Bioactivation Treatment with Mixed Acid and Heat on Titanium Implants Fabricated by Selective Laser Melting Enhances Preosteoblast Cell Differentiation
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Preparation
2.2. Surface Characteristics
2.3. Apatite Formation
2.4. Cell Culture
2.5. Cell Viability and Cell Morphology
2.6. Alkaline Phosphatase Activity
2.7. Extracellular Matrix Mineralization
2.8. Real-Time PCR for Assessing Gene Expression
2.9. Statistical Analysis
3. Results
3.1. The Surface Characteristics
3.2. Capacity for Apatite Formation
3.3. Cell Morphology
3.4. Cell Viability
3.5. Alp Activity
3.6. Extracellular Matrix Mineralization
3.7. Gene Expression Level
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Koizumi, H.; Takeuchi, Y.; Imai, H.; Kawai, T.; Yoneyama, T. Application of titanium and titanium alloys to fixed dental prostheses. J. Prosthodont. Res. 2019, 63, 266–279. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.-C.; Chen, L.-Y. A review on biomedical titanium alloys: Recent progress and prospect. Adv. Eng. Mater. 2019, 21, 1801215. [Google Scholar] [CrossRef]
- Niinomi, M.; Liu, Y.; Nakai, M.; Liu, H.; Li, H. Biomedical titanium alloys with Young’s moduli close to that of cortical bone. Regen. Biomater. 2016, 3, 173–185.–185. [Google Scholar] [CrossRef]
- Kawai, T.; Takemoto, M.; Fujibayashi, S.; Neo, M.; Akiyama, H.; Yamaguchi, S.; Pattanayak, D.K.; Matsushita, T.; Nakamura, T.; Kokubo, T. Bone-bonding properties of Ti metal subjected to acid and heat treatments. J. Mater. Sci. Mater. Med. 2012, 23, 2981–2992. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Veiga, C.; Davim, J.P.; Loureiro, A.J.R. Review on machinability of titanium alloys: The process perspective. Rev. Adv. Mater. Sci. 2013, 34, 148–164. [Google Scholar]
- Yap, C.Y.; Chua, C.K.; Dong, Z.L.; Liu, Z.H.; Zhang, D.Q.; Loh, L.E.; Sing, S.L. Review of selective laser melting: Materials and applications. Appl. Phys. Rev. 2015, 2, 041101. [Google Scholar] [CrossRef]
- Wang, D.; Dou, W.; Yang, Y. Research on Selective Laser Melting of Ti6Al4V: Surface Morphologies, Optimized Processing Zone, and Ductility Improvement Mechanism. Metals 2018, 8, 471. [Google Scholar] [CrossRef]
- Warnke, P.H.; Douglas, T.; Wollny, P.; Sherry, E.; Steiner, M.; Galonska, S.; Becker, S.; Springer, I.; Wiltfang, J.; Sivananthan, S. Rapid prototyping: Porous titanium alloy scaffolds produced by selective laser melting for bone tissue engineering. Tissue Eng. Part C 2009, 15, 115–124. [Google Scholar] [CrossRef]
- Wysocki, B.; Idaszek, J.; Szlazak, K.; Strzelczyk, K.; Brynk, T.; Kurzydlowski, K.J.; Swieszkowski, W. Post processing and biological evaluation of the titanium scaffolds for bone tissue engineering. Materials 2016, 9, 197. [Google Scholar] [CrossRef] [PubMed]
- Biemond, J.E.; Hannink, G.; Verdonschot, N.; Buma, P. Bone ingrowth potential of electron beam and selective laser melting produced trabecular-like implant surfaces with and without a biomimetic coating. J. Mater. Sci. Mater. Med. 2003, 24, 745–753. [Google Scholar] [CrossRef]
