Deciphering Fire Blight: From Erwinia amylovora Ecology to Genomics and Sustainable Control
Abstract
1. Introduction
1.1. Host Range and Specificity
2. Geographical Distribution
3. Genetics
4. Polyphasic Approaches to Characterize Erwinia amylovora Isolates
Molecular Typing Method | References |
---|---|
Random amplified polymorphic DNA (RAPD) | [36,40,42] |
Pulse field gel electrophoresis (PFGE) | [36,91] |
Rep-PCR | [84,92] |
Variable number of tandem repeats (VNTR) | [72,86,93] |
Multiple-locus VNTR analysis (MLVA) | [57,94] |
Restriction fragment length polymorphism (RFLP) | [40,95] |
PCR ribotyping | [36] |
Fluorescent amplified fragment length polymorphism (fAFLP) | [92] |
Amplified ribosomal DNA restriction analysis (ARDRA) | [95] |
Multi-locus sequencing analysis (MLSA) | [85] |
Multi-locus sequence typing (MLST) | [86] |
Short-sequence DNA repeats (SSR) | [45] |
Clustered regularly interspaced short palindromic repeats (CRISPR) | [46,51,62,63,69,87,88] |
5. Management of Fire Blight with Sustainable Compounds
5.1. Antagonists
5.2. Bacteriophages
5.3. Essential Oils
5.4. Antimicrobial Peptides
6. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Oh, C.S.; Beer, S.V. Molecular genetics of Erwinia amylovora involved in the development of fire blight. FEMS Microbiol. Lett. 2005, 253, 185–192. [Google Scholar] [CrossRef] [PubMed]
- van der Zwet, T.; Orolaza-Halbrendt, N.; Zeller, W. Fire Blight: History, Biology, and Management; The American Phytopathological Society: Saint Paul, MN, USA, 2016; ISBN 978-0-89054-483-9. [Google Scholar]
- Pel, C.; Schenk, M.; Delbianco, A.; Vos, S. Pest survey card on Erwinia amylovora. EFSA Support. Publ. 2021, 18, 6767E. [Google Scholar] [CrossRef]
- Marco-Noales, E.; Peñalver, J.; Navarro, I.; Gorris, M.T.; Morente, M.C.; Balguerías, C.; Ramírez, J.A.; Recio, C.; De La Hermosa, T.R.; Sancho, R.; et al. Iberian Wild Pear (Pyrus bourgaeana) is a New Host of Erwinia amylovora, the Causal Agent of Fire Blight. Plant Dis. 2017, 101, 502. [Google Scholar] [CrossRef]
- CABI. Erwinia amylovora (Fireblight). Available online: https://www.cabi.org/isc/datasheet/21908#top-page (accessed on 4 January 2022).
- EPPO. Erwinia amylovora Datasheet. Available online: https://gd.eppo.int/taxon/ERWIAM (accessed on 4 October 2024).
- Adeolu, M.; Alnajar, S.; Naushad, S.; SGupta, R. Genome-based phylogeny and taxonomy of the ‘Enterobacteriales’: Proposal for Enterobacterales ord. nov. divided into the families Enterobacteriaceae, Erwiniaceae fam. nov., Pectobacteriaceae fam. nov., Yersiniaceae fam. nov., Hafniaceae fam. nov., Morgane. Int. J. Syst. Evol. Microbiol. 2016, 66, 5575–5599. [Google Scholar] [CrossRef]
- EPPO. EPPO A1 and A2 lists of pests recommended for regulation as quarantine pests. EPPO Standards. 2021. Available online: https://www.eppo.int/media/uploaded_images/ACTIVITIES/plant_quarantine/pm1-002-28-en.pdf (accessed on 4 October 2024).
- Zhao, Y.; Tian, Y.; Wang, L.; Geng, G.; Zhao, W.; Hu, B.; Zhao, Y. Fire blight disease, a fast-approaching threat to apple and pear production in China. J. Integr. Agric. 2019, 18, 815–820. [Google Scholar] [CrossRef]
- Norelli, J.L.; Jones, A.L.; Aldwinckle, H.S. Fire Blight Management in the Twenty-First Century: Using New Technologies that Enhance Host Resistance in Apple. Plant Dis. 2003, 87, 756–765. [Google Scholar] [CrossRef]
- Vanneste, J. What is Fire Blight? Who is Erwinia amylovora? How to Control it? In Fire Blight, The Disease and Its Causative Agent, Erwinia amylovora; Vanneste, J., Ed.; CABI: Wallingford, UK, 2000. [Google Scholar]
- Gusberti, M.; Klemm, U.; Meier, M.S.; Maurhofer, M.; Hunger-Glaser, I. Fire Blight Control: The Struggle Goes On. A Comparison of Different Fire Blight Control Methods in Switzerland with Respect to Biosafety, Efficacy and Durability. Int. J. Environ. Res. Public Health 2015, 12, 11422–11447. [Google Scholar] [CrossRef]
- Jiang, X.; Cassey, A.J.; Marsh, T.L. Economic consequences for tree fruit intermediaries from shocks. J. Agric. Appl. Econ. 2017, 49, 592–616. [Google Scholar] [CrossRef]
- Emeriewen, O.F.; Wöhner, T.; Flachowsky, H.; Peil, A. Malus hosts–Erwinia amylovora interactions: Strain pathogenicity and resistance mechanisms. Front. Plant Sci. 2019, 10, 551. [Google Scholar] [CrossRef]
- Santander, R.D.; Oliver, J.D.; Biosca, E.G. Cellular, physiological, and molecular adaptive responses of Erwinia amylovora to starvation. FEMS Microbiol. Ecol. 2014, 88, 258–271. [Google Scholar] [CrossRef]
- Martins, P.M.M.; Merfa, M.V.; Takita, M.A.; De Souza, A.A. Persistence in phytopathogenic bacteria: Do we know enough? Front. Microbiol. 2018, 9, 1099. [Google Scholar] [CrossRef] [PubMed]
- Griffith, C. Fire Blight: The Foundation of Phytobacteriology; The American Phytopathological Society: Saint Paul, MN, USA, 2003. [Google Scholar]
- Mansfield, J.; Genin, S.; Magori, S.; Citovsky, V.; Sriariyanum, M.; Ronald, P.; Dow, M.; Verdier, V.; Beer, S.V.; Machado, M.A.; et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 614–629. [Google Scholar] [CrossRef] [PubMed]
- Turland, N.J.; Wiersema, J.; Barrie, F.; Greuter, W.; Hawksworth, D.; Herendeen, P.; Knapp, S.; Kusber, W.; Li, D.; Marhold, K.; et al. International Code of Nomenclature for Algae, Fungi, and Plants (Shenzhen Code) Adopted by the Nineteenth International Botanical Congress, Shenzhen, China, 23–29 July 2017; Koeltz Botanical Books: Glashütten, Germany, 2018. [Google Scholar]
- Zeng, Q.; Cui, Z.; Wang, J.; Childs, K.L.; Sundin, G.W.; Cooley, D.R.; Yang, C.H.; Garofalo, E.; Eaton, A.; Huntley, R.B.; et al. Comparative genomics of Spiraeoideae-infecting Erwinia amylovora strains provides novel insight to genetic diversity and identifies the genetic basis of a low-virulence strain. Mol. Plant Pathol. 2018, 19, 1652–1666. [Google Scholar] [CrossRef] [PubMed]
- Weißhaupt, S.; Köhl, L.; Kunz, S.; Hinze, M.; Ernst, M.; Schmid, A.; Voegele, R.T. Alternative inoculum sources for fire blight: The potential role of fruit mummies and non-host plants. Plant Pathol. 2016, 65, 470–483. [Google Scholar] [CrossRef]
