Investigation of Liver X Receptor Gene Variants and Oxysterol Dysregulation in Autism Spectrum Disorder †
Abstract
:1. Introduction
2. Materials and Methods
2.1. Participants
2.2. Procedure
2.3. Clinical Assessment Tools
2.3.1. Sociodemographic Data Form
2.3.2. Childhood Autism Rating Scale (CARS)
2.3.3. The Autism Behaviour Checklist (ABC)
2.3.4. The Repetitive Behaviour Scale—Revised (RBS-R)
2.3.5. Lipid Panel and Oxysterol Level Analysis
2.3.6. Analysis of SNPs Identified for Liver X Receptor Beta
2.4. Statistical Analysis
3. Results
3.1. Data on Sociodemographic Characteristics
3.2. Clinical Characteristics and Evaluation of Scales of the ASD Group
3.3. Lipid Profile Analysis
3.4. Oxysterol Analyzes
3.5. Genotype and Allele Frequencies of LXRB Gene SNPs
4. Discussion
Limitations of the Study
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
SNP | Primer Pairs | Amplicon Lengths (bp) | Restriction Digestion Products (bp) |
---|---|---|---|
rs2695121 | forward: GCTTAAGACCAAGCTGAAGGC reverse: CGGAGCAGCCTGTAGAATACA | 225 | C allele: 114 + 33 + 78 T allele: 147 + 78 |
rs17373080 | forward: AGAAGCGCATGAATGAGCTAAATCCA reverse: GTAGATCTACTGGGACTTGGC | 108 | G allele: 84 + 24 C allele: 108 |
References
- Maenner, M.J.; Warren, Z.; Williams, A.R.; Amoakohene, E.; Bakian, A.V.; Bilder, D.A.; Durkin, M.S.; Fitzgerald, R.T.; Furnier, S.M.; Hughes, M.M. Prevalence and characteristics of autism spectrum disorder among children aged 8 years—Autism and Developmental Disabilities Monitoring Network, 11 sites, United States, 2020. MMWR Surveill. Summ. 2023, 72, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Fombonne, E. Epidemiological surveys of autism and other pervasive developmental disorders: An update. J. Autism Dev. Disord. 2003, 33, 365–382. [Google Scholar] [CrossRef] [PubMed]
- Murphy, C.M.; Wilson, C.E.; Robertson, D.M.; Ecker, C.; Daly, E.M.; Hammond, N.; Galanopoulos, A.; Dud, I.; Murphy, D.G.; McAlonan, G.M. Autism spectrum disorder in adults: Diagnosis, management, and health services development. Neuropsychiatr. Dis. Treat. 2016, 12, 1669–1686. [Google Scholar] [CrossRef] [PubMed]
- Herbert, M.R. Contributions of the environment and environmentally vulnerable physiology to autism spectrum disorders. Curr. Opin. Neurol. 2010, 23, 103–110. [Google Scholar] [CrossRef]
- Tierney, E.; Bukelis, I.; Thompson, R.E.; Ahmed, K.; Aneja, A.; Kratz, L.; Kelley, R.I. Abnormalities of cholesterol metabolism in autism spectrum disorders. Am. J. Med. Genet. Part B Neuropsychiatr. Genet. 2006, 141, 666–668. [Google Scholar] [CrossRef] [PubMed]
- Karasinska, J.M.; Hayden, M.R. Cholesterol metabolism in Huntington disease. Nat. Rev. Neurol. 2011, 7, 561–572. [Google Scholar] [CrossRef] [PubMed]
- Aneja, A.; Tierney, E. Cholesterol deficit in autism: Insights from Smith–Lemli–Opitz syndrome. In Autism; Springer: Berlin/Heidelberg, Germany, 2008; pp. 69–79. [Google Scholar]
