Next Article in Journal
Identification of Key Candidate Genes Involved in Aluminum Accumulation in the Sepals of Hydrangea macrophylla
Next Article in Special Issue
Biotechnological Revolution in Agrifood Systems: Multidisciplinary Approaches for the Diagnosis, Management, and Epidemiology of Plant Diseases
Previous Article in Journal
Biological Characteristics, Domestication and Cultivation of Wild Tyromyces kmetii
Previous Article in Special Issue
Detection and Characterization of Lasiodiplodia pseudotheobromae Associated with Stem Wilt on Ficus hirta (Vahl) and Its Fungicidal Sensitivity
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Review

Deciphering Fire Blight: From Erwinia amylovora Ecology to Genomics and Sustainable Control

by
Rafael J. Mendes
1,2,3,4,*,
Laura Regalado
1,2,3,4,5,
Fabio Rezzonico
6,
Fernando Tavares
1,3,4 and
Conceição Santos
1,2
1
Biology Department, Faculty of Sciences, University of Porto, 4169-007 Porto, Portugal
2
LAQV-REQUIMTE, Biology Department, Faculty of Sciences, University of Porto, 4050-453 Porto, Portugal
3
CIBIO–Research Centre in Biodiversity and Genetic Resources, InBIO, Associated Laboratory, University of Porto, Campus Agrário de Vairão, 4485-661 Vairão, Portugal
4
BIOPOLIS Program in Genomics, Biodiversity and Land Planning, CIBIO, Campus de Vairão, 4485-661 Vairão, Portugal
5
Faculty of Pharmacy, University of Porto, 4050-313 Porto, Portugal
6
Environmental Genomics and Systems Biology Research Group, Institute for Environment and Natural Resources, Zürich University of Applied Sciences (ZHAW), 8820 Wädenswil, Switzerland
*
Author to whom correspondence should be addressed.
Horticulturae 2024, 10(11), 1178; https://doi.org/10.3390/horticulturae10111178
Submission received: 3 September 2024 / Revised: 28 October 2024 / Accepted: 4 November 2024 / Published: 7 November 2024
(This article belongs to the Special Issue The Diagnosis, Management, and Epidemiology of Plant Diseases)

Abstract

Fire blight is a highly destructive plant disease that affects the pome fruit value chain, with high economic impacts. Its etiological agent is the Gram-negative bacterium Erwinia amylovora. The origin of fire blight goes back to the late 1700s in North America, and the disease since then has spread to New Zealand, Europe, North Africa, the Middle East, and Asia. Due to its worldwide dissemination, advances have been made to identify and characterize E. amylovora strains from different regions and understand their evolutionary adaptation. Additionally, many efforts have been made in recent decades to stop the occurrence and impacts of fire blight, but in many countries, only preventive measures have been applied, as the application of antibiotics and copper-based compounds has become more restricted. Thus, new sustainable methods to control the pathogen are constantly required. This article presents a comprehensive review of the pathogen, from the phenotypic and molecular characterization methods applied to advances in comparative genomics and the development of new compounds for sustainable control of E. amylovora.

1. Introduction

Fire blight is a destructive necrotic plant disease that affects widely grown pome fruit trees of the Rosaceae family, such as apple (Malus domestica), pear (Pyrus communis), quince (Cydonia oblonga), and loquat (Eriobotrya japonica) and is thus a major economic concern to fruit growers worldwide [1,2,3]. The disease can further affect several ornamental and wild species [4,5,6]. The causal agent is the Gram-negative bacterial species Erwinia amylovora, which belongs to the Erwiniaceae family [7] and is included in the EPPO A2 list of quarantine species [8]. It is considered the most destructive disease of pome fruit trees, ultimately capable of decimating entire orchards in a single season and significantly reducing the marketing and crop yield of its hosts [9].
Worldwide losses of pome fruits due to this disease have been increasing, with losses estimated to be USD 100 million per year in the United States [10]. In Europe and North Africa, severe production losses have also been registered throughout the years [11], with the latest report after a major outbreak in Switzerland in 2007 of USD 56 million, which corresponded to 40,000 standard trees throughout the country [2,12]. A study from 2017 on the impact of fire blight on pear trade shocks disclosed losses that could range from USD 363.48 million to USD 975.72 million in the United States [13]. Furthermore, the total loss due to fire blight corresponds to the loss associated with the direct effects in orchards (e.g., destruction of trees) and the application of control measures (e.g., preventive actions and antibiotic application, among others) that could span several years. The economic losses in European countries do not factor in antibiotic application since their application is strictly restricted or prohibited [14]. Due to the perennial nature of pome fruit cultivation, fire blight imposes long-term damages since a single outbreak can disrupt orchard production over several years as a consequence of the required removal of the infected parts of the trees, the follow-up management, and replacement costs required by the contingency plans established by national and international regulations. Not surprisingly, this reality makes fire blight a major and constant threat to producers of pome fruit and other Rosaceae species [9].

1.1. Host Range and Specificity

E. amylovora is a rod-shaped bacterium with peritrichous flagella that belongs to the Erwiniaceae family [7]. This bacterial species is a non-obligate psychrotrophic pathogen that can grow in temperatures ranging from 4 to 37 °C, experiencing periods of starvation during its life cycle, with its physiological responses being linked to the environmental temperature [15]. This species was the first bacterium to be reported as phytopathogenic, in late 1700 [16,17]. Due to its scientific and economic importance, E. amylovora has been recognized by plant bacteriologists as one of the top 10 most relevant phytopathogenic bacteria [18].
E. amylovora can infect around 200 known species restricted to the Rosaceae family, which can be divided into two major groups, namely, the Amygdaloideae subfamily (formerly known as Spiraeoideae) [19] and the Rubus genus [20]. The pathogen has also been reported from non-host species like Rosa rugosa (beach rose), raising the possibility of the bacteria possessing a larger host range [21,22]. Whilst specific biovars or pathovars of E. amylovora have not explicitly been defined, several studies have proven the existence of two groups with significant genome differences with respect to their preferred hosts [20,23].
A characteristic of this pathogen is that Rubus-specific strains do not have the capacity to infect an Amygdaloideae host, whereas Amygdaloideae-infecting strains can still infect Rubus hosts, albeit it a more limited fashion [24]. It has been suggested that host specialization on Rubus is due to a series of genetic adaptations such as the acquisition of a different set of gylkotransferases and LPS genes [25], the loss of a number of gene clusters responsible for degradation of phenolic and sulfur compounds as well as for the metabolism of L-arabinose [26] and sorbitol [27], the lack of a SAM-dependent methyltransferase gene together with its flanking dnd/dpt gene clusters [28], and the divergent sequence of T3SS effector Eop1 with respect to the Amygdaloideae-infecting group or to other pome fruit-infecting species like Erwinia pyrifoliae [29]. Thus, many Rubus hosts can serve as overwintering reservoirs for E. amylovora, an occurrence that has been reported in several countries worldwide, such as the United States, Turkey, and the United Kingdom, among others [11].
When considering its two main Amygdaloideae hosts, strains capable of infecting apple trees can even-handedly infect pear trees and vice versa [11]. This cross-infectivity between apple and pear by E. amylovora, supported by numerous molecular studies that have regularly failed to genetically discriminate Amygdaloideae-infecting isolates based on their host of origin [30], is a significant factor in the management and control of fire blight in orchards as the disease can easily spread between these two types of fruit trees.