- de la Peña-Baca, D.A.; Romo-Chacón, A.; Rios-Velasco, C.; Olivas-Orozco, G.I.; Ornelas-Paz, J.d.J.; Acosta-Muñiz, C.H. Primary inoculum of Erwinia amylovora: Alternative sources and viable but non-culturable state: A review. J. Plant Dis. Prot. 2023, 130, 143–155. [Google Scholar] [CrossRef]
- Parcey, M.; Gayder, S.; Morley-Senkler, V.; Bakkeren, G.; Úrbez-Torres, J.R.; Ali, S.; Castle, A.J.; Svircev, A.M. Comparative genomic analysis of Erwinia amylovora reveals novel insights in phylogenetic arrangement, plasmid diversity, and streptomycin resistance. Genomics 2020, 112, 3762–3772. [Google Scholar] [CrossRef]
- Braun, P.G.; Hildebrand, P.D. Infection, carbohydrate utilization, and protein profiles of apple, pear, and raspberry isolates of Erwinia amylovora. Can. J. Plant Pathol. 2005, 27, 338–346. [Google Scholar] [CrossRef]
- Rezzonico, F.; Braun-Kiewnick, A.; Mann, R.A.; Rodoni, B.; Goesmann, A.; Duffy, B.; Smits, T.H.M. Lipopolysaccharide biosynthesis genes discriminate between Rubus- and Spiraeoideae-infective genotypes of Erwinia amylovora. Mol. Plant Pathol. 2012, 13, 975–984. [Google Scholar] [CrossRef]
- Sprecher, C. Comparative Genomics Provides New Insights into Host Specificity and Evolutionary History of Erwinia amylovora. Master’s Thesis, Zürcher Hochschule für Angewandte Wissenschaften (ZHAW), Wädenswil, Switzerland, 2021. [Google Scholar]
- Borruso, L.; Salomone-Stagni, M.; Polsinelli, I.; Otto Schmitt, A.; Benini, S. Conservation of Erwinia amylovora pathogenicity-relevant genes among Erwinia genomes. Arch. Microbiol. 2017, 199, 1335–1344. [Google Scholar] [CrossRef]
- Ham, H.; Park, D.S. Novel approach toward the understanding of genetic diversity based on the two types of amino acid repeats in Erwinia amylovora. Sci. Rep. 2023, 13, 17876. [Google Scholar] [CrossRef]
- Rezzonico, F.; Emeriewen, O.F.; Zeng, Q.; Peil, A.; Smits, T.H.M.; Sundin, G.W. Burning questions for fire blight research: I. Genomics and evolution of Erwinia amylovora and analyses of host-pathogen interactions. J. Plant Pathol. 2024, 106, 797–810. [Google Scholar] [CrossRef]
- Puławska, J.; Sobiczewski, P. Phenotypic and genetic diversity of Erwinia amylovora: The causal agent of fire blight. Trees-Struct. Funct. 2012, 26, 3–12. [Google Scholar] [CrossRef]
- Denning, W. Transactions of the Society for the Promotion of Useful Arts, in the State of New York; Forgotten Books: London, UK, 2019. [Google Scholar]
- Kurz, M.; Carnal, S.; Dafny-Yelin, M.; Mairesse, O.; Gottsberger, R.A.; Ivanović, M.; Grahovac, M.; Lagonenko, A.L.; Drenova, N.; Zharmukhamedova, G.; et al. Tracking the dissemination of Erwinia amylovora in the Eurasian continent using a PCR targeted on the duplication of a single CRISPR spacer. Phytopathol. Res. 2021, 3, 18. [Google Scholar] [CrossRef]
- Sletten, A.; Talgø, V.; Rafoss, T.; Melbøe, N.S. Fire blight in norway: A review of strategies and control measures from 1986 to 2016. J. Plant Pathol. 2017, 99, 137–139. [Google Scholar] [CrossRef]
- Jock, S.; Wensing, A.; Pulawska, J.; Drenova, N.; Dreo, T.; Geider, K. Molecular analyses of Erwinia amylovora strains isolated in Russia, Poland, Slovenia and Austria describing further spread of fire blight in Europe. Microbiol. Res. 2013, 168, 447–454. [Google Scholar] [CrossRef] [PubMed]
- Pucci, N.; L’Aurora, A.; Loreti, S. Fire blight: First report in Latium, Italy. J. Plant Pathol. 2013, 95, 663. [Google Scholar] [CrossRef]
- Donat, V.; Biosca, E.G.; Peñalver, J.; López, M.M. Exploring diversity among Spanish strains of Erwinia amylovora and possible infection sources. J. Appl. Microbiol. 2007, 103, 1639–1649. [Google Scholar] [CrossRef] [PubMed]
- Gaganidze, D.L.; Aznarashvili, M.A.; Sadunishvili, T.A.; Abashidze, E.O.; Gureilidze, M.A.; Gvritishvili, E.S. Fire blight in Georgia. Ann. Agrar. Sci. 2018, 16, 12–16. [Google Scholar] [CrossRef]
- Amashukeli, N.; Gaganidze, D.; Aznarashvili, M.; Kharadze, S.; Sturua, N.; Rezzonico, F.; Sadunishvili, T. Phenotypic Variability of Erwinia amylovora from Pome Fruits in Georgia. Bull. Georg. Natl. Acad. Sci. 2023, 17, 69–74. [Google Scholar]
- Aysan, Y.; Mirik, M.; Saygili, H.; Sahin, F.; Kotan, R. Phenotypic characterization of Erwinia amylovora from pome fruits in Turkey. Acta Hortic. 2006, 704, 459–463. [Google Scholar] [CrossRef]
- Popović, T.; Jelušić, A.; Živković, L.; Živković, N.; Iličić, R.; Stanisavljević, R.; Stanković, S. Identification, genetic characterization and virulence of Serbian Erwinia amylovora isolates. Eur. J. Plant Pathol. 2020, 157, 857–872. [Google Scholar] [CrossRef]
- Dimitrova, E.; Andreev, L. Fireblight situation in Bulgaria and measures undertaken by the NPPO. EPPO Bull. 2004, 34, 343–345. [Google Scholar] [CrossRef]
- Constantinescu, F.; Severin, V.; Manole, F.; Oprea, E.; Dascǎlu, G.; Saviuc, C.; Şesan, T.E.; Radulescu, V. Status of fire blight (Erwinia amylovora) disease in Romania: Distribution, pathogen characterization and disease control. Acta Hortic. 2011, 896, 505–510. [Google Scholar] [CrossRef]
- Sobiczewski, P.; Zurawicz, E.; Berczyński, S.; Lewandowski, M. Fire blight susceptibility of new apple cultivars and clones from Poland. Acta Hortic. 2006, 704, 551–555. [Google Scholar] [CrossRef]
- Baranauskaite, L.; Jogaite, V.; Jankuviene, L. A three-year study of fireblight in Lithuania. Zemdirbyste 2008, 95, 19–26. [Google Scholar]
- Végh, A.; Hevesi, M.; Pájtli, É.; Palkovics, L. Characterization of Erwinia amylovora strains from Hungary. Eur. J. Plant Pathol. 2017, 147, 455–461. [Google Scholar] [CrossRef]
- Mendes, R.J.; Luz, J.P.; Santos, C.; Tavares, F. CRISPR genotyping as complementary tool for epidemiological surveillance of Erwinia amylovora outbreaks. PLoS ONE 2021, 16, e0250280. [Google Scholar] [CrossRef]
- Saad, A.T.; Hanna, L.; Asly, O.J.; Choueiri, E. The distribution and host range of the first serious outbreak of fire blight in lebanon. Acta Hortic. 1999, 489, 65–68. [Google Scholar] [CrossRef]
- Manulis, S.; Kleitman, F.; Dror, O.; David, I.; Zutra, D. Characterization of the Erwinia amylovora population in Israel. Phytoparasitica 1997, 26, 39–46. [Google Scholar] [CrossRef]