- Fukuda, A.; Takemoto, M.; Saito, T.; Fujibayashi, S.; Neo, M.; Pattanayak, D.K.; Matsushita, T.; Sasaki, K.; Nishida, N.; Kokubo, T.; et al. Osteoinduction of porous Ti implants with a channel structure fabricated by selective laser melting. Acta Biomater. 2011, 7, 2327–2336. [Google Scholar] [CrossRef] [PubMed]
- Rana, M.; Gellrich, M.M.; Gellrich, N.C. Customised reconstruction of the orbital wall and engineering of selective laser melting (SLM) core implants. Br. J. Oral Maxillofac. Surg. 2015, 53, 208–209. [Google Scholar] [CrossRef] [PubMed]
- Rotaru, H.; Schumacher, R.; Kim, S.G.; Dinu, C. Selective laser melted titanium implants: A new technique for the reconstruction of extensive zygomatic complex defects, Maxillofac. Plast. Reconstr. Surg. 2015, 37, 1–6. [Google Scholar]
- Dumbleton, J.; Manley, M.T. Hydroxyapatite-coated prostheses in total hip and knee arthroplasty. J. Bone Joint Surg. Am. 2004, 86, 2526–2540. [Google Scholar] [CrossRef] [PubMed]
- Park, J.W.; Kurashima, K.; Tustusmi, Y.; An, C.H.; Suh, Y.J.; Doi, H.; Nomura, N.; Noda, K.; Hanawa, T. Bone healing of commercial oral implants with RGD immobilization through electrodeposited poly(ethylene glycol) in rabbit cancellous bone. Acta Biomater. 2011, 7, 3222–3229. [Google Scholar] [CrossRef] [PubMed]
- Yan, W.Q.; Nakamura, T.; Kobayashi, M.; Kim, H.M.; Miyaji, F.; Kokubo, T. Bonding of chemically treated titanium implants to bone. J. Biomed. Mater. Res. 1997, 37, 267–275. [Google Scholar] [CrossRef]
- Takemoto, M.; Fujibayashi, S.; Neo, M.; Suzuki, J.; Matsushita, T.; Kokubo, T.; Nakamura, T. Osteoinductive porous titanium implants: Effect of sodium removal by dilute HCl treatment. Biomaterials 2006, 27, 2682–2691. [Google Scholar] [CrossRef] [PubMed]
- Kokubo, T.; Pattanayak, D.K.; Yamaguchi, S.; Takadama, H.; Matsushita, T.; Kawai, T.; Takemoto, M.; Fujibayashi, S.; Nakamura, T. Positively charged bioactive Ti metal prepared by simple chemical and heat treatments. J. R. Soc. Interface 2010, 7, 503–513. [Google Scholar] [CrossRef]
- Yavari, S.A.; Stok, J.; Chai, Y.C.; Wauthle, R.; Birgani, Z.T.; Habibovic, T.; Mulier, M.; Schrooten, J.; Weinans, H.; Zadpoor, A.A. Bone regeneration performance of surface-treated porous titanium. Biomaterials 2014, 35, 6172–6181. [Google Scholar] [CrossRef]
- Kokubo, T.; Yamaguchi, S. Novel bioactive materials developed by simulated body fluid evaluation: Surface–modified Ti metal and its alloys. Acta Biomater. 2016, 44, 16–30. [Google Scholar] [CrossRef]
- Tsukanaka, M.; Fujibayashi, S.; Takemoto, M.; Matsushita, T.; Kokubo, T.; Nakamura, T.; Sasaki, K.; Matsuda, S. Bioactive treatment promotes osteoblast differentiation on titanium materials fabricated by selective laser melting technology. Dent. Mater. J. 2016, 35, 118–125. [Google Scholar] [CrossRef]