2. Geographical Distribution

Fire blight is known to have originated in North America, with the first reports dating back to the late 1700s in New York state [31]. Subsequently, disease spread was facilitated by the expansion of the European settlers towards the West, whereby orchards of domesticated apples were infected by the local population of E. amylovora residing on wild plants [29]. Fire blight was first reported outside North America in New Zealand in the late 1910s [32]. Since then, the disease has spread to more than 70 countries around the world, including several countries in North Africa, Middle East Oceania, and Asia, and every country in Europe, being currently absent in Latvia, Finland, Estonia, and Moldova as reported by EPPO due to eradication efforts (Figure 1) [2,6].
In Europe, fire blight was first detected in the United Kingdom in 1957 [2], and until the end of the 20th century, it spread mainly to other countries of Western Europe. Due to the disease being already established in other countries of the same continent, several European countries established strict import guidelines to prevent the entry of the disease. Despite these efforts, the pathogen crossed borders as shown in Norway where E. amylovora was first detected in 1986 affecting primarily ornamental species and small apple and pear orchards [33].
Dissemination of E. amylovora across Europe and Asia has been explored in the first 20 years of the new millennium [32], with strains identified in Russia, Slovenia, Austria [34], Italy [35], Spain [36], Georgia [37,38], Turkey [39], Serbia [40], Bulgaria [41], Romania [42], Poland [43], Lithuania [44], Hungary [45], and Portugal [46].
Interestingly, Portugal was the only Western European country where the presence of E. amylovora was not reported until the early 2000s, but in 2006 the first outbreaks of fire blight were publicly reported by the official governmental bodies [46]. The etiological origin of that 2006 outbreak could never be demonstrated, as the isolates were lost. However, in a recent study, it was possible to confirm the identity of E. amylovora strains in Portugal isolated in 2010, which corresponded to the second fire blight outbreak officially announced in the country. In the same study, the identity of several E. amylovora isolates from 2017 were further confirmed, suggesting that the presence of this pathogen in Portugal is no longer transient [46].
In the Middle East, fire blight was first detected in the mid-1960s in Lebanon [47], and 20 years later the disease was present in Israel [48], rapidly followed by other countries in the region, such as Syria [49] and Iran [50]. In Asia, E. amylovora strains were identified in Kyrgyzstan and Kazakhstan in 2008 [51,52], and in 2016 were first detected in the Xinjiang and Gansu provinces in northwestern China [53] and in South Korea [54]. They have been spreading domestically since then [55], being currently a major threat to producers in East Asia. In North Africa, fire blight was detected in 2006 in Morocco [56], and Algeria in 2011 [57].
Due to the rise of naturally occurring streptomycin-resistant E. amylovora strains, several studies have been performed to track their dissemination, with various resistant strains found in countries that allow the application of the antibiotic, such as the United States, Canada, Israel, New Zealand, and Mexico [23].
This global dissemination of fire blight has been mainly attributed to the commerce of E. amylovora-infected plant material, which could be aggravated by climate change due to warmer temperatures and weather conditions favoring infections [58].

3. Genetics

The first sequenced genomes of E. amylovora were published in 2010 and corresponded to strains ATCC 49946 and CFBP 1430 that were isolated in the United States and France, respectively [59,60]. The E. amylovora genome is composed of plasmids and a circular chromosome with a size of approximately 3,805,800 bp, which is smaller than most plant pathogenic bacteria, usually possessing genomes ranging from 4.5 to 5.5 Mbp [59,60,61]. This small genome has been hypothesized to reflect the high adaptation to a narrow taxonomic range of hosts within the Rosaceae family, which eventually resulted in the loss of certain genes [59] and significant evolutionary pressure to conserve its gene functions [23].
The coding sequences of E. amylovora represent 86% of its genome, which includes conserved hypothetical proteins, mobile elements, pseudogenes, and genes involved in cellular envelope biosynthesis/modification and signal transduction [59]. Additionally, it contains numerous genes related to the virulence of the pathogen, including three T3SS gene clusters [the hypersensitive response and pathogenicity (Hrp) T3SS, encoded by the pathogenicity island 1 (PAI-1) and the two inv/spa-type T3SS islands (PAI-2 and PAI-3)]; three T6SS gene clusters, and three T3SS effector singleton genes, namely, eop2, hopPtoC, and avrRpt2 [60]. Moreover, E. amylovora possesses three CRISPR loci, which have been particularly useful in identifying different lineages of the pathogen worldwide [46,51,61,62,63].
Initially, two plasmids were found in the genome of E. amylovora, namely, pEA29 and pEA72, with a nucleotide size of 28,259 and 71,487 bp, respectively [59]. pEA29 is ubiquitous in E. amylovora isolates, with only sporadic reports of this plasmid lacking in some strains [46,64]. pEA29 is recognized to influence how symptoms develop during infection, as it has been observed that, in comparison to E. amylovora wild-type strains, plasmid-free isolates notably slow down the progression of symptoms [65], producing less bacterial ooze and thus resulting in less tissue death [66]. Moreover, the plasmid pEI70, widely found in European isolates, has been hypothesized to offer certain features that compensate for the absence of pEA29 in terms of aggressiveness symptoms [67]. The pEA34 plasmid has been mainly identified in strains from Michigan containing the streptomycin-resistance genes strA-strB, involved in overcoming the selective pressure exerted by antibiotics on this pathogen [68]. Furthermore, a study from 2015 revealed for the first time the presence of the transposon Tn5393, responsible for carrying the streptomycin-resistance genes strA-strB, on plasmid pEU30 [69]. Mann et al. (2013) [70] described three new plasmids, namely two cryptic plasmids [pEAR5.2 (5251) and pEAR4.3 (4369)] of unknown functions and pEA30 (30,000 bp) that are involved in the type IV secretion system (T4SS) for putative conjugative plasmid transfer. In recent years, seven new plasmids with unclear functions were discovered, namely, pEAR27 (27,479 bp), pEAR28 (25,558 bp), pEAR35 (34,732 bp), pEA2.9 (2847 bp), pEA4.0 (4068 bp), pEA5.8 (5800 bp), and pEA6.0, with some putatively granting bacteriocin immunity, bacteriophage protection, or encoding for T4SS (5944 bp) [23].
Even though whole-genome sequencing of worldwide dispersed E. amylovora strains has been performed to obtain a good representative population, these genomic analyses allowed us to unveil the remarkable genetic homogeneity within this species. The first genomes published (strains CFBP 1430 and ATCC 49946), despite being from two different continents (Europe and North America, respectively), displayed a nucleotide identity greater than 99.99% [60]. In the study of Mann et al. (2023) [70], the pan-genome of 12 E. amylovora strains containing 5751 coding sequences with an average of 89% conserved core genes displayed an amino acid identity of 99.4% and 99.98% in the Rubus-infecting strains and Amygdaloideae-infecting strains, respectively. All these studies show a high homogeneity among the Amygdaloideae-infecting E. amylovora strains worldwide since their dissemination started. It has been hypothesized that this low diversity within Amygdaloideae-infecting strains is probably due to a genetic bottleneck associated with a recent adaption to a restricted range of hosts, namely, domesticated apples and pears as these were introduced to North America [20,23,29,59].
Nevertheless, in 2018, the study by Zeng and collaborators [20] expanded the number of E. amylovora sequenced genomes and disclosed that although highly similar, it was possible to separate the Amygdaloideae-infecting strains into four major clades, namely, the Western U.S. 1, Western U.S. 2, Eastern U.S., and the Widely Prevalent clade. The first consisted of three strains isolated in the Western U.S. with a pairwise identity of 99.997%, the second contained a single strain from the Western U.S., the third had nine strains isolated from the Eastern U.S. with a pairwise identity of 99.996%, and lastly, the fourth clade was composed of 70 strains from Europe, Mexico, Canada, and the United States with a pairwise identity of 99.995%. The study also showed that only strains of the Widely Prevalent clade (which are similar to the strain first discovered in New York state) spread worldwide.
Parcey et al. (2020) [23] delved deeper into the categorization of E. amylovora strains on these four clades by adding 93 genomes from both Rubus and Amygdaloideae-infecting strains and therefore broadening the scope of the comparative genomics analysis. The results showed that, as a species, E. amylovora genomes had 99.62% identity, which is considered an unusually low level of diversity expected for a species. However, genome variances resulted in the identification of five main clades, with one being exclusively associated with strains that target Rubus plants and one B-group gathering different strains having little sequence similarity between the other four clades and located between the two Amygdaloideae- and Rubus-infecting superclades [20,23].
A recent study by Song et al. (2021) [61] showed that five E. amylovora strains isolated in South Korea in 2015 were highly similar (99.5–100%) to 38 E. amylovora strains isolated from different continents belonging to the Widely Prevalent clade, especially to those from North America, suggesting that in this country the disease was directly imported from the latter continent.
Moreover, a more recent study [71] expanded this list by incorporating 82 new isolates from the northeastern Italian Alps. When combined with a collection of 134 global strains, this study reaffirmed the division into five clades and categorized all Italian isolates within the Widely-Prevalent one, especially correlating with other European isolates.