- Ammouneh, H.; Arabi, M.I.E.; Al-Daoude, A. The first record and distribution of the fire blight pathogen Erwinia amylovora in Syria. Australas. Plant Pathol. 2008, 37, 137–140. [Google Scholar] [CrossRef]
- Rahnama, K.; Mazarei, M. The status of fire blight on pome fruits in Iran. Acta Hortic. 2002, 590, 99–102. [Google Scholar] [CrossRef]
- Doolotkeldieva, T.; Bobushova, S.; Carnal, S.; Rezzonico, F. Genetic characterization of Erwinia amylovora isolates detected in the wild walnut-fruit forest of South Kyrgyzstan. J. Plant Pathol. 2021, 103, 109–120. [Google Scholar] [CrossRef]
- Djaimurzina, A.; Umiralieva, Z.; Zharmukhamedova, G.; Born, Y.; Bühlmann, A.; Rezzonico, F. Detection of the causative agent of fire blight—Erwinia amylovora (Burrill) Winslow et al.—In the Southeast of Kazakhstan. Acta Hortic. 2014, 1056, 129–132. [Google Scholar] [CrossRef]
- Sun, W.; Gong, P.; Zhao, Y.; Ming, L.; Zeng, Q.; Liu, F. Current Situation of Fire Blight in China. Phytopathology 2023, 113, 2143–2151. [Google Scholar] [CrossRef] [PubMed]
- Park, D.H.; Lee, Y.G.; Kim, J.S.; Cha, J.S.; Oh, C.S. Current status of fire blight caused by Erwinia amylovora and action for its management in Korea. J. Plant Pathol. 2017, 99, 59–63. [Google Scholar] [CrossRef]
- Jik Lee, H.; Woo Lee, S.; Suh, S.J.; Hyun, I.H. Recent spread and potential pathways for fire blight in South Korea. EPPO Bull. 2022, 52, 135–140. [Google Scholar] [CrossRef]
- Fatmi, M.; Bougsiba, M.; Saoud, H. First Report of Fire Blight Caused by Erwinia amylovora on Pear, Apple, and Quince in Morocco. Plant Dis. 2008, 92, 314. [Google Scholar] [CrossRef]
- Tafifet, L.; Raio, A.; Holeva, M.C.; Dikhai, R.; Kouskoussa, C.O.; Cesbron, S.; Krimi, Z. Molecular characterization of Algerian Erwinia amylovora strains by VNTR analysis and biocontrol efficacy of Bacillus spp. and Pseudomonas brassicacearum antagonists. Eur. J. Plant Pathol. 2020, 156, 867–883. [Google Scholar] [CrossRef]
- Cristian, M.F.; Mirela, C.; Mihaela, S.; Emil, C.; Alina, F.; Mădălina, M.; Dorin, S. Behavior of some apple varieties grown under superintensive system to fire blight (Erwinia amylovora) attack. Fruit Grow. Res. 2018, 34, 94–105. [Google Scholar] [CrossRef]
- Sebaihia, M.; Bocsanczy, A.M.; Biehl, B.S.; Quail, M.A.; Perna, N.T.; Glasner, J.D.; DeClerck, G.A.; Cartinhour, S.; Schneider, D.J.; Bentley, S.D.; et al. Complete genome sequence of the plant pathogen Erwinia amylovora strain ATCC 49946. J. Bacteriol. 2010, 192, 2020–2021. [Google Scholar] [CrossRef]
- Smits, T.H.M.; Rezzonico, F.; Kamber, T.; Blom, J.; Goesmann, A.; Frey, J.E.; Duffy, B. Complete genome sequence of the fire blight pathogen Erwinia amylovora CFBP 1430 and comparison to other Erwinia spp. Mol. Plant-Microbe Interact. 2010, 23, 384–393. [Google Scholar] [CrossRef] [PubMed]
- Song, J.Y.; Yun, Y.H.; Kim, G.D.; Kim, S.H.; Lee, S.J.; Kim, J.F. Genome analysis of Erwinia amylovora strains responsible for a fire blight outbreak in korea. Plant Dis. 2021, 105, 1143–1152. [Google Scholar] [CrossRef]
- McGhee, G.C.; Sundin, G.W. Erwinia amylovora CRISPR elements provide new tools for evaluating strain diversity and for microbial source tracking. PLoS ONE 2012, 7, e41706. [Google Scholar] [CrossRef]
- Tancos, K.A.; Cox, K.D. Exploring diversity and origins of streptomycin-resistant Erwinia amylovora isolates in New York through CRISPR spacer arrays. Plant Dis. 2016, 100, 1307–1313. [Google Scholar] [CrossRef] [PubMed]
- Llop, P.; Donat, V.; Rodríguez, M.; Cabrefiga, J.; Ruz, L.; Palomo, J.L.; Montesinos, E.; López, M.M. An Indigenous Virulent Strain of Erwinia amylovora Lacking the Ubiquitous Plasmid pEA29. Phytopathology 2006, 96, 900–907. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Falkenstein, H.; Zeller, W.; Geider, K. The 29 kb Plasmid, Common in Strains of Erwinia amylovora, Modulates Development of Fireblight Symptoms. Microbiology 1989, 135, 2643–2650. [Google Scholar] [CrossRef][Green Version]
- Mohammadi, M. Enhanced colonization and pathogenicity of Erwinia amylovora strains transformed with the near-ubiquitous pEA29 plasmid on pear and apple. Plant Pathol. 2010, 59, 252–261. [Google Scholar] [CrossRef]
- Llop, P.; Cabrefiga, J.; Smits, T.H.M.; Dreo, T.; Barbe, S.; Pulawska, J.; Bultreys, A.; Blom, J.; Duffy, B.; Montesinos, E.; et al. Erwinia amylovora Novel Plasmid pEI70: Complete Sequence, Biogeography, and Role in Aggressiveness in the Fire Blight Phytopathogen. PLoS ONE 2011, 6, e28651. [Google Scholar] [CrossRef]
- Singh, J.; Khan, A. Distinct patterns of natural selection determine sub-population structure in the fire blight pathogen, Erwinia amylovora. Sci. Rep. 2019, 9, 14017. [Google Scholar] [CrossRef]
- Förster, H.; McGhee, G.C.; Sundin, G.W.; Adaskaveg, J.E. Characterization of Streptomycin Resistance in Isolates of Erwinia amylovora in California. Phytopathology 2015, 105, 1302–1310. [Google Scholar] [CrossRef]
- Mann, R.A.; Smits, T.H.M.; Bühlmann, A.; Blom, J.; Goesmann, A.; Frey, J.E.; Plummer, K.M.; Beer, S.V.; Luck, J.; Duffy, B.; et al. Comparative Genomics of 12 Strains of Erwinia amylovora Identifies a Pan-Genome with a Large Conserved Core. PLoS ONE 2013, 8. [Google Scholar] [CrossRef]
- Albanese, D.; Cainelli, C.; Gualandri, V.; Larger, S.; Pindo, M.; Donati, C. Genome sequencing provides new insights on the distribution of Erwinia amylovora lineages in northern Italy. Environ. Microbiol. Rep. 2022, 14, 584–590. [Google Scholar] [CrossRef] [PubMed]
- Dardouri, S.; Chehimi, S.; Murillo, J.; Hajlaoui, M.R. Molecular characterization of tunisian strains of Erwinia amylovora. J. Plant Pathol. 2017, 99, 333–337. [Google Scholar] [CrossRef]
- EPPO. PM 7/20 (3) Erwinia amylovora. EPPO Bull. 2022, 52, 198–224. [Google Scholar] [CrossRef]
- Mitrev, S.; Kostadinovska, E. Isolation and molecular determination of the fire blight pathogen, Erwinia amylovora, isolated from apple trees in the republic of Macedonia. J. Plant Pathol. 2016, 98, 577–580. [Google Scholar] [CrossRef]