- Pattanayak, D.K.; Fukuda, A.; Matsushita, T.; Takemoto, M.; Fujibayashi, S.; Sasaki, K.; Nishida, N.; Nakamura, T.; Kokubo, T. Bioactive Ti metal analogous to human cancellous bone: Fabrication by selective laser melting and chemical treatments. Acta Biomater. 2011, 7, 1398–1406. [Google Scholar] [CrossRef]
- Kokubo, T.; Yamaguchi, S. Growth of novel ceramic layers on metals via chemical and heat treatments for inducing various biological functions. Front. Bioeng. Biotechnol. 2015, 3, 176. [Google Scholar] [CrossRef]
- Kawai, T.; Takemoto, M.; Fujibayashi, S.; Akiyama, H.; Tanaka, M.; Yamaguchi, S.; Pattanayak, D.K.; Doi, K.; Matsushita, T.; Nakamura, T.; et al. Osteoinduction on acid and heat treated porous Ti metal samples in canine muscle. PLoS ONE 2014, 10, e88366. [Google Scholar] [CrossRef] [PubMed]
- Kawai, T.; Takemoto, M.; Fujibayashi, S.; Akiyama, H.; Yamaguchi, S.; Pattanayak, D.K.; Doi, K.; Matsushita, T.; Nakamura, T.; Kokubo, T.; et al. Osteoconduction of porous Ti metal enhanced by acid and heat treatments. J. Mater. Sci. Mater. Med. 2013, 24, 1707–1715. [Google Scholar] [CrossRef]
- Kawanabe, K.; Ise, K.; Goto, K.; Akiyama, H.; Nakamura, T.; Kaneuji, A.; Sugimori, T.; Matsumoto, T. A new cementless total hip arthroplasty with bioactive titanium porous-coating by alkaline and heat treatment: Average 4.8-year results. J. Biomed. Mater. Res. B Appl. Biomater. 2009, 90, 476–481. [Google Scholar] [CrossRef] [PubMed]
- So, K.; Kaneuji, A.; Matsumoto, T.; Matsuda, S.; Akiyama, H. Is the Bone-bonding Ability of a Cementless Total Hip Prosthesis Enhanced by Alkaline and Heat Treatments? Clin. Orthop. Relat. Res. 2013, 471, 3847–3855. [Google Scholar] [CrossRef]
- Coelho, P.G.; Granjeiro, J.M.; Romanos, G.E.; Suzuki, M.; Silva, N.R.F.; Cardaropoli, G.; Thompson, V.P.; Lemons, J.E. Basic research methods and current trends of dental implant surfaces. J. Biomed. Mater. Res. Part B Appl. Biomater. 2009, 88, 579–596. [Google Scholar] [CrossRef] [PubMed]
- Yang, G.L.; He, F.M.; Yang, X.F.; Wang, X.X.; Zhao, S.F. Bone responses to titanium implants surface-roughened by sandblasted and double etched treatments in a rabbit model. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 2008, 106, 516–524. [Google Scholar] [CrossRef]
- Wang, X.; Hayakawa, S.; Tsuru, K.; Osaka, A. Bioactive titania gel layers formed by chemical treatment of Ti substrate with a H2O2/HCl solution. Biomaterials 2002, 23, 1353–1357. [Google Scholar] [CrossRef]
- Lu, X.; Zhao, Z.; Leng, Y. Biomimetic calcium phosphate coatings on nitric acid treated titanium surfaces. Mater. Sci. Eng. C 2007, 27, 700–708. [Google Scholar] [CrossRef]
- Yamamoto, K.; Yamaguchi, S.; Matsushita, T.; Mori, S.; Hirata, A.; Kato-Kogoe, N.; Nakano, H.; Nakajima, Y.; Nishitani, Y.; Nagatsuka, H.; et al. Osteogenic capacity of mixed acid and heat-treated titanium mesh prepared by a selective laser melting technique. RSC Adv. 2019, 8, 26069. [Google Scholar] [CrossRef]