4. Polyphasic Approaches to Characterize Erwinia amylovora Isolates

Due to its high genomic homogeneity, the dissemination of E. amylovora lineages is difficult to track. Throughout the years, researchers worldwide have employed different characterization analyses resorting to phenotypic traits and different genetic markers and techniques [32,36,42,62,72]. The identification procedures of E. amylovora differ between symptomatic and asymptomatic samples, with the first involving a normal isolation protocol of the pathogen, whilst the second suggests resorting to an enrichment isolation protocol since detection from asymptomatic samples is more difficult because the concentration of the bacteria is lower [73]. The remaining steps of detection and identification are similar in both cases. Official guidelines of EPPO state that at least two distinct identification methods, based on different biological principles or targeting different parts of the genome (e.g., serological and molecular tests), must be applied to colonies displaying typical morphology. Lastly, a pathogenicity test should be applied to confirm Koch’s postulates from asymptomatic samples [73].
Besides serving as detection methods, most of them have also been applied to characterize these kinds of plant pathogens. Phenotypic characterization is recommended by EPPO and other agencies as one of the first analyses to confirm the identity of putative isolates of a plant pathogen [73], the first step being the phenotypic evaluation on three distinct media, namely, King’s B, nutrient sucrose agar (NSA), and CCT medium to distinguish from other species that are usually co-isolated with E. amylovora, such as Pseudomonas syringae [52]. Other studies focused on the biochemical profile of E. amylovora and its pathogenicity traits. Phenotypic profiling was performed using API20E [30,36,42,45], API50E [30,36], or API ZYM systems [30,36], as well as BIOLOG analysis [30,36,42,45,74]. The immature pear/apple slice assay has been widely applied to reveal the pathogenicity and virulence level of the different E. amylovora strains [20,46,75], which were shown to correlate with the production of the exopolysaccharide amylovoran and lipopolysaccharides [76,77].
Moreover, pathogen isolates can be identified using molecular techniques such as polymerase chain reaction (PCR), quantitative real-time polymerase chain reaction (qPCR), loop-mediated isothermal amplification (LAMP) with multiple sets of primers available specifically for the species (Table 1) [73,78,79,80,81,82]. The primer set designed by Ham et al. (2022) [83] for specific identification of E. amylovora through PCR (Table 1) also amplifies E. pyrifoliae, but it does so with a different amplicon size for each species, allowing one to distinguish the pathogens. To tackle the challenge of understanding E. amylovora lineage distributions worldwide, researchers have resorted to a vast group of different molecular typing techniques (Table 2), thus complementing phenotypic analysis [36,40,46,51,57,72,84,85,86].
The genomic homogeneity led researchers to choose genotyping techniques that are more suitable for source tracking and to identify new clonal lineages. CRISPR genotyping is currently a reliable molecular typing method due to the continuous adaptation of this genome section through the integration of short DNA sequences from bacteriophages, plasmids, other laterally transferred DNA sequences, or self-acquisition within the genome, besides losses and duplication of those same short DNA sequences. This technique has sufficient resolution for epidemiological source tracking as it enables the generation of a chronological genetic record that is particularly useful to understand the pathogen dissemination at various geographical scales, from global or national levels [46,51,62,87,88] to local movements in and between orchards [89]. Besides this, the CRISPR-Cas system present in E. amylovora also functions as a defense mechanism against plasmids and could be involved in phage resistance [90].
Recently, a study on E. amylovora strains obtained from Portuguese outbreaks documented for one strain (Ea 680) a self-acquired DNA sequence from the ybaL gene situated in an intergenic region of its genome [46], that could explain the low virulence level displayed by the strain through regulation of gene expression [29]. Nonetheless, despite the high homogeneity among different E. amylovora strains worldwide, it was determined that single strains can possess different levels of virulence [20,46], which reinforces the need to further study phenotypic adaptation in addition to genetic adaptations.
Table 2. Molecular typing methods used for Erwinia amylovora characterization.
Table 2. Molecular typing methods used for Erwinia amylovora characterization.
Molecular Typing MethodReferences
Random amplified polymorphic DNA (RAPD)[36,40,42]
Pulse field gel electrophoresis (PFGE)[36,91]
Rep-PCR[84,92]
Variable number of tandem repeats (VNTR)[72,86,93]
Multiple-locus VNTR analysis (MLVA)[57,94]
Restriction fragment length polymorphism (RFLP)[40,95]
PCR ribotyping[36]
Fluorescent amplified fragment length polymorphism (fAFLP)[92]
Amplified ribosomal DNA restriction analysis (ARDRA)[95]
Multi-locus sequencing analysis (MLSA)[85]
Multi-locus sequence typing (MLST)[86]
Short-sequence DNA repeats (SSR)[45]
Clustered regularly interspaced short palindromic repeats (CRISPR)[46,51,62,63,69,87,88]
In the last decade, with the advances in genome sequencing, researchers have started to employ whole-genome sequencing of E. amylovora strains to further disclose its characterization and distribution, with the first genomic characterization of two published sequenced genomes released in 2010 [59,60], further expanding this number to 12 genomes in 2013 [70], 30 in 2018 [20], 127 in 2020 [23], and to 216 in 2022 [71] with a last report in 2023 for a total of 217 [96]. Besides pathogen characterization, genomics has recently started to be explored as a tool for precise diagnosis of E. amylovora, thus facilitating epidemiological studies to disclose the source and possible dissemination routes, enabling the development of successful eradication and/or management contingencies [97].
Although genotyping approaches document a rather homogeneous population of E. amylovora from a collection of wild isolates, their phenotypic characterization presents different virulence levels, growth kinetics, antibiotic susceptibility, and carbon sources metabolization, unveiling a highly heterogeneous population [46,98]. These results demonstrate the importance of still conducting a range of phenotypic analyses in field isolates identified as E. amylovora, since even molecular typing techniques with great discriminating power, as is the case with CRISPR, may fail to demonstrate variability inherent to those strains. Until now, attempts to explain this phenotypic variability at the molecular level have failed, highlighting the need for a polyphasic approach to characterize these isolates.