- Schwarczinger, I.; Kolozsváriné Nagy, J.; Künstler, A.; Szabó, L.; Geider, K.; Király, L.; Pogány, M. Characterization of Myoviridae and Podoviridae family bacteriophages of Erwinia amylovora from Hungary—potential of application in biological control of fire blight. Eur. J. Plant Pathol. 2017, 149, 639–652. [Google Scholar] [CrossRef]
- Kharadi, R.R.; Castiblanco, L.F.; Waters, C.M.; Sundin, G.W. Phosphodiesterase genes regulate amylovoran production, biofilm formation, and virulence in Erwinia amylovora. Appl. Environ. Microbiol. 2019, 85, e02233-18. [Google Scholar] [CrossRef]
- Klee, S.M.; Sinn, J.P.; Christian, E.; Holmes, A.C.; Zhao, K.; Lehman, B.L.; Peter, K.A.; Rosa, C.; McNellis, T.W. Virulence genetics of an Erwinia amylovora putative polysaccharide transporter family member. J. Bacteriol. 2020, 202, e00390-20. [Google Scholar] [CrossRef]
- Obradovic, D.; Balaz, J.; Kevresan, S. Detection of Erwinia amylovora by novel chromosomal polymerase chain reaction primers. Microbiology 2007, 76, 748–756. [Google Scholar] [CrossRef]
- Taylor, R.K.; Guilford, P.J.; Clark, R.G.; Hale, C.N.; Forster, R.L.S. Detection of Erwinia amylovora in plant material using novel polymerase chain reaction (PCR) primers. N. Z. J. Crop Hortic. Sci. 2001, 29, 35–43. [Google Scholar] [CrossRef]
- Pirc, M.; Ravnikar, M.; Tomlinson, J.; Dreo, T. Improved fireblight diagnostics using quantitative real-time PCR detection of Erwinia amylovora chromosomal DNA. Plant Pathol. 2009, 58, 872–881. [Google Scholar] [CrossRef]
- Shin, D.S.; Heo, G.I.l.; Son, S.H.; Oh, C.S.; Lee, Y.K.; Cha, J.S. Development of an Improved Loop-Mediated Isothermal Amplification Assay for On-Site Diagnosis of Fire Blight in Apple and Pear. Plant Pathol. J. 2018, 34, 191–198. [Google Scholar] [CrossRef]
- Gottsberger, R.A. Development and evaluation of a real-time PCR assay targeting chromosomal DNA of Erwinia amylovora. Lett. Appl. Microbiol. 2010, 51, 285–292. [Google Scholar] [CrossRef]
- Ham, H.; Kim, K.; Yang, S.; Kong, H.G.; Lee, M.-H.; Jin, Y.J.; Park, D.S. Discrimination and Detection of Erwinia amylovora and Erwinia pyrifoliae with a Single Primer Set. Plant Pathol. J. 2022, 38, 194–202. [Google Scholar] [CrossRef]
- Gavrilović, V.; Ivanović, Z.; Popović, T.; Živković, S. Characterization of Erwinia amylovora strains isolated from quince trees in Serbia using REP-PCR method. Acta Hortic. 2014, 1056, 169–172. [Google Scholar] [CrossRef]
- Doolotkeldieva, T.; Bobushova, S.; Schuster, C.; Konurbaeva, M.; Leclerque, A. Isolation and genetic characterization of Erwinia amylovora bacteria from Kyrgyzstan. Eur. J. Plant Pathol. 2019, 155, 677–686. [Google Scholar] [CrossRef]
- Refahi, M.; Baghaee-Ravari, S.; Mahdikhani-Moghaddam, E. Exploring possible variation among Iranian Erwinia amylovora strains using multilocus typing and tandem repeat analysis. J. Agric. Sci. Technol. 2017, 19, 745–754. [Google Scholar]
- Rezzonico, F.; Smits, T.H.M.; Duffy, B. Diversity, evolution, and functionality of clustered regularly interspaced short palindromic repeat (CRISPR) regions in the fire blight pathogen Erwinia amylovora. Appl. Environ. Microbiol. 2011, 77, 3819–3829. [Google Scholar] [CrossRef]
- Gaganidze, D.; Sadunishvili, T.; Aznarashvili, M.; Abashidze, E.; Gurielidze, M.; Carnal, S.; Rezzonico, F.; Zubadalashvili, M. Fire blight distribution in Georgia and characterization of selected Erwinia amylovora isolates. J. Plant Pathol. 2021, 103, 121–129. [Google Scholar] [CrossRef]
- Wallis, A.; Cox, K.D. Examining Spatial Distribution and Spread of Fire Blight in Apple Orchards: Two Case Studies. Plant Heal. Prog. 2021, 22, 445–449. [Google Scholar] [CrossRef]
- Parcey, M.; Gayder, S.; Castle, A.J.; Svircev, A.M. Function and Application of the CRISPR-Cas System in the Plant Pathogen Erwinia amylovora. Appl. Environ. Microbiol. 2022, 88, e0251321. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Merighi, M.; Bazzi, C.; Geider, K. Genomic analysis by pulsed-field gel electrophoresis of Erwinia amylovora strains from the Mediterranean region including Italy. J. Plant Pathol. 1998, 80, 225–232. [Google Scholar]
- Yaich, M.; Fatmi, M.; Bougsiba, M.; Valentini, F.; Scuderi, G.; D’onghia, A.M.; Cirvilleri, G. Fire blight (Erwinia amylovora [Burrill] Winslow) in Morocco: Importance, geographical distribution and characterization. Phytopathol. Mediterr. 2011, 50, 212–227. [Google Scholar] [CrossRef]
- Hannou, N.; Llop, P.; Faure, D.; López, M.M.; Moumni, M. Characterization of Erwinia amylovora Strains from Middle Atlas Mountains in Morocco by PCR Based on Tandem Repeat Sequences. Eur. J. Plant Pathol. 2013, 136, 665–674. [Google Scholar] [CrossRef]
- Bühlmann, A.; Dreo, T.; Rezzonico, F.; Pothier, J.F.; Smits, T.H.M.; Ravnikar, M.; Frey, J.E.; Duffy, B. Phylogeography and population structure of the biologically invasive phytopathogen Erwinia amylovora inferred using minisatellites. Environ. Microbiol. 2014, 16, 2112–2125. [Google Scholar] [CrossRef]
- Barionovi, D.; Giorgi, S.; Stoeger, A.R.; Ruppitsch, W.; Scortichini, M. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29. J. Appl. Microbiol. 2006, 100, 1084–1094. [Google Scholar] [CrossRef]
- Fei, N.; Song, B.; Yang, Y.; Zhu, X.; Guan, W.; Zhao, T. Draft Genome Sequence Data for Erwinia amylovora Strain S618-2-2 Isolated from Pyrus Sinkiangensis in China. PhytoFrontiers 2023, 3, 694–696. [Google Scholar] [CrossRef]
- Frey, J.E.; Frey, B.; Frei, D.; Blaser, S.; Gueuning, M.; Bühlmann, A. Next generation biosecurity: Towards genome based identification to prevent spread of agronomic pests and pathogens using nanopore sequencing. PLoS ONE 2022, 17, e0270897. [Google Scholar] [CrossRef]
- Mendes, R.J.; Amaro, C.; Luz, J.P.; Tavares, F.; Santos, C. Variability within a clonal population of Erwinia amylovora disclosed by phenotypic analysis. PeerJ 2022, 10, e13695. [Google Scholar] [CrossRef]
- European Commission. Farm to Fork Strategy. Available online: https://food.ec.europa.eu/horizontal-topics/farm-fork-strategy_en (accessed on 4 October 2024).