- Imagawa, N.; Inoue, K.; Matsumoto, K.; Ochi, A.; Omori, M.; Yamamoto, K.; Nakajima, Y.; Kato-Kogoe, N.; Nakano, H.; Matsushita, T.; et al. Mechanical, histological, and scanning electron microscopy study of the effect of mixed-acid and heat treatment on additive-manufactured titanium plates on bonding to the bone surface. Materials 2020, 13, 5104. [Google Scholar] [CrossRef] [PubMed]
- Kokubo, T.; Takadama, H. How useful is SBF in predicting in vivo bone bioactivity. Biomaterials 2006, 27, 2907–2915. [Google Scholar] [CrossRef] [PubMed]
- Vandrovcová, M.; Bačáková, L. Adhesion, growth and differentiation of osteoblasts on surface-modifed materials developed for bone implants. Physiol. Res. 2011, 60, 403–417. [Google Scholar] [CrossRef]
- Bächle, M.; Kohal, R.J. A systematic review of the influence of different titanium surfaces on proliferation, differentiation and protein synthesis of osteoblast-like MG63 cells. Clin. Oral Implant. Res. 2004, 15, 683–692. [Google Scholar] [CrossRef]
- Fujino, T.; Taguchi, Y.; Komasa, S.; Sekino, T.; Tanaka, M. Cell differentiation on nanoscle features of a Titanium surface: Effects of deposition time in NaOH solution. J. Hard Tissue Biol. 2014, 23, 63–70. [Google Scholar] [CrossRef]
- Wennerberg, A.; Albrektsson, T. Effects of titanium surface topography on bone integration: A systematic review. Clin. Oral Implant. Res. 2009, 20, 172–184. [Google Scholar] [CrossRef]
- Elias, C.N.; Oshida, Y.; Lima, J.H.; Muller, C.A. Relationship between surface properties (roughness, wettability and morphology) of titanium and dental implant removal torque. J. Mech. Behav. Biomed. Mater. 2008, 1, 234–242. [Google Scholar] [CrossRef]
- Buser, D.; Janner, S.F.; Wittneben, J.G.; Brägger, U.; Ramseier, C.A.; Salvi, G.E. 10-year survival and success rates of 511 titanium implants with a sandblasted and acid-etched surface: A retrospective study in 303 partially edentulous patients. Clin. Implant Dent. Relat. Res. 2012, 14, 839–851. [Google Scholar] [CrossRef]
- Gittens, R.A.; Olivares-Navarrete, R.; Cheng, A.; Anderson, D.M.; McLachlan, T.; Stephan, I.; Geis-Gerstorfer, J.; Sandhage, K.H.; Fedorov, A.G.; Rupp, F.; et al. The roles of titanium surface micro/nanotopography and wettability on the differential response of human osteoblast lineage cells. Acta Biomater. 2013, 9, 6268–6277. [Google Scholar] [CrossRef]
- Pattanayak, D.K.; Yamaguchi, S.; Matsushita, T.; Nakamura, T.; Kokubo, T. Apatite-forming ability of titanium in terms of pH of the exposed solution. J. R. Soc. Interface 2012, 9, 2145–2155. [Google Scholar] [CrossRef]
- Lavenus, S.; Berreur, M.; Trichet, V.; Louarn, G.; Layrolle, P. Adhesion and osteogenic differentiation of human mesenchymal stem cells on titanium nanopores. Eur. Cells Mater. 2011, 22, 84–96. [Google Scholar] [CrossRef] [PubMed]
- Webb, K.; Hlady, V.; Tresco, P.A. Relationships among cell attachment, spreading, cytoskeletal organization, and migration rate for anchorage-dependent cells on model surfaces. J. Biomed. Mater. Res. 2000, 49, 358–362. [Google Scholar] [CrossRef]