5. Management of Fire Blight with Sustainable Compounds

Major concerns in agricultural production revolve around plant pests and diseases that threaten food production [16]. The urgent need to ensure food security and nutrition whilst promoting sustainable management practices that do not present harmful impacts on the environment are keystones of the farm-to-fork concept, which is at the heart of the European Green Deal [99].
Chemical control of E. amylovora relies mainly on two approaches, i.e., copper formulations and antibiotic application, with the former being the usual practice in Europe. In the United States, antibiotic application is still allowed, contrasting with the restrictive use of antibiotics in the European Union [16,100]. These restrictions are justified by the emergence of antibiotic-resistant strains of the pathogen and the possible transmission of the strA-strB genes responsible for such resistance to other plant and human pathogens [16,63,101,102].
Fire blight development occurs rapidly and producers and phytosanitary agents have a narrow window (48 to 24 h prior to predicted infection) to tackle this pathogen with current control methods [103]. This approach, however, requires a better understanding of the disease cycle and physiology of E. amylovora with respect to the existing preventive and control tools (Figure 2).

5.1. Antagonists

One of the first sustainable strategies explored by fire blight researchers has been the use of other microorganisms to interact with and control the phytopathogen responsible for the disease [104,105,106]. Currently, there are already some commercial products based on antagonistic action, i.e., BlightBan®, Serenade® Optimum, BlossomProtect®, and Bloomtime Biological®, which are composed of strains of P. fluorescens, Bacillus subtillis, Aureobasidium pullulans, and Pantoea agglomerans, respectively [104,106,107,108]. Pantoea agglomerans and Pantoea vagans are two epiphytic bacteria that in previous studies have been shown to efficiently control E. amylovora [105,109]. These bacteria have been isolated from different biological origins, including soil, plant and water samples, with P. agglomerans being easily found in susceptible hosts of E. amylovora [104,110]. It has been determined that these microorganisms compete with E. amylovora for space and nutrient uptake, by the exclusion of the infection sites, through the production of antimicrobial compounds such as pantocin A, or by a combination of these factors [111,112]. Additionally, P. agglomerans, Candida albicans, and Staphylococcus aureus also affect other plant pathogenic organisms, which may enable its use against a wide range of plant diseases and enhancing its importance and added value in agricultural practices [113,114]. Several studies have been conducted in recent years to evaluate the potential antagonistic effect of different microorganisms against E. amylovora [115,116,117,118,119,120,121], with promising results being disclosed using Bacillus velezensis against a total of 165 E. amylovora strains in a recent study [122].
The challenges associated with the use of these biological control agents (BCAs) are the strict regulations imposed on them since it is important to fully understand if they can develop diseases in plants, animals, and humans. An example is the recent emergence of concerns about P. agglomerans in human health [106,123], although some studies have proven the misidentification of clinical strains as P. agglomerans [110,124], which could impair the application of this antagonist. Furthermore, BCAs’ survival and efficacy on the field depend on several factors controlled by the environmental conditions (e.g., nutrient levels and moisture fluctuations), especially for those that are applied in the aerial parts of the plants [125]. With this in mind, a recent study has encapsulated P. agglomerans in alginate microcapsules and tested it against E. amylovora in order to improve the stability of the formulation [126]. Moreover, the application of BCAs could lead to phytotoxic responses, which can reduce the crop value, with a study from Johnson et al. (2022) [127] stating that the application of BlossomProtect® should be timed at petal fall and at 70% bloom in order to reduce this problem and achieve infection suppression.

5.2. Bacteriophages

Besides microbial antagonists, a hot topic in plant protection is the use of pathogen-specific phages [128,129,130,131]. Discovered in late 1910, phages are viruses that enter and replicate inside bacteria, and they are present in several microbiomes, from marine to soil, air, and industrial ones [132]. Due to their narrow host range, they are especially interesting for targeting bacterial pathogens in complex microbiomes, such as those found in agricultural areas. Bacteriophages have already started being employed commercially for the management of bacterial diseases in plants [133].
Phage treatments in plant protection have been mainly focused on fire blight [75,134,135,136,137], with one of the six available phage treatments in agriculture being for E. amylovora, namely AgriPhage-Fire [133]. The studies based on phage therapy against this pathogen have focused on targeting its exopolysaccharide amylovoran, with some phages such as podoviruses utilizing an exopolysaccharide depolymerase to degrade amylovoran [138].
Nevertheless, the use of phages is associated with several impediments, including application methods in the field, product storage, lack of a broad-range action spectrum (which could be useful to control more than one pathogen in a single application but could affect beneficial organisms), and especially the ecology and interactions of the phages with the complex plant-associated microbiome. Since the harvesting seasons have long periods where this complex can be modified, researchers must carefully consider these factors when developing this phage treatment [128,133].

5.3. Essential Oils

Essential oils have gathered the attention of researchers in the last decade as a possible alternative tool to control the growth of plant pathogenic microorganisms. These compounds can be found in several plant species and isolated from diverse plant organs, such as roots, seeds, leaves, flowers, and fruits, particularly from aromatic plants [139,140]. They are involved in natural plant defense, acting both as antimicrobials or signal molecules to interact with other plants and beneficial insects [141,142]. However, their toxicity varies and is dependent on the sensitivity of the microorganisms [143].
Several studies have been performed on the use of certain essential oils against E. amylovora [144,145,146,147,148], but also on other phytopathogens, such as Xanthomonas arboricola pv. corylina, Xanthomonas arboricola pv. juglandis, X. campestris, Pectobacterium carotovorum, Pseudomonas syringae pv. syringae, and Agrobacterium tumefaciens [146,147,149].
A study by Proto et al. (2022) [150] showed that despite the application of three essential oils, from Origanum compactum, Thymus vulgaris, and Citrus aurantium var. ‘amara’, inhibited E. amylovora in in vitro assays, they did not exert any significant effects when applied in vivo, which demonstrates that although essential oils could be promising to control this pathogen, their emulsions need to be improved in order to increase their stabilization. In line with this, a recent study by Doukkali et al. (2022) [151] assessed the efficacy of two essential oils, Cinnamomum cassia and Syzygium aromaticum, in a formulation with nanoparticles against E. amylovora in order to improve their utilization, stability, and efficacy since it allowed for a more intimate interaction between the bacterial membrane and the active compounds.