- European Commission. Commission Regulation (EC) No 473/2002. Off. J. Eur. Communities 2002. [Google Scholar]
- McManus, P.S.; Stockwell, V.O.; Sundin, G.W.; Jones, A.L. Antibiotic use in plant agriculture. Annu. Rev. Phytopathol. 2002, 40, 443–465. [Google Scholar] [CrossRef] [PubMed]
- Lamichhane, J.R.; Osdaghi, E.; Behlau, F.; Köhl, J.; Jones, J.B.; Aubertot, J.N. Thirteen decades of antimicrobial copper compounds applied in agriculture. A review. Agron. Sustain. Dev. 2018, 38, 28. [Google Scholar] [CrossRef]
- Acimovic, S.A.G.; Meredith, C.L.; Santander, R.D.; Khodadadi, F. Proof of Concept for Shoot Blight and Fire Blight Canker Management with Postinfection Spray Applications of Prohexadione-Calcium and Acibenzolar-S-Methyl in Apple. Plant Dis. 2021, 105, 4095–4105. [Google Scholar] [CrossRef] [PubMed]
- Malnoy, M.; Martens, S.; Norelli, J.L.; Barny, M.A.; Sundin, G.W.; Smits, T.H.M.; Duffy, B. Fire blight: Applied genomic insights of the pathogen and host. Annu. Rev. Phytopathol. 2012, 50, 475–494. [Google Scholar] [CrossRef]
- Kamber, T.; Smits, T.H.M.; Rezzonico, F.; Duffy, B. Genomics and current genetic understanding of Erwinia amylovora and the fire blight antagonist Pantoea vagans. Trees–Struct. Funct. 2012, 26, 227–238. [Google Scholar] [CrossRef]
- Mechan Llontop, M.E.; Hurley, K.; Tian, L.; Bernal Galeano, V.A.; Wildschutte, H.K.; Marine, S.C.; Yoder, K.S.; Vinatzer, B.A. Exploring Rain as Source of Biological Control Agents for Fire Blight on Apple. Front. Microbiol. 2020, 11, 199. [Google Scholar] [CrossRef] [PubMed]
- Johnson, K.B.; Stockwell, V.O. Management of fire blight: A case study in microbial ecology. Annu. Rev. Phytopathol. 1998, 36, 227–248. [Google Scholar] [CrossRef]
- Broggini, G.A.L.; Duffy, B.; Holliger, E.; Schärer, H.J.; Gessler, C.; Patocchi, A. Detection of the fire blight biocontrol agent Bacillus subtilis BD170 (Biopro®) in a Swiss apple orchard. Eur. J. Plant Pathol. 2005, 111, 93–100. [Google Scholar] [CrossRef]
- Stockwell, V.O.; Johnson, K.B.; Sugar, D.; Loper, J.E. Control of fire blight by Pseudomonas fluorescens A506 and Pantoea vagans C9-1 applied as single strains and mixed inocula. Phytopathology 2010, 100, 1330–1339. [Google Scholar] [CrossRef]
- Rezzonico, F.; Smits, T.H.; Montesinos, E.; Frey, J.E.; Duffy, B. Genotypic comparison of Pantoea agglomerans plant and clinical strains. BMC Microbiol. 2009, 9, 204. [Google Scholar] [CrossRef]
- Pusey, P.L.; Stockwell, V.O.; Rudell, D.R. Antibiosis and acidification by Pantoea agglomerans strain E325 may contribute to suppression of Erwinia amylovora. Phytopathology 2008, 98, 1136–1143. [Google Scholar] [CrossRef] [PubMed]
- Neeno-Eckwall, E.C.; Kinkel, L.L.; Schottel, J.L. Competition and antibiosis in the biological control of potato scab. Can. J. Microbiol. 2001, 47, 332–340. [Google Scholar] [CrossRef]
- Francés, J.; Bonaterra, A.; Moreno, M.C.; Cabrefiga, J.; Badosa, E.; Montesinos, E. Pathogen aggressiveness and postharvest biocontrol efficiency in Pantoea agglomerans. Postharvest Biol. Technol. 2006, 39, 299–307. [Google Scholar] [CrossRef]
- Gromyko, O.; Tistechok, S.; Roman, I.; Aravitska, O.; Luzhetskyy, A.; Parnikoza, I.; Fedorenko, V. Isolation and characterization of culturable actinobacteria associated with Polytrichum strictum (Galindez Island, the maritime Antarctic). Ukr. Antarct. J. 2021, 2021, 82–97. [Google Scholar] [CrossRef]
- Dagher, F.; Nickzad, A.; Zheng, J.; Hoffmann, M.; Déziel, E. Characterization of the biocontrol activity of three bacterial isolates against the phytopathogen Erwinia amylovora. Microbiologyopen 2021, 10, e1202. [Google Scholar] [CrossRef]
- Arab, M.; Ahani Azari, A. Antagonistic potential of rhizospheric and endophytic bacteria against Fire blight, caused by Erwinia amylovora. Int. J. Mol. Clin. Microbiol. 2020, 10, 1331–1338. [Google Scholar]
- Sharifazizi, M.; Harighi, B.; Sadeghi, A. Evaluation of biological control of Erwinia amylovora, causal agent of fire blight disease of pear by antagonistic bacteria. Biol. Control. 2017, 104, 28–34. [Google Scholar] [CrossRef]
- Shemshura, O.; Alimzhanova, M.; Ismailova, E.; Molzhigitova, A.; Daugaliyeva, S.; Sadanov, A. Antagonistic activity and mechanism of a novel Bacillus amyloliquefaciens MB40 strain against fire blight. J. Plant Pathol. 2020, 102, 825–833. [Google Scholar] [CrossRef]
- Leathers, T.D.; Saunders, L.P.; Bowman, M.J.; Price, N.P.J.; Bischoff, K.M.; Rich, J.O.; Skory, C.D.; Nunnally, M.S. Inhibition of Erwinia amylovora by Bacillus nakamurai. Curr. Microbiol. 2020, 77, 875–881. [Google Scholar] [CrossRef]
- Choi, O.; Cho, J.; Kang, B.; Lee, Y.; Kim, J. Negatively Regulated Aerobactin and Desferrioxamine E by Fur in Pantoea ananatis Are Required for Full Siderophore Production and Antibacterial Activity, but Not for Virulence. Appl. Environ. Microbiol. 2022, 88, e0240521. [Google Scholar] [CrossRef]
- Sabri, M.; Habbadi, K.; Achbani, E.H.; Benkirane, R.; El Handi, K.; Ou-Zine, M.; Benali, T.; Elbeaino, T. Antagonistic effect of Leuconostoc mesenteroides on grapevine crown gall and fire blight. J. Crop Improv. 2022, 431–446. [Google Scholar] [CrossRef]
- Medhioub, I.; Cheffi, M.; Tounsi, S.; Triki, M.A. Study of Bacillus velezensis OEE1 potentialities in the biocontrol against Erwinia amylovora, causal agent of fire blight disease of rosaceous plants. Biol. Control. 2022, 167, 104842. [Google Scholar] [CrossRef]
- Büyükcam, A.; Tuncer, Ö.; Gür, D.; Sancak, B.; Ceyhan, M.; Cengiz, A.B.; Kara, A. Clinical and microbiological characteristics of Pantoea agglomerans infection in children. J. Infect. Public Health 2018, 11, 304–309. [Google Scholar] [CrossRef] [PubMed]
- Soutar, C.D.; Stavrinides, J. Molecular validation of clinical Pantoea isolates identified by MALDI-TOF. PLoS ONE 2019, 14, e0224731. [Google Scholar] [CrossRef]
- Sundin, G.W.; Werner, N.A.; Yoder, K.S.; Aldwinckle, H.S. Field Evaluation of Biological Control of Fire Blight in the Eastern United States. Plant Dis. 2009, 93, 386–394. [Google Scholar] [CrossRef]
- Kim, I.-Y.; Lew, B.; Zhao, Y.; Korban, S.S.; Choi, H.; Kim, K. Biocontrol of fire blight via microcapsule-mediated delivery of the bacterial antagonist Pantoea agglomerans E325 to apple blossoms. BioControl 2022, 67, 433–442. [Google Scholar] [CrossRef]
- Johnson, K.B.; Temple, T.N.; Achala, K.C.; Elkins, R.B. Refinement of Nonantibiotic Spray Programs for Fire Blight Control in Organic Pome Fruit. Plant Dis. 2022, 106, 623–633. [Google Scholar] [CrossRef]
