rice (Oryza sativa L.) plants. Environ. Pollut. 2015, 197, 99–107. [Google Scholar] [CrossRef] [PubMed]
- Xiang, Q.; Zhu, D.; Chen, Q.L.; O’Connor, P.; Yang, X.R.; Qiao, M.; Zhu, Y.G. Adsorbed Sulfamethoxazole Exacerbates the Effects of Polystyrene (∼2 μm) on Gut Microbiota and the Antibiotic Resistome of a Soil Collembolan. Environ. Sci. Technol. 2019, 53, 12823–12834. [Google Scholar] [CrossRef]
- Nechitaylo, T.Y.; Timmis, K.N.; Golyshin, P.N. “Candidatus Lumbricincola”, a novel lineage of uncultured Mollicutes from earthworms of family Lumbricidae. Environ. Microbiol. 2009, 11, 1016–1026. [Google Scholar] [CrossRef]
- Tak, E.S.; Cho, S.; Park, S.C. Gene expression profiling of coelomic cells and discovery of immune-related genes in the earthworm, Eisenia andrei, using expressed sequence tags. Biosci. Biotechnol. Biochem. 2015, 8451, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Opper, B.; Bognár, A.; Heidt, D.; Németh, P.; Engelmann, P. Revising lysenin expression of earthworm coelomocytes. Dev. Comp. Immunol. 2013, 39, 214–218. [Google Scholar] [CrossRef]
- Adamowicz, A. Morphology and ultrastructure of the earthworm Dendrobaena veneta (Lumbricidae) coelomocytes. Tissue Cell 2005, 37, 125–133. [Google Scholar] [CrossRef] [PubMed]
- Engelmann, P.; Cooper, E.L.; Opper, B.; Németh, P. Earthworm Innate Immune System. In Biology of Earthworms; Karaca, A., Ed.; Soil Biology; Springer: Berlin/Heidelberg, Germany, 2011; Volume 24, pp. 229–245. ISBN 978-3-642-14635-0. [Google Scholar]
- Bodó, K.; Ernszt, D.; Németh, P.; Engelmann, P. Distinct immune-and defense-related molecular fingerprints in sepatated coelomocyte subsets of Eisenia andrei earthworms. Invertebr. Surviv. J. 2018, 15, 338–345. [Google Scholar]
- Irizar, A.; Rivas, C.; García-Velasco, N.; de Cerio, F.G.; Etxebarria, J.; Marigómez, I.; Soto, M. Establishment of toxicity thresholds in subpopulations of coelomocytes (amoebocytes vs. eleocytes) of Eisenia fetida exposed in vitro to a variety of metals: Implications for biomarker measurements. Ecotoxicology 2015, 24, 1004–1013. [Google Scholar] [CrossRef] [PubMed]
- Homa, J.; Zorska, A.; Wesolowski, D.; Chadzinska, M. Dermal exposure to immunostimulants induces changes in activity and proliferation of coelomocytes of Eisenia andrei. J. Comp. Physiol. B. 2013, 313–322. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Olchawa, E.; Bzowska, M.; Stürzenbaum, S.R.; Morgan, A.J.; Plytycz, B. Heavy metals affect the coelomocyte-bacteria balance in earthworms: Environmental interactions between abiotic and biotic stressors. Environ. Pollut. 2006, 142, 373–381. [Google Scholar] [CrossRef] [PubMed]
- Procházková, P.; Silerová, M.; Felsberg, J.; Josková, R.; Beschin, A.; De Baetselier, P.; Bilej, M. Relationship between hemolytic molecules in Eisenia fetida earthworms. Dev. Comp. Immunol. 2006, 30, 381–392. [Google Scholar] [CrossRef]
- Plytycz, B.; Bigaj, J.; Osikowski, A.; Hofman, S.; Falniowski, A.; Panz, T.; Grzmil, P.; Vandenbulcke, F. The existence of fertile hybrids of closely related model earthworm species, Eisenia andrei and E. fetida. PLoS ONE 2018, 13, e0191711. [Google Scholar] [CrossRef] [Green Version]
- Martinsson, S.; Erséus, C. Hybridisation and species delimitation of Scandinavian Eisenia spp. (Clitellata: Lumbricidae). Eur. J. Soil Biol. 2018, 88, 41–47. [Google Scholar] [CrossRef]
- Römbke, J.; Aira, M.; Backeljau, T.; Breugelmans, K.; Domínguez, J.; Funke, E.; Graf, N.; Hajibabaei, M.; Pérez-Losada, M.; Porto, P.G.; et al. DNA barcoding of earthworms (Eisenia fetida/andrei complex) from 28 ecotoxicological test laboratories. Appl. Soil Ecol. 2016, 104, 3–11. [Google Scholar] [CrossRef]
- Bouché, M.B. Lombriciens de France. Ecol. Syst. 1972, 72, 671. [Google Scholar]
- Domínguez, J.; Velando, A.; Ferreiro, A. Are Eisenia fetida (Savigny, 1826) and Eisenia andrei Bouche (1972) (Oligochaeta, Lumbricidae) different biological species? Pedobiologia 2005, 49, 81–87. [Google Scholar] [CrossRef]
- Plytycz, B.; Bigaj, J.; Panz, T.; Grzmil, P. Asymmetrical hybridization and gene flow between Eisenia andrei and E. fetida lumbricid earthworms. PLoS ONE 2018, 13, e0204469. [Google Scholar] [CrossRef] [PubMed]