5.4. Antimicrobial Peptides

Antimicrobial peptides (AMPs) are among the most promising sustainable compounds to overcome antibiotic-resistant bacterial strains [152]. AMPs are a highly diverse group of biologically active molecules present in several organisms, such as plants, vertebrates, invertebrates, and bacteria, and are naturally produced by their innate immune system [153,154]. Regardless of their biological origin, AMPs possess common characteristics, namely, a small size with a linear or cyclic structure, the former having an amphipathic α-helical structure, and the latter a β-sheet conformation [155,156]. AMPs are known to have the capacity to act against several microorganisms; thus, they are considered to possess broad-spectrum activity and are capable of inducing rapid death in Gram-positive and Gram-negative bacteria, fungi, parasites, and viruses [152,157]. One important characteristic of these AMPs is that they have a low disposition to induce the development of resistant microorganisms due to the fact that they do not interact with specific receptors whilst possessing the capacity to efficiently target those with already acquired antibiotic resistance [152,158]. Moreover, AMPs are usually non-cytotoxic and biodegradable when released into the environment [154]. Until now, more than 3000 AMPs have been identified; nevertheless, only seven AMPs have been greenlighted by the US Food and Drug Administration (FDA) to be marketed or to be under evaluation [159].
AMPs mainly exert their activity against bacteria using two modes, either by acting directly on the membranes (membrane-targeting AMPs) and leading to destabilization of membrane integrity, or by targeting mechanisms that inhibit the synthesis of nucleic acids, functional proteins, or essential enzymes (non-membrane-targeting AMPs) (Figure 3) [160].
The membrane-targeting mode of action has been categorized into three distinct models (Figure 3), the barrel-stave model, the toroidal model, and the carpet model [161]. The first is characterized by the AMP molecules being absorbed in the membrane surface through the interaction of their hydrophilic surfaces and self-assembling [153]. After the necessary accumulation of the peptide monomers happens, it leads to the perpendicular rotation of the membrane, and consequently to the formation of a channel in the bilayer region with the hydrophilic surface directed inwards, with the size of the pore being correlated with the peptide to lipid molar ratio [162]. The toroid mode of action occurs when peptides are inserted in the bilayer perpendicularly forming a peptide-lipid complex which will allow the formation of a membrane curvature forming a toroidal pore [153,163]. In the last model, due to the negatively charged phospholipid head and the positively charged cationic peptides, the AMPs bind parallelly to the membrane surface, and once the membrane-bound AMPs reach a critical concentration, they reorient them inside the membranes forming micelles that will cause membrane disintegration, either through pores or defects in the membrane [153,164,165]. All of these modes of action are possible due to the physicochemical properties of the AMPs, such as amphipathicity, hydrophobicity, net charge, and self-aggregation [156], which allows cationic and hydrophobic interactions to occur. These are mainly possible due to the electrostatic attraction of the positively charged residues of AMPs to the negatively charged bacterial cell surface [153].
The aforementioned three modes of action in the cellular membrane were considered for a long time the main mode of action of the AMPs, but several studies have shown that besides membrane-target action, many AMPs also target essential cell components and cellular functions leading to bacterial death [166,167]. These AMPs invade the cells without disturbing the membrane and then affect critical cellular processes, inhibiting protein and nucleic acid synthesis [168,169,170], translation in the ribosome [167,171], bacteria cell wall synthesis [172], and chaperone proteins [173]. Recently it has been shown that some AMPs prevent the formation of bacterial biofilm, an essential virulence and pathogenic trait for some bacteria [174,175].
AMPs can be applied in a variety of fields such as pharmaceutical practices, food production, animal husbandry, aquacultural applications, and plant protection [157]. In plant protection, AMPs started to receive special attention from researchers and producers as an alternative and sustainable agent to control phytopathogens in substitution of the high quantity of pesticides and antibiotics applied in crop production [176], which results in environmental pollution and human health concerns. AMPs then take the spotlight as good candidates to substitute these chemical compounds to control phytopathogens and insects in agriculture without the common side effects on the environment, plants, and humans [154].
Many studies have been performed in this field with natural and synthetic AMPs, demonstrating that several AMPs can be used as an innovative plant protection method [154,176,177,178,179,180]. In E. amylovora, several studies have focused on the application of linear undecapeptide BP100 with good outcomes [178,181,182,183,184]. This peptide has also been applied against other phytopathogens, such as Dickeya chrysanthemi, Fusarium verticillioides [185], X. fastidiosa [186], X. campestris pv. vesicatoria, Pseudomonas syringae pv. tomato, Botrytis cinerea [187], and P. syringae pv. actinidiae [188]. Recently, a study has shown that besides BP100, its analog, RW-BP100, and the cecropin A-melittin (CA-M) hybrid peptides also demonstrated good perspectives as a control agent for E. amylovora [189]. Furthermore, it was also shown that the mixture of these three AMPs in equimolar concentrations further improved their action in controlling the pathogen, resulting in a synergic effect [190]. Besides E. amylovora, other peptides have also been tested against multiple other plant pathogenic bacteria and fungi, such as P. syringae [191], Magnaporthe grisea [192], Blumeria graminis, Rhizoctonia solani [193], Phytophthora infestans, Alternaria solani, P. carotovorum [194], Ralstonia solanacearum [195], Xanthomonas oryzae, X. campestris [196], X. arboricola pv. pruni, Xanthomonas fragariae, and Xanthomonas axonopodis pv. vesicatoria [180], among others.

6. Conclusions

Fire blight continues to be a key problem for pome fruit producers worldwide, with its devastating effect killing trees in entire orchards. This results in high economic losses that escalate due to the costs associated with the control measures applied, whether they involve orchard management practices or chemical applications during the bloom period. Moreover, this disease and its causal agent remain a major research topic worldwide, with an exponential increase of 1338 research articles published since 2010 in international journals (source: Scopus; accessed on 2 September 2024; keyword: Erwinia amylovora).
Several studies have been conducted in the characterization of E. amylovora strains isolated worldwide to better understand its epidemiology and evolutionary adaptation. With the advance of next-generation sequencing in the last 10 years, at least 217 whole genomes of E. amylovora have been published (with more anticipated in the future), and comparative genomics studies have shown that this bacterium presents a rather conserved genome, especially in the Amygdaloideae-infecting strains. Nevertheless, it has been shown that even in those strains, different phenotypic traits are expressed, especially considering virulence levels, which makes this subject of great importance for researchers.
Another major research line has been the development of new sustainable tools to control this pathogen to complement cultural measures (e.g., sanitary pruning) that serve to prevent or mitigate the effects of the infection by E. amylovora. The general consensus is that new sustainable measures should be applied to overcome the problems of antibiotic and Cu-based agrochemicals; hence, different approaches have been taken. Several promising approaches include the use of BCAs, essential oils, and particularly the application of AMPs. The potential of AMPs relies on their specificity to the pathogen, low toxicity, and apparent capacity to not select for resistant strains. Several studies have been conducted with different AMPs, mixtures of AMPs, and conjugation of AMPs to control E. amylovora with promising results, making this area of special interest in plant pathology.

Author Contributions

Conceptualization, R.J.M., F.T. and C.S.; formal analysis, R.J.M. and L.R.; investigation, R.J.M., L.R. and F.R.; data curation, R.J.M.; writing—original draft preparation, R.J.M.; writing—review and editing, R.J.M., L.R., F.R., F.T. and C.S.; visualization, R.J.M. and L.R.; supervision, R.J.M., F.R., F.T. and C.S.; project administration, R.J.M.; funding acquisition, R.J.M., F.T. and C.S. All authors have read and agreed to the published version of the manuscript.

Funding

Laura Regalado’s work was funded by Fundação para a Ciência e a Tecnologia (FCT), grant number 2023.01413.BD.

Data Availability Statement

No new data were created or analyzed in this study. Data sharing is not applicable to this article.