- Buttimer, C.; McAuliffe, O.; Ross, R.P.; Hill, C.; O’Mahony, J.; Coffey, A. Bacteriophages and bacterial plant diseases. Front. Microbiol. 2017, 8, 34. [Google Scholar] [CrossRef]
- Ni, P.; Wang, L.; Deng, B.; Jiu, S.; Ma, C.; Zhang, C.; Almeida, A.; Wang, D.; Xu, W.; Wang, S. Combined application of bacteriophages and carvacrol in the control of Pseudomonas syringae pv. actinidiae planktonic and biofilm forms. Microorganisms 2020, 8, 837. [Google Scholar] [CrossRef]
- Attai, H.; Brown, P.J.B. Isolation and characterization T4-and T7-like phages that infect the bacterial plant pathogen agrobacterium tumefaciens. Viruses 2019, 11, 528. [Google Scholar] [CrossRef]
- Dömötör, D.; Frank, T.; Rákhely, G.; Doffkay, Z.; Schneider, G.; Kovács, T. Comparative analysis of two bacteriophages of Xanthomonas arboricola pv. juglandis. Infect. Genet. Evol. 2016, 43, 371–377. [Google Scholar] [CrossRef] [PubMed]
- Batinovic, S.; Wassef, F.; Knowler, S.A.; Rice, D.T.F.; Stanton, C.R.; Rose, J.; Tucci, J.; Nittami, T.; Vinh, A.; Drummond, G.R.; et al. Bacteriophages in Natural and Artificial Environments. Pathogens 2019, 8, 100. [Google Scholar] [CrossRef] [PubMed]
- Grace, E.R.; Rabiey, M.; Friman, V.P.; Jackson, R.W. Seeing the forest for the trees: Use of phages to treat bacterial tree diseases. Plant Pathol. 2021, 70, 1987–2004. [Google Scholar] [CrossRef]
- Parcey, M.; Gayder, S.; Castle, A.J.; Svircev, A.M. Molecular Profile of Phage Infection: A Novel Approach for the Characterization of Erwinia Phages Through qPCR. Int. J. Mol. Sci. 2020, 21, 553. [Google Scholar] [CrossRef]
- Park, J.; Lee, G.M.; Kim, D.; Park, D.H.; Oh, C.S. Characterization of the lytic bacteriophage phiEaP-8 effective against both Erwinia amylovora and Erwinia pyrifoliae causing severe diseases in apple and pear. Plant Pathol. J. 2018, 34, 445–450. [Google Scholar] [CrossRef] [PubMed]
- Lagonenko, A.L.; Sadovskaya, O.; Valentovich, L.N.; Evtushenkov, A.N. Characterization of a new ViI-like Erwinia amylovora bacteriophage phiEa2809. FEMS Microbiol. Lett. 2015, 362, fnv031. [Google Scholar] [CrossRef] [PubMed]
- Park, J.; Kim, B.; Song, S.; Lee, Y.W.; Roh, E. Isolation of Nine Bacteriophages Shown Effective Against Erwinia amylovora in Korea. Plant Pathol. J. 2022, 38, 248–253. [Google Scholar] [CrossRef]
- Roach, D.R.; Sjaarda, D.R.; Castle, A.J.; Svircev, A.M. Host exopolysaccharide quantity and composition impact erwinia: Amylovora bacteriophage pathogenesis. Appl. Environ. Microbiol. 2013, 79, 3249–3256. [Google Scholar] [CrossRef]
- Nazzaro, F.; Fratianni, F.; De Martino, L.; Coppola, R.; De Feo, V. Effect of essential oils on pathogenic bacteria. Pharmaceuticals 2013, 6, 1451–1474. [Google Scholar] [CrossRef]
- Bakkali, F.; Averbeck, S.; Averbeck, D.; Idaomar, M. Biological effects of essential oils—A review. Food Chem. Toxicol. 2008, 46, 446–475. [Google Scholar] [CrossRef]
- Choudhary, P.; Aggarwal, P.R.; Rana, S.; Nagarathnam, R.; Muthamilarasan, M. Molecular and metabolomic interventions for identifying potential bioactive molecules to mitigate diseases and their impacts on crop plants. Physiol. Mol. Plant Pathol. 2021, 114, 101624. [Google Scholar] [CrossRef]
- Sharifi-Rad, J.; Sureda, A.; Tenore, G.C.; Daglia, M.; Sharifi-Rad, M.; Valussi, M.; Tundis, R.; Sharifi-Rad, M.; Loizzo, M.R.; Oluwaseun Ademiluyi, A.; et al. Biological Activities of Essential Oils: From Plant Chemoecology to Traditional Healing Systems. Molecules 2017, 22, 70. [Google Scholar] [CrossRef] [PubMed]
- Vujanović, M.; Zengin, G.; Đurović, S.; Mašković, P.; Cvetanović, A.; Radojković, M. Biological activity of extracts of traditional wild medicinal plants from the Balkan Peninsula. S. Afr. J. Bot. 2019, 120, 213–218. [Google Scholar] [CrossRef]
- Akhlaghi, M.; Tarighi, S.; Taheri, P. Effects of plant essential oils on growth and virulence factors of Erwinia amylovora. J. Plant Pathol. 2020, 102, 409–419. [Google Scholar] [CrossRef]
- Loukhaoukha, R.; Saidi, F.; Jullien, F.; Benabdelkader, T. Chemical composition and antibacterial activity of Lavandula stoechas essential oil and its main components against Erwinia amylovora and Pectobacterium carotovorum subsp. carotovorum. Phytotherapie 2018, 16, 149–157. [Google Scholar] [CrossRef]
- Kokoskova, B.; Pouvova, D.; Pavela, R. Effectiveness of plant essential oils against Erwinia amylovora, Pseudomonas syringae pv. syringae and associated saprophytic bacteria on/in host plants. J. Plant Pathol. 2011, 93, 133–139. [Google Scholar]
- Ciocarlan, A.; Dragalin, I.; Aricu, A.; Lupascu, L.; Ciocarlan, N.; Vergel, K.; Duliu, O.G.; Hristozova, G.; Zinicovscaia, I. Chemical Profile, Elemental Composition, and Antimicrobial Activity of Plants of the Teucrium (Lamiaceae) Genus Growing in Moldova. Agronomy 2022, 12, 772. [Google Scholar] [CrossRef]
- Doukkali, L.; Tahiri, A.; Askarne, L.; Tazi, B.; Guenoun, F.; Ezrari, S.; Lahlali, R. Chemical composition and antibacterial activity of Moroccan Artemisia mesatlantica and A. absinthium essential oils against fire blight caused by Erwinia amylovora. Not. Sci. Biol. 2022, 14, 11173. [Google Scholar] [CrossRef]
- Mikiciński, A.; Sobiczewski, P.; Berczyński, S. Efficacy of fungicides and essential oils against bacterial diseases of fruit trees. J. Plant Prot. Res. 2012, 52, 467–471. [Google Scholar] [CrossRef]
- Proto, M.R.; Biondi, E.; Baldo, D.; Levoni, M.; Filippini, G.; Modesto, M.; Di Vito, M.; Bugli, F.; Ratti, C.; Minardi, P.; et al. Essential Oils and Hydrolates: Potential Tools for Defense Against Bacterial Plant Pathogens. Microorganisms 2022, 10, 702. [Google Scholar] [CrossRef]
- Doukkali, E.; Radouane, N.; Tahiri, A.; Tazi, B.; Guenoun, F.; Lahlali, R. Chemical composition and antibacterial activity of essential oils of Cinnamomum cassia and Syzygium aromaticum plants and their nanoparticles against Erwinia amylovora. Arch. Phytopathol. Plant Prot. 2022, 55, 217–234. [Google Scholar] [CrossRef]
- Ageitos, J.M.; Sánchez-Pérez, A.; Calo-Mata, P.; Villa, T.G. Antimicrobial peptides (AMPs): Ancient compounds that represent novel weapons in the fight against bacteria. Biochem. Pharmacol. 2017, 133, 117–138. [Google Scholar] [CrossRef]
- Li, S.; Wang, Y.; Xue, Z.; Jia, Y.; Li, R.; He, C.; Chen, H. The structure-mechanism relationship and mode of actions of antimicrobial peptides: A review. Trends Food Sci. Technol. 2021, 109, 103–115. [Google Scholar] [CrossRef]