- Goodrich, J.K.; Davenport, E.R.; Beaumont, M.; Bell, J.T.; Clark, A.G.; Ley, R.E.; Goodrich, J.K.; Davenport, E.R.; Beaumont, M.; Jackson, M.A.; et al. Genetic Determinants of the Gut Microbiome in UK Twins Resource Genetic Determinants of the Gut Microbiome in UK Twins. Cell Host Microbe 2016, 731–743. [Google Scholar] [CrossRef] [Green Version]
- Kolde, R.; Franzosa, E.A.; Rahnavard, G.; Hall, A.B.; Vlamakis, H.; Stevens, C.; Daly, M.J.; Xavier, R.J.; Huttenhower, C. Host genetic variation and its microbiome interactions within the Human Microbiome Project. Genome Med. 2018, 10, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Buhnik-Rosenblau, K.; Danin-Poleg, Y.; Kashi, Y. Predominant effect of host genetics on levels of Lactobacillus johnsonii bacteria in the mouse gut. Appl. Environ. Microbiol. 2011, 77, 6531–6538. [Google Scholar] [CrossRef] [Green Version]
- Macke, E.; Callens, M.; De Meester, L.; Decaestecker, E. Host-genotype dependent gut microbiota drives zooplankton tolerance to toxic cyanobacteria. Nat. Commun. 2017, 8. [Google Scholar] [CrossRef] [Green Version]
- Davidson, S.K.; Davidson, S.K.; Stahl, D.A. Transmission of Nephridial Bacteria of the Earthworm Eisenia fetida. Appl. Environ. Microbiol. 2006, 72, 769–775. [Google Scholar] [CrossRef] [Green Version]
Primer Name | Target Gene(s) | F/R | Sequence (5′ → 3′) | Amplicon Length (bp) |
---|---|---|---|---|
EF1α_F | Elongation factor 1 alpha | F | ATCGGTCATGTCGATTCCGG | 213 |
EF1α_R | Elongation factor 1 alpha | R | GGCAGTCTCGAACTTCCACA | |
CCF_721F | Coelomic cytolytic factor | F | ACGACAACCGATACTGGCTG | 193 |
CCF_914R | Coelomic cytolytic factor | R | CTCCCAGAAATCCACCCACC | |
Lysfet_F | Lysenin/fetidin | F | TGGCCAGCTGCAACTCTT a | 177 |
Lysfet_R | Lysenin/fetidin | R | CCAGCGCTGTTTCGGATTAT a | |
Lysozyme_F | Lysozyme | F | GCCATTCCAAATCAAGGAAC a | 129 |
Lysozyme_R | Lysozyme | R | TAGGTACCGTAGCGCTTCAT a |
Model Type | Model | Model Outcomes | ||||
---|---|---|---|---|---|---|
Explanatory Variables | Explained | Un-Explained | F-Value | p-Value | ||
Db-rda | Community~Pre-treatment + Bacterial treatment + Genotype | All | 0.202 | 0.798 | 1.167 | 0.008 ** |
Db-rda | Community~Pre-treatment + Bacterial treatment | All | 0.118 | 0.882 | 1.114 | 0.084 |
Db-rda | Community~Pre-treatment + Bacterial treatment + conditioned (Genotype) | Pre-treatment + Bacterial treatment | 0.085 (0.117) | 0.798 | 1.130 | 0.079 |
Db-rda | Community~Pre-treatment | Pre-treatment | 0.041 | 0.959 | 1.159 | 0.103 |
Db-rda | Community~Bacterial treatment | Bacterial treatment | 0.077 | 0.924 | 1.077 | 0.189 |
Db-rda | Community~Genotype | Genotype | 0.085 | 0.915 | 1.205 | 0.021* |
Permanova | Community~Pre-treatment + Bacterial treatment + Genotype | Pre-treatment | 0.101 | 0.899 | 1.614 | 0.074 |
Bacterial treatment | 0.044 | 0.956 | 1.428 | 0.173 | ||
Genotype | 0.139 | 0.861 | 2.229 | 0.019 * | ||
Permanova | Community~Pre-treatment + Bacterial treatment | Pre-treatment | 0.101 | 0.899 | 1.470 | 0.128 |
Bacterial treatment | 0.044 | 0.956 | 1.300 | 0.220 | ||
Permanova | Community~Pre-treatment | Pre-treatment | 0.101 | 0.899 | 1.453 | 0.108 |
Permanova | Community~Bacterial treatment | Bacterial treatment | 0.043 | 0.957 | 1.221 | 0.265 |
Permanova | Community~Genotype | Genotype | 0.167 | 0.833 | 2.598 | 0.004 ** |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Swart, E.; Dvorak, J.; Hernádi, S.; Goodall, T.; Kille, P.; Spurgeon, D.; Svendsen, C.; Prochazkova, P. The Effects of In Vivo Exposure to Copper Oxide Nanoparticles on the Gut Microbiome, Host Immunity, and Susceptibility to a Bacterial Infection in Earthworms. Nanomaterials 2020, 10, 1337. https://doi.org/10.3390/nano10071337
Swart E, Dvorak J, Hernádi S, Goodall T, Kille P, Spurgeon D, Svendsen C, Prochazkova P. The Effects of In Vivo Exposure to Copper Oxide Nanoparticles on the Gut Microbiome, Host Immunity, and Susceptibility to a Bacterial Infection in Earthworms. Nanomaterials. 2020; 10(7):1337. https://doi.org/10.3390/nano10071337
Chicago/Turabian StyleSwart, Elmer, Jiri Dvorak, Szabolcs Hernádi, Tim Goodall, Peter Kille, David Spurgeon, Claus Svendsen, and Petra Prochazkova. 2020. "The Effects of In Vivo Exposure to Copper Oxide Nanoparticles on the Gut Microbiome, Host Immunity, and Susceptibility to a Bacterial Infection in Earthworms" Nanomaterials 10, no. 7: 1337. https://doi.org/10.3390/nano10071337