Acknowledgments

This work received support and assistance from FCT/MCTES (LA/P/0008/2020 DOI 10.54499/LA/P/0008/2020, UIDP/50006/2020 DOI 10.54499/UIDP/50006/2020 and UIDB/50006/2020 DOI 10.54499/UIDB/50006/2020), through national funds. Fabio Rezzonico’s participation was funded by the Life Science and Facility Management Department at Zurich University for Applied Sciences (ZHAW).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Oh, C.S.; Beer, S.V. Molecular genetics of Erwinia amylovora involved in the development of fire blight. FEMS Microbiol. Lett. 2005, 253, 185–192. [Google Scholar] [CrossRef] [PubMed]
  2. van der Zwet, T.; Orolaza-Halbrendt, N.; Zeller, W. Fire Blight: History, Biology, and Management; The American Phytopathological Society: Saint Paul, MN, USA, 2016; ISBN 978-0-89054-483-9. [Google Scholar]
  3. Pel, C.; Schenk, M.; Delbianco, A.; Vos, S. Pest survey card on Erwinia amylovora. EFSA Support. Publ. 2021, 18, 6767E. [Google Scholar] [CrossRef]
  4. Marco-Noales, E.; Peñalver, J.; Navarro, I.; Gorris, M.T.; Morente, M.C.; Balguerías, C.; Ramírez, J.A.; Recio, C.; De La Hermosa, T.R.; Sancho, R.; et al. Iberian Wild Pear (Pyrus bourgaeana) is a New Host of Erwinia amylovora, the Causal Agent of Fire Blight. Plant Dis. 2017, 101, 502. [Google Scholar] [CrossRef]
  5. CABI. Erwinia amylovora (Fireblight). Available online: https://www.cabi.org/isc/datasheet/21908#top-page (accessed on 4 January 2022).
  6. EPPO. Erwinia amylovora Datasheet. Available online: https://gd.eppo.int/taxon/ERWIAM (accessed on 4 October 2024).
  7. Adeolu, M.; Alnajar, S.; Naushad, S.; SGupta, R. Genome-based phylogeny and taxonomy of the ‘Enterobacteriales’: Proposal for Enterobacterales ord. nov. divided into the families Enterobacteriaceae, Erwiniaceae fam. nov., Pectobacteriaceae fam. nov., Yersiniaceae fam. nov., Hafniaceae fam. nov., Morgane. Int. J. Syst. Evol. Microbiol. 2016, 66, 5575–5599. [Google Scholar] [CrossRef]
  8. EPPO. EPPO A1 and A2 lists of pests recommended for regulation as quarantine pests. EPPO Standards. 2021. Available online: https://www.eppo.int/media/uploaded_images/ACTIVITIES/plant_quarantine/pm1-002-28-en.pdf (accessed on 4 October 2024).
  9. Zhao, Y.; Tian, Y.; Wang, L.; Geng, G.; Zhao, W.; Hu, B.; Zhao, Y. Fire blight disease, a fast-approaching threat to apple and pear production in China. J. Integr. Agric. 2019, 18, 815–820. [Google Scholar] [CrossRef]
  10. Norelli, J.L.; Jones, A.L.; Aldwinckle, H.S. Fire Blight Management in the Twenty-First Century: Using New Technologies that Enhance Host Resistance in Apple. Plant Dis. 2003, 87, 756–765. [Google Scholar] [CrossRef]
  11. Vanneste, J. What is Fire Blight? Who is Erwinia amylovora? How to Control it? In Fire Blight, The Disease and Its Causative Agent, Erwinia amylovora; Vanneste, J., Ed.; CABI: Wallingford, UK, 2000. [Google Scholar]
  12. Gusberti, M.; Klemm, U.; Meier, M.S.; Maurhofer, M.; Hunger-Glaser, I. Fire Blight Control: The Struggle Goes On. A Comparison of Different Fire Blight Control Methods in Switzerland with Respect to Biosafety, Efficacy and Durability. Int. J. Environ. Res. Public Health 2015, 12, 11422–11447. [Google Scholar] [CrossRef]
  13. Jiang, X.; Cassey, A.J.; Marsh, T.L. Economic consequences for tree fruit intermediaries from shocks. J. Agric. Appl. Econ. 2017, 49, 592–616. [Google Scholar] [CrossRef]
  14. Emeriewen, O.F.; Wöhner, T.; Flachowsky, H.; Peil, A. Malus hosts–Erwinia amylovora interactions: Strain pathogenicity and resistance mechanisms. Front. Plant Sci. 2019, 10, 551. [Google Scholar] [CrossRef]
  15. Santander, R.D.; Oliver, J.D.; Biosca, E.G. Cellular, physiological, and molecular adaptive responses of Erwinia amylovora to starvation. FEMS Microbiol. Ecol. 2014, 88, 258–271. [Google Scholar] [CrossRef]
  16. Martins, P.M.M.; Merfa, M.V.; Takita, M.A.; De Souza, A.A. Persistence in phytopathogenic bacteria: Do we know enough? Front. Microbiol. 2018, 9, 1099. [Google Scholar] [CrossRef] [PubMed]
  17. Griffith, C. Fire Blight: The Foundation of Phytobacteriology; The American Phytopathological Society: Saint Paul, MN, USA, 2003. [Google Scholar]
  18. Mansfield, J.; Genin, S.; Magori, S.; Citovsky, V.; Sriariyanum, M.; Ronald, P.; Dow, M.; Verdier, V.; Beer, S.V.; Machado, M.A.; et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 614–629. [Google Scholar] [CrossRef] [PubMed]
  19. Turland, N.J.; Wiersema, J.; Barrie, F.; Greuter, W.; Hawksworth, D.; Herendeen, P.; Knapp, S.; Kusber, W.; Li, D.; Marhold, K.; et al. International Code of Nomenclature for Algae, Fungi, and Plants (Shenzhen Code) Adopted by the Nineteenth International Botanical Congress, Shenzhen, China, 23–29 July 2017; Koeltz Botanical Books: Glashütten, Germany, 2018. [Google Scholar]
  20. Zeng, Q.; Cui, Z.; Wang, J.; Childs, K.L.; Sundin, G.W.; Cooley, D.R.; Yang, C.H.; Garofalo, E.; Eaton, A.; Huntley, R.B.; et al. Comparative genomics of Spiraeoideae-infecting Erwinia amylovora strains provides novel insight to genetic diversity and identifies the genetic basis of a low-virulence strain. Mol. Plant Pathol. 2018, 19, 1652–1666. [Google Scholar] [CrossRef] [PubMed]
  21. Weißhaupt, S.; Köhl, L.; Kunz, S.; Hinze, M.; Ernst, M.; Schmid, A.; Voegele, R.T. Alternative inoculum sources for fire blight: The potential role of fruit mummies and non-host plants. Plant Pathol. 2016, 65, 470–483. [Google Scholar] [CrossRef]
  22. de la Peña-Baca, D.A.; Romo-Chacón, A.; Rios-Velasco, C.; Olivas-Orozco, G.I.; Ornelas-Paz, J.d.J.; Acosta-Muñiz, C.H. Primary inoculum of Erwinia amylovora: Alternative sources and viable but non-culturable state: A review. J. Plant Dis. Prot. 2023, 130, 143–155. [Google Scholar] [CrossRef]
  23. Parcey, M.; Gayder, S.; Morley-Senkler, V.; Bakkeren, G.; Úrbez-Torres, J.R.; Ali, S.; Castle, A.J.; Svircev, A.M. Comparative genomic analysis of Erwinia amylovora reveals novel insights in phylogenetic arrangement, plasmid diversity, and streptomycin resistance. Genomics 2020, 112, 3762–3772. [Google Scholar] [CrossRef]
  24. Braun, P.G.; Hildebrand, P.D. Infection, carbohydrate utilization, and protein profiles of apple, pear, and raspberry isolates of Erwinia amylovora. Can. J. Plant Pathol. 2005, 27, 338–346. [Google Scholar] [CrossRef]