- Ilyas, H.; Datta, A.; Bhunia, A. An Approach Towards Structure Based Antimicrobial Peptide Design for Use in Development of Transgenic Plants: A Strategy for Plant Disease Management. Curr. Med. Chem. 2017, 24, 1350–1364. [Google Scholar] [CrossRef] [PubMed]
- Boman, H.G. Peptide Antibiotics and Their Role in Innate Immunity. Annu. Rev. Immunol. 1995, 13, 61–92. [Google Scholar] [CrossRef]
- Koehbach, J.; Craik, D.J. The Vast Structural Diversity of Antimicrobial Peptides. Trends Pharmacol. Sci. 2019, 40, 517–528. [Google Scholar] [CrossRef]
- Erdem Büyükkiraz, M.; Kesmen, Z. Antimicrobial peptides (AMPs): A promising class of antimicrobial compounds. J. Appl. Microbiol. 2021, 1–24. [Google Scholar] [CrossRef] [PubMed]
- Mahlapuu, M.; Björn, C.; Ekblom, J. Antimicrobial peptides as therapeutic agents: Opportunities and challenges. Crit. Rev. Biotechnol. 2020, 40, 978–992. [Google Scholar] [CrossRef]
- Krishnan, M.; Choi, J.; Jang, A.; Kim, Y. A novel peptide antibiotic, Pro10-1D, designed from insect defensin shows antibacterial and anti-inflammatory activities in sepsis models. Int. J. Mol. Sci. 2020, 21, 6216. [Google Scholar] [CrossRef]
- Zhang, Q.Y.; Yan, Z.; Meng, Y.M.; Hong, X.Y.; Shao, G.; Ma, J.J.; Cheng, X.R.; Liu, J.; Kang, J.; Fu, C.Y. Antimicrobial peptides: Mechanism of action, activity and clinical potential. Mil. Med. Res. 2021, 8, 48. [Google Scholar] [CrossRef]
- Brogden, K.A. Antimicrobial peptides: Pore formers or metabolic inhibitors in bacteria? Nat. Rev. Microbiol. 2005, 3, 238–250. [Google Scholar] [CrossRef] [PubMed]
- Matsuzaki, K. Membrane Permeabilization Mechanisms. Antimicrob. Pept. 2019, 1117, 9–16. [Google Scholar] [CrossRef]
- Xu, C.; Ma, W.; Wang, K.; He, K.; Chen, Z.; Liu, J.; Yang, K.; Yuan, B. Correlation between Single-Molecule Dynamics and Biological Functions of Antimicrobial Peptide Melittin. J. Phys. Chem. Lett. 2020, 11, 4834–4841. [Google Scholar] [CrossRef]
- Lee, T.-H.; NHall, K.; Aguilar, M.-I. Antimicrobial Peptide Structure and Mechanism of Action: A Focus on the Role of Membrane Structure. Curr. Top. Med. Chem. 2015, 16, 25–39. [Google Scholar] [CrossRef] [PubMed]
- Melo, M.N.; Ferre, R.; Castanho, M.A.R.B. Antimicrobial peptides: Linking partition, activity and high membrane-bound concentrations. Nat. Rev. Microbiol. 2009, 7, 245–250. [Google Scholar] [CrossRef]
- Zhang, K.; Zhang, H.; Gao, C.; Chen, R.; Li, C. Antimicrobial Mechanism of pBD2 Against Staphylococcus aureus. Molecules 2020, 25, 3513. [Google Scholar] [CrossRef]
- Zhang, L.; Wang, Y.-H.; Zhang, X.; Lancaster, L.; Zhou, J.; Noller, H.F. The structural basis for inhibition of ribosomal translocation by viomycin. Proc. Natl. Acad. Sci. USA 2020, 117, 10271–10277. [Google Scholar] [CrossRef]
- Han, X.; Kou, Z.; Jiang, F.; Sun, X.; Shang, D. Interactions of Designed Trp-Containing Antimicrobial Peptides with DNA of Multidrug-Resistant Pseudomonas aeruginosa. DNA Cell Biol. 2021, 40, 414–424. [Google Scholar] [CrossRef]
- Zhang, R.; Wang, Z.; Tian, Y.; Yin, Q.; Cheng, X.; Lian, M.; Zhou, B.; Zhang, X.; Yang, L. Efficacy of antimicrobial peptide DP7, designed by machine-learning method, against methicillin-resistant staphylococcus aureus. Front. Microbiol. 2019, 10, 1175. [Google Scholar] [CrossRef]
- Yi, L.; Dang, J.; Zhang, L.; Wu, Y.; Liu, B.; Lü, X. Purification, characterization and bactericidal mechanism of a broad spectrum bacteriocin with antimicrobial activity against multidrug-resistant strains produced by Lactobacillus coryniformis XN8. Food Control 2016, 67, 53–62. [Google Scholar] [CrossRef]
- Graf, M.; Mardirossian, M.; Nguyen, F.; Seefeldt, A.C.; Guichard, G.; Scocchi, M.; Innis, C.A.; Wilson, D.N. Proline-rich antimicrobial peptides targeting protein synthesis. Nat. Prod. Rep. 2017, 34, 702–711. [Google Scholar] [CrossRef] [PubMed]
- Manabe, T.; Kawasaki, K. D-form KLKLLLLLKLK-NH 2 peptide exerts higher antimicrobial properties than its L-form counterpart via an association with bacterial cell wall components. Sci. Rep. 2017, 7, 43384. [Google Scholar] [CrossRef]
- Kurpe, S.R.; Grishin, S.Y.; Surin, A.K.; Panfilov, A.V.; Slizen, M.V.; Chowdhury, S.D.; Galzitskaya, O.V. Antimicrobial and Amyloidogenic Activity of Peptides. Can Antimicrobial Peptides Be Used Against SARS-CoV-2? Int. J. Mol. Sci. 2020, 21, 9552. [Google Scholar] [CrossRef]
- Liu, W.; Wu, Z.; Mao, C.; Guo, G.; Zeng, Z.; Fei, Y.; Wan, S.; Peng, J.; Wu, J. Antimicrobial Peptide Cec4 Eradicates the Bacteria of Clinical Carbapenem-Resistant Acinetobacter baumannii Biofilm. Front. Microbiol. 2020, 11, 1532. [Google Scholar] [CrossRef] [PubMed]
- Maselli, V.; Galdiero, E.; Salzano, A.M.; Scaloni, A.; Maione, A.; Falanga, A.; Naviglio, D.; Guida, M.; Di Cosmo, A.; Galdiero, S. OctoPartenopin: Identification and Preliminary Characterization of a Novel Antimicrobial Peptide from the Suckers of Octopus Vulgaris. Mar. Drugs 2020, 18, 380. [Google Scholar] [CrossRef]
- Montesinos, E. Antimicrobial peptides and plant disease control. FEMS Microbiol. Lett. 2007, 270, 1–11. [Google Scholar] [CrossRef]
- Luo, X.; Wu, W.; Feng, L.; Treves, H.; Ren, M. Short peptides make a big difference: The role of botany-derived amps in disease control and protection of human health. Int. J. Mol. Sci. 2021, 22, 11363. [Google Scholar] [CrossRef] [PubMed]
- Cabrefiga, J.; Montesinos, E. Lysozyme enhances the bactericidal effect of BP100 peptide against Erwinia amylovora, the causal agent of fire blight of rosaceous plants. BMC Microbiol. 2017, 17, 39. [Google Scholar] [CrossRef]
- Shanmugaraj, B.; Bulaon, C.J.I.; Malla, A.; Phoolcharoen, W. Biotechnological insights on the expression and production of antimicrobial peptides in plants. Molecules 2021, 26, 4032. [Google Scholar] [CrossRef]
- Oliveras, À.; Camó, C.; Caravaca-Fuentes, P.; Moll, L.; Riesco-Llach, G.; Gil-Caballero, S.; Badosa, E.; Bonaterra, A.; Montesinos, E.; Feliu, L.; et al. Peptide Conjugates Derived from flg15, Pep13, and PIP1 That Are Active Against Plant-Pathogenic Bacteria and Trigger Plant Defense Responses. Appl. Environ. Microbiol. 2022, 88, e0057422. [Google Scholar] [CrossRef]
- Badosa, E.; Ferre, R.; Planas, M.; Feliu, L.; Besalú, E.; Cabrefiga, J.; Bardají, E.; Montesinos, E. A library of linear undecapeptides with bactericidal activity against phytopathogenic bacteria. Peptides 2007, 28, 2276–2285. [Google Scholar] [CrossRef] [PubMed]