- Petrov, A.; Kasimov, M.; Zefirov, A. Cholesterol in the pathogenesis of Alzheimer’s, Parkinson’s diseases and autism: Link to synaptic dysfunction. Acta Naturae (Англоязычная Версия) 2017, 9, 26–37. [Google Scholar] [CrossRef]
- Wang, B.; Tontonoz, P. Liver X receptors in lipid signalling and membrane homeostasis. Nat. Rev. Endocrinol. 2018, 14, 452–463. [Google Scholar] [CrossRef] [PubMed]
- Ma, L.; Nelson, E.R. Oxysterols and nuclear receptors. Mol. Cell. Endocrinol. 2019, 484, 42–51. [Google Scholar] [CrossRef]
- Zhang, J.-X.; Zhang, J.; Li, Y. Liver X receptor-β improves autism symptoms via downregulation of β-amyloid expression in cortical neurons. Ital. J. Pediatr. 2016, 42, 46. [Google Scholar] [CrossRef]
- Cai, Y.; Tang, X.; Chen, X.; Li, X.; Wang, Y.; Bao, X.; Wang, L.; Sun, D.; Zhao, J.; Xing, Y. Liver X receptor β regulates the development of the dentate gyrus and autistic-like behavior in the mouse. Proc. Natl. Acad. Sci. USA 2018, 115, E2725–E2733. [Google Scholar] [CrossRef] [PubMed]
- Cai, Y.; Zhong, H.; Li, X.; Xiao, R.; Wang, L.; Fan, X. The liver X receptor agonist TO901317 ameliorates behavioral deficits in two mouse models of autism. Front. Cell. Neurosci. 2019, 13, 213. [Google Scholar] [CrossRef] [PubMed]
- Vejux, A.; Lizard, G. Cytotoxic effects of oxysterols associated with human diseases: Induction of cell death (apoptosis and/or oncosis), oxidative and inflammatory activities, and phospholipidosis. Mol. Asp. Med. 2009, 30, 153–170. [Google Scholar] [CrossRef] [PubMed]
- Aksu, N.; Sabuncuoğlu, S. Oksisteroller: Hücresel Etkileri ve Kronik Hastalıklarla İlişkileri. J. Lit. Pharm. Sci. 2019, 8, 225–234. [Google Scholar] [CrossRef]
- Sweeney, M.D.; Sagare, A.P.; Zlokovic, B.V. Blood–brain barrier breakdown in Alzheimer disease and other neurodegenerative disorders. Nat. Rev. Neurol. 2018, 14, 133–150. [Google Scholar] [CrossRef] [PubMed]
- Grayaa, S.; Zerbinati, C.; Messedi, M.; HadjKacem, I.; Chtourou, M.; Touhemi, D.B.; Naifar, M.; Ayadi, H.; Ayedi, F.; Iuliano, L. Plasma oxysterol profiling in children reveals 24-hydroxycholesterol as a potential marker for Autism Spectrum Disorders. Biochimie 2018, 153, 80–85. [Google Scholar] [CrossRef] [PubMed]
- Heverin, M.; Meaney, S.; Lütjohann, D.; Diczfalusy, U.; Wahren, J.; Björkhem, I. Crossing the barrier: Net flux of 27-hydroxycholesterol into the human brain. J. Lipid Res. 2005, 46, 1047–1052. [Google Scholar] [CrossRef] [PubMed]
- Heverin, M.; Bogdanovic, N.; Lütjohann, D.; Bayer, T.; Pikuleva, I.; Bretillon, L.; Diczfalusy, U.; Winblad, B.; Björkhem, I. Changes in the levels of cerebral and extracerebral sterols in the brain of patients with Alzheimer’s disease. J. Lipid Res. 2004, 45, 186–193. [Google Scholar] [CrossRef] [PubMed]
- Du, X.; Pham, Y.H.; Brown, A.J. Effects of 25-hydroxycholesterol on cholesterol esterification and sterol regulatory element-binding protein processing are dissociable: Implications for cholesterol movement to the regulatory pool in the endoplasmic reticulum. J. Biol. Chem. 2004, 279, 47010–47016. [Google Scholar] [CrossRef]