  25. Rezzonico, F.; Braun-Kiewnick, A.; Mann, R.A.; Rodoni, B.; Goesmann, A.; Duffy, B.; Smits, T.H.M. Lipopolysaccharide biosynthesis genes discriminate between Rubus- and Spiraeoideae-infective genotypes of Erwinia amylovora. Mol. Plant Pathol. 2012, 13, 975–984. [Google Scholar] [CrossRef]
  26. Sprecher, C. Comparative Genomics Provides New Insights into Host Specificity and Evolutionary History of Erwinia amylovora. Master’s Thesis, Zürcher Hochschule für Angewandte Wissenschaften (ZHAW), Wädenswil, Switzerland, 2021. [Google Scholar]
  27. Borruso, L.; Salomone-Stagni, M.; Polsinelli, I.; Otto Schmitt, A.; Benini, S. Conservation of Erwinia amylovora pathogenicity-relevant genes among Erwinia genomes. Arch. Microbiol. 2017, 199, 1335–1344. [Google Scholar] [CrossRef]
  28. Ham, H.; Park, D.S. Novel approach toward the understanding of genetic diversity based on the two types of amino acid repeats in Erwinia amylovora. Sci. Rep. 2023, 13, 17876. [Google Scholar] [CrossRef]
  29. Rezzonico, F.; Emeriewen, O.F.; Zeng, Q.; Peil, A.; Smits, T.H.M.; Sundin, G.W. Burning questions for fire blight research: I. Genomics and evolution of Erwinia amylovora and analyses of host-pathogen interactions. J. Plant Pathol. 2024, 106, 797–810. [Google Scholar] [CrossRef]
  30. Puławska, J.; Sobiczewski, P. Phenotypic and genetic diversity of Erwinia amylovora: The causal agent of fire blight. Trees-Struct. Funct. 2012, 26, 3–12. [Google Scholar] [CrossRef]
  31. Denning, W. Transactions of the Society for the Promotion of Useful Arts, in the State of New York; Forgotten Books: London, UK, 2019. [Google Scholar]
  32. Kurz, M.; Carnal, S.; Dafny-Yelin, M.; Mairesse, O.; Gottsberger, R.A.; Ivanović, M.; Grahovac, M.; Lagonenko, A.L.; Drenova, N.; Zharmukhamedova, G.; et al. Tracking the dissemination of Erwinia amylovora in the Eurasian continent using a PCR targeted on the duplication of a single CRISPR spacer. Phytopathol. Res. 2021, 3, 18. [Google Scholar] [CrossRef]
  33. Sletten, A.; Talgø, V.; Rafoss, T.; Melbøe, N.S. Fire blight in norway: A review of strategies and control measures from 1986 to 2016. J. Plant Pathol. 2017, 99, 137–139. [Google Scholar] [CrossRef]
  34. Jock, S.; Wensing, A.; Pulawska, J.; Drenova, N.; Dreo, T.; Geider, K. Molecular analyses of Erwinia amylovora strains isolated in Russia, Poland, Slovenia and Austria describing further spread of fire blight in Europe. Microbiol. Res. 2013, 168, 447–454. [Google Scholar] [CrossRef] [PubMed]
  35. Pucci, N.; L’Aurora, A.; Loreti, S. Fire blight: First report in Latium, Italy. J. Plant Pathol. 2013, 95, 663. [Google Scholar] [CrossRef]
  36. Donat, V.; Biosca, E.G.; Peñalver, J.; López, M.M. Exploring diversity among Spanish strains of Erwinia amylovora and possible infection sources. J. Appl. Microbiol. 2007, 103, 1639–1649. [Google Scholar] [CrossRef] [PubMed]
  37. Gaganidze, D.L.; Aznarashvili, M.A.; Sadunishvili, T.A.; Abashidze, E.O.; Gureilidze, M.A.; Gvritishvili, E.S. Fire blight in Georgia. Ann. Agrar. Sci. 2018, 16, 12–16. [Google Scholar] [CrossRef]
  38. Amashukeli, N.; Gaganidze, D.; Aznarashvili, M.; Kharadze, S.; Sturua, N.; Rezzonico, F.; Sadunishvili, T. Phenotypic Variability of Erwinia amylovora from Pome Fruits in Georgia. Bull. Georg. Natl. Acad. Sci. 2023, 17, 69–74. [Google Scholar]
  39. Aysan, Y.; Mirik, M.; Saygili, H.; Sahin, F.; Kotan, R. Phenotypic characterization of Erwinia amylovora from pome fruits in Turkey. Acta Hortic. 2006, 704, 459–463. [Google Scholar] [CrossRef]
  40. Popović, T.; Jelušić, A.; Živković, L.; Živković, N.; Iličić, R.; Stanisavljević, R.; Stanković, S. Identification, genetic characterization and virulence of Serbian Erwinia amylovora isolates. Eur. J. Plant Pathol. 2020, 157, 857–872. [Google Scholar] [CrossRef]
  41. Dimitrova, E.; Andreev, L. Fireblight situation in Bulgaria and measures undertaken by the NPPO. EPPO Bull. 2004, 34, 343–345. [Google Scholar] [CrossRef]
  42. Constantinescu, F.; Severin, V.; Manole, F.; Oprea, E.; Dascǎlu, G.; Saviuc, C.; Şesan, T.E.; Radulescu, V. Status of fire blight (Erwinia amylovora) disease in Romania: Distribution, pathogen characterization and disease control. Acta Hortic. 2011, 896, 505–510. [Google Scholar] [CrossRef]
  43. Sobiczewski, P.; Zurawicz, E.; Berczyński, S.; Lewandowski, M. Fire blight susceptibility of new apple cultivars and clones from Poland. Acta Hortic. 2006, 704, 551–555. [Google Scholar] [CrossRef]
  44. Baranauskaite, L.; Jogaite, V.; Jankuviene, L. A three-year study of fireblight in Lithuania. Zemdirbyste 2008, 95, 19–26. [Google Scholar]
  45. Végh, A.; Hevesi, M.; Pájtli, É.; Palkovics, L. Characterization of Erwinia amylovora strains from Hungary. Eur. J. Plant Pathol. 2017, 147, 455–461. [Google Scholar] [CrossRef]
  46. Mendes, R.J.; Luz, J.P.; Santos, C.; Tavares, F. CRISPR genotyping as complementary tool for epidemiological surveillance of Erwinia amylovora outbreaks. PLoS ONE 2021, 16, e0250280. [Google Scholar] [CrossRef]
  47. Saad, A.T.; Hanna, L.; Asly, O.J.; Choueiri, E. The distribution and host range of the first serious outbreak of fire blight in lebanon. Acta Hortic. 1999, 489, 65–68. [Google Scholar] [CrossRef]
  48. Manulis, S.; Kleitman, F.; Dror, O.; David, I.; Zutra, D. Characterization of the Erwinia amylovora population in Israel. Phytoparasitica 1997, 26, 39–46. [Google Scholar] [CrossRef]
  49. Ammouneh, H.; Arabi, M.I.E.; Al-Daoude, A. The first record and distribution of the fire blight pathogen Erwinia amylovora in Syria. Australas. Plant Pathol. 2008, 37, 137–140. [Google Scholar] [CrossRef]
  50. Rahnama, K.; Mazarei, M. The status of fire blight on pome fruits in Iran. Acta Hortic. 2002, 590, 99–102. [Google Scholar] [CrossRef]
  51. Doolotkeldieva, T.; Bobushova, S.; Carnal, S.; Rezzonico, F. Genetic characterization of Erwinia amylovora isolates detected in the wild walnut-fruit forest of South Kyrgyzstan. J. Plant Pathol. 2021, 103, 109–120. [Google Scholar] [CrossRef]
  52. Djaimurzina, A.; Umiralieva, Z.; Zharmukhamedova, G.; Born, Y.; Bühlmann, A.; Rezzonico, F. Detection of the causative agent of fire blight—Erwinia amylovora (Burrill) Winslow et al.—In the Southeast of Kazakhstan. Acta Hortic. 2014, 1056, 129–132. [Google Scholar] [CrossRef]