- Güell, I.; Micaló, L.; Cano, L.; Badosa, E.; Ferre, R.; Montesinos, E.; Bardají, E.; Feliu, L.; Planas, M. Peptidotriazoles with antimicrobial activity against bacterial and fungal plant pathogens. Peptides 2012, 33, 9–17. [Google Scholar] [CrossRef] [PubMed]
- Badosa, E.; Montesinos, L.; Camó, C.; Ruz, L.; Cabrefiga, J.; Francés, J.; Gascón, B.; Planas, M.; Feliu, L.; Montesinos, E. Control of fire blight infections with synthetic peptides that elicit plant defense responses. J. Plant Pathol. 2017, 99, 65–73. [Google Scholar] [CrossRef]
- Güell, I.; Cabrefiga, J.; Badosa, E.; Ferre, R.; Talleda, M.; Bardají, E.; Planas, M.; Feliu, L.; Montesinos, E. Improvement of the efficacy of linear undecapeptides against plant-pathogenic bacteria by incorporation of D-amino acids. Appl. Environ. Microbiol. 2011, 77, 2667–2675. [Google Scholar] [CrossRef]
- Nadal, A.; Montero, M.; Company, N.; Badosa, E.; Messeguer, J.; Montesinos, L.; Montesinos, E.; Pla, M. Constitutive expression of transgenes encoding derivatives of the synthetic antimicrobial peptide BP100: Impact on rice host plant fitness. BMC Plant Biol. 2012, 12, 159. [Google Scholar] [CrossRef]
- Baró, A.; Badosa, E.; Montesinos, L.; Feliu, L.; Planas, M.; Montesinos, E.; Bonaterra, A. Screening and identification of BP100 peptide conjugates active against Xylella fastidiosa using a viability-qPCR method. BMC Microbiol. 2020, 20, 229. [Google Scholar] [CrossRef]
- Montesinos, L.; Gascón, B.; Ruz, L.; Badosa, E.; Planas, M.; Feliu, L.; Montesinos, E. A Bifunctional Synthetic Peptide with Antimicrobial and Plant Elicitation Properties That Protect Tomato Plants from Bacterial and Fungal Infections. Front. Plant Sci. 2021, 12, 756357. [Google Scholar] [CrossRef] [PubMed]
- Mariz-Ponte, N.; Regalado, L.; Gimranov, E.; Tassi, N.; Moura, L.; Gomes, P.; Tavares, F.; Santos, C.; Teixeira, C. A Synergic Potential of Antimicrobial Peptides Against Pseudomonas syringae pv. Actinidiae. Molecules 2021, 26, 1461. [Google Scholar] [CrossRef]
- Mendes, R.J.; Regalado, L.; Luz, J.P.; Tassi, N.; Teixeira, C.; Gomes, P.; Tavares, F.; Santos, C. In vitro evaluation of five antimicrobial peptides against the plant pathogen Erwinia amylovora. Biomolecules 2021, 11, 554. [Google Scholar] [CrossRef]
- Mendes, R.J.; Sario, S.; Luz, J.P.; Tassi, N.; Teixeira, C.; Gomes, P.; Tavares, F.; Santos, C. Evaluation of three antimicrobial peptides mixtures to control the phytopathogen responsible for fire blight disease. Plants 2021, 10, 2637. [Google Scholar] [CrossRef]
- Monroc, S.; Badosa, E.; Besalú, E.; Planas, M.; Bardají, E.; Montesinos, E.; Feliu, L. Improvement of cyclic decapeptides against plant pathogenic bacteria using a combinatorial chemistry approach. Peptides 2006, 27, 2575–2584. [Google Scholar] [CrossRef] [PubMed]
- Coca, M.; Peñas, G.; Gómez, J.; Campo, S.; Bortolotti, C.; Messeguer, J.; Segundo, B.S. Enhanced resistance to the rice blast fungus Magnaporthe grisea conferred by expression of a cecropin A gene in transgenic rice. Planta 2006, 223, 392–406. [Google Scholar] [CrossRef] [PubMed]
- Rahnamaeian, M.; Langen, G.; Imani, J.; Khalifa, W.; Altincicek, B.; Von Wettstein, D.; Kogel, K.H.; Vilcinskas, A. Insect peptide metchnikowin confers on barley a selective capacity for resistance to fungal ascomycetes pathogens. J. Exp. Bot. 2009, 60, 4105–4114. [Google Scholar] [CrossRef] [PubMed]
- Ali, G.S.; Reddy, A.S.N. Inhibition of fungal and bacterial plant pathogens by synthetic peptides: In vitro growth inhibition, interaction between peptides and inhibition of disease progression. Mol. Plant-Microbe Interact. 2000, 13, 847–859. [Google Scholar] [CrossRef] [PubMed]
- Jan, P.S.; Huang, H.Y.; Chen, H.M. Expression of a synthesized gene encoding cationic peptide cecropin B in transgenic tomato plants protects against bacterial diseases. Appl. Environ. Microbiol. 2010, 76, 769–775. [Google Scholar] [CrossRef]
- Datta, A.; Ghosh, A.; Airoldi, C.; Sperandeo, P.; Mroue, K.H.; Jimenez-Barbero, J.; Kundu, P.; Ramamoorthy, A.; Bhunia, A. Antimicrobial Peptides: Insights into Membrane Permeabilization, Lipopolysaccharide Fragmentation and Application in Plant Disease Control. Sci. Rep. 2015, 5, 11951. [Google Scholar] [CrossRef]
Primer | Sequence (5′-3′) | Technique | References |
---|---|---|---|
RS24580-205F γ | CACTGCGCCTGTTGTTCA | PCR | [83] |
205R γ | ATGTATCTGGTAGCCGGGTAAGTT | ||
G1-F | CCTGCATAAATCACCGCTGACAGCTCAATG | PCR | [79] |
G2-R | GCTACCACTGATCGCTCGAATCAAATCGGC | ||
FER1-F | AGCAGCAATTAATGGCAAGTATAGTCA | PCR | [78] |
FER1-R | AATTTAATCAGGTCACCTCTGTTCAAC | ||
rgER2R Φ | AAAAGAGACATCTGGATTCAGACAAT | PCR | [73] |
Ams116F | TCCCACATACTGTGAATCATCCA | qPCR | [80] |
Ams189R | GGGTATTTGCGCTAATTTTATTCG | ||
Ams141T Τ | FAM-CCAGAATCTGGCCCGCGTATACCG-TAMRA | ||
ITS15F | TGAGTAATGAGCGAGCTAAGTGAAG | qPCR | [80] |
ITS93R | CGCAATGCTCATGGACTCAA | ||
ITS43T Τ | FAM-AGGCGTCAGCGCGCAGCAAC-TAMRA | ||
hpEaF | CCG TGGAGACCGATCTTTTA | qPCR | [82] |
hpEaR | AAGTTTCTCCGCCCTACGAT | ||
hpEaP Τ | FAM-TCGTCGAATGCTGCCTCTCT-MGB | ||
Ea_Shin2018_F3 | ATAATAAGAGAATGGCGCTATG | LAMP | [81] |
Ea_Shin2018_B3 | TCTACATCTCCACCTTTGG | ||
Ea_Shin2018_FIP | TAATGAAGTTGAATCTCAGGCATGAGAAAAAATCCATTGTAAAACCTTCG | ||
Ea_Shin2018_BIP | GATGGATTGCTTAGTGAGCTCAGCCAATCTCTCCACAACCG | ||
Ea_Shin2018_LoopF | AAAGTTGTTTTCATCCCACGGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mendes, R.J.; Regalado, L.; Rezzonico, F.; Tavares, F.; Santos, C. Deciphering Fire Blight: From Erwinia amylovora Ecology to Genomics and Sustainable Control. Horticulturae 2024, 10, 1178. https://doi.org/10.3390/horticulturae10111178
Mendes RJ, Regalado L, Rezzonico F, Tavares F, Santos C. Deciphering Fire Blight: From Erwinia amylovora Ecology to Genomics and Sustainable Control. Horticulturae. 2024; 10(11):1178. https://doi.org/10.3390/horticulturae10111178
Chicago/Turabian StyleMendes, Rafael J., Laura Regalado, Fabio Rezzonico, Fernando Tavares, and Conceição Santos. 2024. "Deciphering Fire Blight: From Erwinia amylovora Ecology to Genomics and Sustainable Control" Horticulturae 10, no. 11: 1178. https://doi.org/10.3390/horticulturae10111178
APA StyleMendes, R. J., Regalado, L., Rezzonico, F., Tavares, F., & Santos, C. (2024). Deciphering Fire Blight: From Erwinia amylovora Ecology to Genomics and Sustainable Control. Horticulturae, 10(11), 1178. https://doi.org/10.3390/horticulturae10111178