- Khalili, A.; Ahmad, M. A Review of Cell Adhesion Studies for Biomedical and Biological Applications. Int. J. Mol. Sci. 2015, 16, 18149–18184. [Google Scholar] [CrossRef]
- Shi, G.; Ren, L.; Wang, L.; Lin, H.; Wang, S.; Tong, Y. H2O2/HCl and heat-treated Ti-6Al-4V stimulates pre-osteoblast proliferation and differentiation. Oral Surg. Oral Med. Oral Pahol. Oral Radiol. Endod. 2009, 108, 368–375. [Google Scholar] [CrossRef] [PubMed]
- Inui, S.; Yamamoto, K.; Kato-Kogoe, N.; Nakajima, Y.; Inoue, K.; Nakano, H.; Yamaguchi, S.; Hirata, A.; Kondo, Y.; Ueno, T. Biological safety of mixed acid heat treatment in SLM (Selective Laser Melting technique) Titanium mesh. J. Oral Tissue Eng. 2018, 16, 27–31. [Google Scholar]
- Sola-Ruiz, M.F.; Perez-Martinez, C.; Labaig-Rueda, C.; Carda, C.; Llano, J.J. Behavior of Human Osteoblast Cells Cultured on Titanium Discs in Relation to Surface Roughness and Presence of Melatonin. Int. J. Mol. Sci. 2017, 18, 823. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Wu, C.; Chang, J.; Sun, J. Stimulation of osteogenic protein expression for rat bone marrow stromal cells involved in the ERK signaling pathway by the ions released from Ca7Si2P2O16 bioceramics. J. Mater. Chem. B 2014, 2, 885–891. [Google Scholar] [CrossRef] [PubMed]
- Case, N.; Rubin, J. β-catenin—A supporting role in the skeleton. J. Cell. Biochem. 2010, 110, 545–553. [Google Scholar]
- Bennett, C.N.; Longo, K.A.; Wright, W.S.; Suva, L.J.; Lane, T.F.; Hankenson, K.D.; MacDougald, O.A. Regulation of psteoblastogenesis and bone mass by Wnt10b. Proc. Natl. Acad. Sci. USA 2005, 102, 3324–3329. [Google Scholar] [CrossRef]
- Wang, W.; Zhao, L.; Wu, K.; Ma, Q.; Mei, S.; Chu, P.K.; Wang, Q.; Zhang, Y. The role of integrin-linked kinase/β-catenin pathway in the enhanced MG63 differentiation by micro/nano-textures topography. Biomaterials 2013, 34, 631–640–640. [Google Scholar]
- Shi, J.; Zhang, X.; Qiao, S.; Ni, J.; Mo, J.; Gu, Y.; Lai, H. Enhanced osteointegration of tantalum-modified titanium implants with micro/nano-topography. RSC Adv. 2017, 73, 46472–46479. [Google Scholar] [CrossRef]
- Shen, M.; Wang, G.; Wang, Y.; Xie, J.; Ding, X. Nell-1 enhances osteogenic differentiation of pre-osteoblasts on titanium surfaces via the MAPK-ERK signaling pathway. Cell Physiol. Biochem. 2018, 50, 1522–1534. [Google Scholar] [CrossRef] [PubMed]
- Fujibayashi, S.; Takemoto, M.; Neo, M.; Matsushita, T.; Kokubo, T.; Doi, K.; Ito, T.; Shimizu, A.; Nakamura, T. A novel synthetic material for spinal fusion: A prospective clinical trial of porous bioactive titanium metal for lumbar interbody fusion. Eur. Spine J. 2011, 20, 1486–1495. [Google Scholar] [CrossRef] [PubMed]
- Kokubo, T.; Yamaguchi, S. Bioactive titanate layers formed on titanium and its alloys by simple chemical and heat treatments. Open Biomed. Eng. J. 2015, 9, 29–41. [Google Scholar] [CrossRef]