- Oliveira, F.F.; Chen, E.S.; Smith, M.C.; Bertolucci, P.H. Associations of cerebrovascular metabolism genotypes with neuropsychiatric symptoms and age at onset of Alzhei-mer’s disease dementia. Braz. J. Psychiatry 2017, 39, 95–103. [Google Scholar] [CrossRef]
- Kaufman, J.; Birmaher, B.; Brent, D.; Rao, U.; Flynn, C.; Moreci, P.; Williamson, D.; Ryan, N. Schedule for affective disorders and schizophrenia for school-age children-present and lifetime version (K-SADS-PL): Initial reliability and validity data. J. Am. Acad. Child Adolesc. Psychiatry 1997, 36, 980–988. [Google Scholar] [CrossRef] [PubMed]
- Ünal, F.; Öktem, F.; Çetin Çuhadaroğlu, F.; Çengel Kültür, S.E.; Akdemir, D.; Foto Özdemir, D.; Çak, H.T.; Ünal, D.; Tıraş, K.; Aslan, C. Okul Çağı Çocukları için Duygulanım Bozuklukları ve Şizofreni Görüşme Çizelgesi-Şimdi ve Yaşam Boyu Şekli-DSM-5 Kasım 2016-Türkçe Uyarlamasının (ÇDŞG-ŞY-DSM-5-T) Geçerlik ve Güvenirliği. Turk Psikiyatr. Derg. 2019, 30, 42–50. [Google Scholar]
- Schopler, E.; Reichler, R.J.; DeVellis, R.F.; Daly, K. Toward objective classification of childhood autism: Childhood Autism Rating Scale (CARS). J. Autism Dev. Disord. 1980, 10, 91–103. [Google Scholar] [CrossRef] [PubMed]
- Gassaloğlu, S.; Baykara, B.; Avcil, S.; Demiral, Y. Çocukluk Otizmi Derecelendirme Ölçeği Türkçe Formunun Geçerlik ve Güvenilirlik Çalışması. Türk Psikiyatr. Derg. 2016, 27, 266–274. [Google Scholar]
- Krug, D.A.; Arick, J.R.; Almond, P.J. Autism Screening İnstrument for Educational Planning: Examiner’s Manual; Pro-Ed: Austin, TX, USA, 1993. [Google Scholar]
- Irmak, T.; Sutcu, S.; Aydın, A.; Sorias, O. Otizm Davranış Kontrol Listesinin (ABC) Geçerlilik ve Güvenirliğinin İncelenmesi. Çocuk Ve Gençlik Ruh Saðlýðý Derg. 2007, 14, 13–23. [Google Scholar]
- Bodfish, J.W.; Symons, F.J.; Parker, D.E.; Lewis, M.H. Varieties of repetitive behavior in autism: Comparisons to mental retardation. J. Autism Dev. Disord. 2000, 30, 237–243. [Google Scholar] [CrossRef] [PubMed]
- Ökcün Akçamuş, M.Ç.; Bakkaloğlu, H.; Demir, Ş.; Bahap Kudret, Z. Otizm spektrum bozukluğunda Tekrarlayıcı Davranışlar Ölçeği-Revize Türkçe Sürümünün geçerlilik ve güvenilirlik çalışması. Anatol. J. Psychiatry/Anadolu Psikiyatr. Derg. 2019, 20, 65–72. [Google Scholar]
- Sugimoto, H.; Kakehi, M.; Satomi, Y.; Kamiguchi, H.; Jinno, F. Method development for the determination of 24S-hydroxycholesterol in human plasma without derivatization by high-performance liquid chromatography with tandem mass spectrometry in atmospheric pressure chemical ionization mode. J Sep Sci 2015, 38, 3516–3524. [Google Scholar] [CrossRef] [PubMed]
- Fombonne, E. The changing epidemiology of autism. J. Appl. Res. Intellect. Disabil. 2005, 18, 281–294. [Google Scholar] [CrossRef]