- Isaac, J.; Galtayries, A.; Kizuki, T.; Kokubo, T.; Berdal, A.; Sautier, J.M. Bioengineere titanium surfaces affect the gene-expression and phenotypic response of osteprogenitor cells derived from mouse calvarial bones. Eur. Cells Mater. 2010, 20, 178–196. [Google Scholar] [CrossRef]
- Yamaguchi, S.; Takadama, H.; Matsushita, T.; Nakamura, T.; Kokubo, T. Preparation of bioactive Ti-15Zr-4Nb-4Ta alloy from HCl and heat treatments after an NaOH treatment. J. Biomed. Mater. Res. Part A 2011, 97, 135–144. [Google Scholar] [CrossRef] [PubMed]











| Gene | Primer Sequence (F: Forward; R: Reverse; 5′–3′ |
|---|---|
| β-catenin | F: GCCTACCACCAGCAGAATGT |
| R: GAGGTGGCTGGGACTGTG | |
| Integrin β1 | F: TTGGGATGATGTCGGGAC |
| R: AATGTTTCAGTGCAGAGCC | |
| Cyclin D1 | F: TTTCTTTCCAGAGTCATCAAGTGT |
| R: TGACTCCAGAAGGGCTTCAA | |
| Runx2 | F: CCACAAGGACAGAGTCAGATTACA |
| R: TGGCTCAGATAGGAGGGGTA | |
| Alp | F: ACTCAGGGCAATGAGGTCAC |
| R: CACCCGAGTGGTAGTCACAA | |
| Ocn | F: AGACTCCGGCGCTACCTT |
| R: CTCGTCACAAGCAGGGTTAAG | |
| Opn | F: GGAGGAAACCAGCCAAGG |
| R: TGCCAGAATCAGTCACTTTCAC | |
| GADPH | F: TGTCCGTCGTGGATCTGAC |
| R: CCTGCTTCACCACCTTCTTG |
| Sample | Roughness | Phase | Contact Angle | Apatite Formation | Cell Attachment | Cell Viability | Cell Differentiation |
|---|---|---|---|---|---|---|---|
| cp-Ti | smooth | α-Ti | 95° | − | + | + | + |
| SLM-Ti U | rough | α-Ti | 92° | − | ++ | ++ | + |
| SLM-Ti MA | rough | α-Ti +TiHx | <1° | − | ++ | + | ++ |
| SLM-Ti MAH | rough | α-Ti +rutile | <1° | + | +++ | ++ | +++ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Le, P.T.M.; Shintani, S.A.; Takadama, H.; Ito, M.; Kakutani, T.; Kitagaki, H.; Terauchi, S.; Ueno, T.; Nakano, H.; Nakajima, Y.; et al. Bioactivation Treatment with Mixed Acid and Heat on Titanium Implants Fabricated by Selective Laser Melting Enhances Preosteoblast Cell Differentiation. Nanomaterials 2021, 11, 987. https://doi.org/10.3390/nano11040987
Le PTM, Shintani SA, Takadama H, Ito M, Kakutani T, Kitagaki H, Terauchi S, Ueno T, Nakano H, Nakajima Y, et al. Bioactivation Treatment with Mixed Acid and Heat on Titanium Implants Fabricated by Selective Laser Melting Enhances Preosteoblast Cell Differentiation. Nanomaterials. 2021; 11(4):987. https://doi.org/10.3390/nano11040987
Chicago/Turabian StyleLe, Phuc Thi Minh, Seine A. Shintani, Hiroaki Takadama, Morihiro Ito, Tatsuya Kakutani, Hisashi Kitagaki, Shuntaro Terauchi, Takaaki Ueno, Hiroyuki Nakano, Yoichiro Nakajima, and et al. 2021. "Bioactivation Treatment with Mixed Acid and Heat on Titanium Implants Fabricated by Selective Laser Melting Enhances Preosteoblast Cell Differentiation" Nanomaterials 11, no. 4: 987. https://doi.org/10.3390/nano11040987
APA StyleLe, P. T. M., Shintani, S. A., Takadama, H., Ito, M., Kakutani, T., Kitagaki, H., Terauchi, S., Ueno, T., Nakano, H., Nakajima, Y., Inoue, K., Matsushita, T., & Yamaguchi, S. (2021). Bioactivation Treatment with Mixed Acid and Heat on Titanium Implants Fabricated by Selective Laser Melting Enhances Preosteoblast Cell Differentiation. Nanomaterials, 11(4), 987. https://doi.org/10.3390/nano11040987