- Błażewicz, A.; Szymańska, I.; Astel, A.; Stenzel-Bembenek, A.; Dolliver, W.R.; Makarewicz, A. Assessment of changes over time of lipid profile, c-reactive protein level and body mass index in teenagers and young adults on different diets belonging to autism spectrum disorder. Nutrients 2020, 12, 2594. [Google Scholar] [CrossRef]
- Benachenhou, S.; Etcheverry, A.; Galarneau, L.; Dubé, J.; Çaku, A. Implication of hypocholesterolemia in autism spectrum disorder and its associated comorbidities: A retrospective case–control study. Autism Res. 2019, 12, 1860–1869. [Google Scholar] [CrossRef] [PubMed]
- Castro, K.; Faccioli, L.S.; Perry, I.S.; dos Santos Riesgo, R. Leptin and adiponectin correlations with body composition and lipid profile in children with Autism Spectrum Disorder. bioRxiv 2019. [Google Scholar] [CrossRef]
- Çaku, A.; Seidah, N.G.; Lortie, A.; Gagné, N.; Perron, P.; Dubé, J.; Corbin, F. New insights of altered lipid profile in Fragile X Syndrome. PLoS ONE 2017, 12, e0174301. [Google Scholar] [CrossRef] [PubMed]
- Kim, E.-K.; Neggers, Y.H.; Shin, C.-S.; Kim, E.; Kim, E.M. Alterations in lipid profile of autistic boys: A case control study. Nutr. Res. 2010, 30, 255–260. [Google Scholar] [CrossRef] [PubMed]
- Avar, S.; Taşar, M.; Tıraş, U.; Dallar, Y. 5-15 yaş çocuklarda serum lipid düzeyi ve etkileyen faktörler. Ege Tıp Derg. 2008, 47, 35–45. [Google Scholar]
- Bibbins-Domingo, K.; Grossman, D.C.; Curry, S.J.; Davidson, K.W.; Epling, J.W.; García, F.A.; Gillman, M.W.; Kemper, A.R.; Krist, A.H.; Kurth, A.E. Screening for lipid disorders in children and adolescents: US Preventive Services Task Force recommendation statement. JAMA 2016, 316, 625–633. [Google Scholar] [PubMed]
- Moses, L.; Katz, N.; Weizman, A. Metabolic profiles in adults with autism spectrum disorder and intellectual disabilities. Eur. Psychiatry 2014, 29, 397–401. [Google Scholar] [CrossRef] [PubMed]
- Gillberg, C.; Fernell, E.; Kočovská, E.; Minnis, H.; Bourgeron, T.; Thompson, L.; Allely, C.S. The role of cholesterol metabolism and various steroid abnormalities in autism spectrum disorders: A hypothesis paper. Autism Res. 2017, 10, 1022–1044. [Google Scholar] [CrossRef] [PubMed]
- Bretillon, L.; Lütjohann, D.; Ståhle, L.; Widhe, T.; Bindl, L.; Eggertsen, G.; Diczfalusy, U.; Björkhem, I. Plasma levels of 24S-hydroxycholesterol reflect the balance between cerebral production and hepatic metabolism and are inversely related to body surface. J. Lipid Res. 2000, 41, 840–845. [Google Scholar] [CrossRef]
- Rossignol, D.A.; Frye, R.E. A review of research trends in physiological abnormalities in autism spectrum disorders: Immune dysregulation, inflammation, oxidative stress, mitochondrial dysfunction and environmental toxicant exposures. Mol. Psychiatry 2012, 17, 389–401. [Google Scholar] [CrossRef]
- Czuba, E.; Steliga, A.; Lietzau, G.; Kowiański, P. Cholesterol as a modifying agent of the neurovascular unit structure and function under physiological and pathological conditions. Metab. Brain Dis. 2017, 32, 935–948. [Google Scholar] [CrossRef] [PubMed]
- Sebastião, A.M.; Colino-Oliveira, M.; Assaife-Lopes, N.; Dias, R.B.; Ribeiro, J.A. Lipid rafts, synaptic transmission and plasticity: Impact in age-related neurodegenerative diseases. Neuropharmacology 2013, 64, 97–107. [Google Scholar] [CrossRef] [PubMed]
- Ronemus, M.; Iossifov, I.; Levy, D.; Wigler, M. The role of de novo mutations in the genetics of autism spectrum disorders. Nat. Rev. Genet. 2014, 15, 133–141. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Doering, L.C. Reversing autism by targeting downstream mTOR signaling. Front. Cell. Neurosci. 2013, 7, 28. [Google Scholar] [CrossRef] [PubMed]
- Luu, W.; Sharpe, L.J.; Capell-Hattam, I.; Gelissen, I.C.; Brown, A.J. Oxysterols: Old tale, new twists. Annu. Rev. Pharmacol. Toxicol. 2016, 56, 447–467. [Google Scholar] [CrossRef] [PubMed]
- Björkhem, I.; Cedazo-Minguez, A.; Leoni, V.; Meaney, S. Oxysterols and neurodegenerative diseases. Mol. Asp. Med. 2009, 30, 171–179. [Google Scholar] [CrossRef] [PubMed]
- Leoni, V.; Caccia, C. 24S-hydroxycholesterol in plasma: A marker of cholesterol turnover in neurodegenerative diseases. Biochimie 2013, 95, 595–612. [Google Scholar] [CrossRef]
- Scott, K.W.; Chan, S.; Hill, A.; Guillemin, G.; Garner, B. Impact of 27-hydroxycholesterol on amyloid-β peptide production and ATP-binding cassette transporter expression in primary human neurons. J. Alzheimer’s Dis. 2009, 16, 121–131. [Google Scholar] [CrossRef]
- Popp, J.; Lewczuk, P.; Kölsch, H.; Meichsner, S.; Maier, W.; Kornhuber, J.; Jessen, F.; Lütjohann, D. Cholesterol metabolism is associated with soluble amyloid precursor protein production in Alzheimer’s disease. J. Neurochem. 2012, 123, 310–316. [Google Scholar] [CrossRef]
- Ray, B.; Sokol, D.K.; Maloney, B.; Lahiri, D.K. Finding novel distinctions between the sAPPα-mediated anabolic biochemical pathways in Autism Spectrum Disorder and Fragile X Syndrome plasma and brain tissue. Sci. Rep. 2016, 6, 26052. [Google Scholar] [CrossRef]
Sociodemographic Variables | ASD (n = 107) Mean (SD) n (%) | NA (n = 103) Mean (SD) n (%) | p |
---|---|---|---|
Child age (years) a | 9.54 (4.81) | 10.18 (4.91) | 0.301 |
Gender ᵇ | <0.001 | ||
Female | 24 (22.4) | 48 (46.6) | |
Male | 83 (77.6) | 55 (53.4) | |
Body mass index a | 19.28 (2.87) | 18.98 (2.68) | 0.463 |
Family type ᵇ | 0.335 | ||
Nuclear | 90 (84.1) | 88 (85.4) | |
Wide | 9 (8.4) | 6 (5.8) | |
Divorced | 8 (7.5) | 7 (6.8) | |
Parental Death | 0 | 2 (1.9) | |
Mothers’ age (years) a | 35.9 (5.18) | 37.2 (5.18) | 0.089 |
Fathers’ age (years) a | 38.71 (5.54) | 39.26 (6.48) | 0.266 |
Mothers’ education level ᵇ | 0.659 | ||
Less than high school | 39 (36.5) | 38 (36.9) | |
High school | 36 (33.6) | 38 (36.9) | |
College degree or higher | 32 (29.9) | 27 (26.2) | |
Fathers’ education level ᵇ | 0.946 | ||
Less than high school | 25 (23.4) | 23 (22.3) | |
High school | 35 (32.7) | 33 (32) | |
College degree or higher | 47 (43.9) | 47 (45.6) |
Clinical Characteristics | Frequency (N) | Percentage (%) |
---|---|---|
Autism Level | ||
Low | 20 | 18.7 |
Mid | 53 | 49.5 |
Severe | 34 | 31.8 |
Global Developmental Delay | ||
Yes | 89 | 83.2 |
No | 18 | 16.8 |
Alternative Treatment | ||
Yes | 28 | 26.2 |
No | 79 | 73.8 |
Restricted Nutrition | ||
Yes | 11 | 10.3 |
No | 96 | 89.7 |
SCALES | Mean ± Standard Deviation | |
Childhood Autism Rating Scale (CARS) | 39.48 ± 6.97 | |
Autism Behaviour Checklist (ABC) | ||
Sensory | 9.67 ± 4.28 | |
Relating Behaviors | 11.05 ± 5.03 | |
Body and object use | 10.97 ± 5.12 | |
Language | 10.13 ± 4.93 | |
Social and self-help | 10.63 ± 5.70 | |
Total | 52.46 ± 21.47 | |
Repetitive Behavior Scale-Revised (RBS-R-TV) | 25.44 ± 17.91 |
ASD Mean ± SD (Median) | NA Mean ± SD (Median) | p | |
---|---|---|---|
Total cholesterol (mg/dL) | 168.57 ± 31.18 (169) | 155.6 ± 29.39 (157) | 0.003 a |
Triglycerides (mg/dL) | 113.6 ± 77 (96) | 85.17 ± 50.1 (71.8) | <0.001 ᵇ |
LDL (mg/dL) | 100.05 ± 25.27 (98.1) | 89.98 ± 28.07 (90,2) | 0.008 a |
HDL (mg/dL) | 55.70 ± 14.23 (53.8) | 58.2 ± 12.18 (58) | 0.179 a |
ASD Mean ± SD (Median) | NA Mean ± SD (Median) | p | |||
---|---|---|---|---|---|
25 HC (µg/L) | 55.21 ± 40.72 (44.29) | 47.44 ± 42.21 (34.76) | 0.060 a | ||
Age ᵇ | rho | p | rho | p | |
−0.516 | <0.001 | −0.617 | <0.001 | ||
24S HC (µg/L) | 56.27 ± 36.18 (48.08) | 52.48 ± 44.83 (39.55) | 0.098 a | ||
Age ᵇ | rho | p | rho | p | |
−0.504 | <0.001 | −0.522 | <0.001 | ||
24 HC (µg/L) | 63.03 ± 44.34 (55.02) | 64.60 ± 69.50 (43.84) | 0.261 a | ||
Age ᵇ | rho | p | rho | p | |
−0.521 | <0.001 | −0.387 | <0.001 | ||
27R HC (µg/L) | 34.73 ± 24.24 (24.24) | 53.61 ± 41.68 (44.76) | 0.001 a | ||
Age ᵇ | rho | p | rho | p | |
−0.007 | 0.944 | −0.390 | <0.001 | ||
27S HC (µg/L) | 34.63 ± 22.36 (27.43) | 53.78 ± 39.86 (42.54) | <0.001 a | ||
Age ᵇ | rho | p | rho | p | |
0.039 | 0.695 | −0.306 | 0.002 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Menteşe Babayiğit, T.; Gümüş-Akay, G.; Uytun, M.Ç.; Doğan, Ö.; Serdar, M.A.; Efendi, G.Y.; Erman, A.G.; Yürümez, E.; Öztop, D.B. Investigation of Liver X Receptor Gene Variants and Oxysterol Dysregulation in Autism Spectrum Disorder. Children 2024, 11, 551. https://doi.org/10.3390/children11050551
Menteşe Babayiğit T, Gümüş-Akay G, Uytun MÇ, Doğan Ö, Serdar MA, Efendi GY, Erman AG, Yürümez E, Öztop DB. Investigation of Liver X Receptor Gene Variants and Oxysterol Dysregulation in Autism Spectrum Disorder. Children. 2024; 11(5):551. https://doi.org/10.3390/children11050551
Chicago/Turabian StyleMenteşe Babayiğit, Tuğba, Güvem Gümüş-Akay, Merve Çikili Uytun, Özlem Doğan, Muhittin A. Serdar, Gökçe Yağmur Efendi, Ayşe Gökçe Erman, Esra Yürümez, and Didem Behice Öztop. 2024. "Investigation of Liver X Receptor Gene Variants and Oxysterol Dysregulation in Autism Spectrum Disorder" Children 11, no. 5: 551. https://doi.org/10.3390/children11050551