  53. Sun, W.; Gong, P.; Zhao, Y.; Ming, L.; Zeng, Q.; Liu, F. Current Situation of Fire Blight in China. Phytopathology 2023, 113, 2143–2151. [Google Scholar] [CrossRef] [PubMed]
  54. Park, D.H.; Lee, Y.G.; Kim, J.S.; Cha, J.S.; Oh, C.S. Current status of fire blight caused by Erwinia amylovora and action for its management in Korea. J. Plant Pathol. 2017, 99, 59–63. [Google Scholar] [CrossRef]
  55. Jik Lee, H.; Woo Lee, S.; Suh, S.J.; Hyun, I.H. Recent spread and potential pathways for fire blight in South Korea. EPPO Bull. 2022, 52, 135–140. [Google Scholar] [CrossRef]
  56. Fatmi, M.; Bougsiba, M.; Saoud, H. First Report of Fire Blight Caused by Erwinia amylovora on Pear, Apple, and Quince in Morocco. Plant Dis. 2008, 92, 314. [Google Scholar] [CrossRef]
  57. Tafifet, L.; Raio, A.; Holeva, M.C.; Dikhai, R.; Kouskoussa, C.O.; Cesbron, S.; Krimi, Z. Molecular characterization of Algerian Erwinia amylovora strains by VNTR analysis and biocontrol efficacy of Bacillus spp. and Pseudomonas brassicacearum antagonists. Eur. J. Plant Pathol. 2020, 156, 867–883. [Google Scholar] [CrossRef]
  58. Cristian, M.F.; Mirela, C.; Mihaela, S.; Emil, C.; Alina, F.; Mădălina, M.; Dorin, S. Behavior of some apple varieties grown under superintensive system to fire blight (Erwinia amylovora) attack. Fruit Grow. Res. 2018, 34, 94–105. [Google Scholar] [CrossRef]
  59. Sebaihia, M.; Bocsanczy, A.M.; Biehl, B.S.; Quail, M.A.; Perna, N.T.; Glasner, J.D.; DeClerck, G.A.; Cartinhour, S.; Schneider, D.J.; Bentley, S.D.; et al. Complete genome sequence of the plant pathogen Erwinia amylovora strain ATCC 49946. J. Bacteriol. 2010, 192, 2020–2021. [Google Scholar] [CrossRef]
  60. Smits, T.H.M.; Rezzonico, F.; Kamber, T.; Blom, J.; Goesmann, A.; Frey, J.E.; Duffy, B. Complete genome sequence of the fire blight pathogen Erwinia amylovora CFBP 1430 and comparison to other Erwinia spp. Mol. Plant-Microbe Interact. 2010, 23, 384–393. [Google Scholar] [CrossRef] [PubMed]
  61. Song, J.Y.; Yun, Y.H.; Kim, G.D.; Kim, S.H.; Lee, S.J.; Kim, J.F. Genome analysis of Erwinia amylovora strains responsible for a fire blight outbreak in korea. Plant Dis. 2021, 105, 1143–1152. [Google Scholar] [CrossRef]
  62. McGhee, G.C.; Sundin, G.W. Erwinia amylovora CRISPR elements provide new tools for evaluating strain diversity and for microbial source tracking. PLoS ONE 2012, 7, e41706. [Google Scholar] [CrossRef]
  63. Tancos, K.A.; Cox, K.D. Exploring diversity and origins of streptomycin-resistant Erwinia amylovora isolates in New York through CRISPR spacer arrays. Plant Dis. 2016, 100, 1307–1313. [Google Scholar] [CrossRef] [PubMed]
  64. Llop, P.; Donat, V.; Rodríguez, M.; Cabrefiga, J.; Ruz, L.; Palomo, J.L.; Montesinos, E.; López, M.M. An Indigenous Virulent Strain of Erwinia amylovora Lacking the Ubiquitous Plasmid pEA29. Phytopathology 2006, 96, 900–907. [Google Scholar] [CrossRef] [PubMed][Green Version]
  65. Falkenstein, H.; Zeller, W.; Geider, K. The 29 kb Plasmid, Common in Strains of Erwinia amylovora, Modulates Development of Fireblight Symptoms. Microbiology 1989, 135, 2643–2650. [Google Scholar] [CrossRef][Green Version]
  66. Mohammadi, M. Enhanced colonization and pathogenicity of Erwinia amylovora strains transformed with the near-ubiquitous pEA29 plasmid on pear and apple. Plant Pathol. 2010, 59, 252–261. [Google Scholar] [CrossRef]
  67. Llop, P.; Cabrefiga, J.; Smits, T.H.M.; Dreo, T.; Barbe, S.; Pulawska, J.; Bultreys, A.; Blom, J.; Duffy, B.; Montesinos, E.; et al. Erwinia amylovora Novel Plasmid pEI70: Complete Sequence, Biogeography, and Role in Aggressiveness in the Fire Blight Phytopathogen. PLoS ONE 2011, 6, e28651. [Google Scholar] [CrossRef]
  68. Singh, J.; Khan, A. Distinct patterns of natural selection determine sub-population structure in the fire blight pathogen, Erwinia amylovora. Sci. Rep. 2019, 9, 14017. [Google Scholar] [CrossRef]
  69. Förster, H.; McGhee, G.C.; Sundin, G.W.; Adaskaveg, J.E. Characterization of Streptomycin Resistance in Isolates of Erwinia amylovora in California. Phytopathology 2015, 105, 1302–1310. [Google Scholar] [CrossRef]
  70. Mann, R.A.; Smits, T.H.M.; Bühlmann, A.; Blom, J.; Goesmann, A.; Frey, J.E.; Plummer, K.M.; Beer, S.V.; Luck, J.; Duffy, B.; et al. Comparative Genomics of 12 Strains of Erwinia amylovora Identifies a Pan-Genome with a Large Conserved Core. PLoS ONE 2013, 8. [Google Scholar] [CrossRef]
  71. Albanese, D.; Cainelli, C.; Gualandri, V.; Larger, S.; Pindo, M.; Donati, C. Genome sequencing provides new insights on the distribution of Erwinia amylovora lineages in northern Italy. Environ. Microbiol. Rep. 2022, 14, 584–590. [Google Scholar] [CrossRef] [PubMed]
  72. Dardouri, S.; Chehimi, S.; Murillo, J.; Hajlaoui, M.R. Molecular characterization of tunisian strains of Erwinia amylovora. J. Plant Pathol. 2017, 99, 333–337. [Google Scholar] [CrossRef]
  73. EPPO. PM 7/20 (3) Erwinia amylovora. EPPO Bull. 2022, 52, 198–224. [Google Scholar] [CrossRef]
  74. Mitrev, S.; Kostadinovska, E. Isolation and molecular determination of the fire blight pathogen, Erwinia amylovora, isolated from apple trees in the republic of Macedonia. J. Plant Pathol. 2016, 98, 577–580. [Google Scholar] [CrossRef]
  75. Schwarczinger, I.; Kolozsváriné Nagy, J.; Künstler, A.; Szabó, L.; Geider, K.; Király, L.; Pogány, M. Characterization of Myoviridae and Podoviridae family bacteriophages of Erwinia amylovora from Hungary—potential of application in biological control of fire blight. Eur. J. Plant Pathol. 2017, 149, 639–652. [Google Scholar] [CrossRef]
  76. Kharadi, R.R.; Castiblanco, L.F.; Waters, C.M.; Sundin, G.W. Phosphodiesterase genes regulate amylovoran production, biofilm formation, and virulence in Erwinia amylovora. Appl. Environ. Microbiol. 2019, 85, e02233-18. [Google Scholar] [CrossRef]
  77. Klee, S.M.; Sinn, J.P.; Christian, E.; Holmes, A.C.; Zhao, K.; Lehman, B.L.; Peter, K.A.; Rosa, C.; McNellis, T.W. Virulence genetics of an Erwinia amylovora putative polysaccharide transporter family member. J. Bacteriol. 2020, 202, e00390-20. [Google Scholar] [CrossRef]
  78. Obradovic, D.; Balaz, J.; Kevresan, S. Detection of Erwinia amylovora by novel chromosomal polymerase chain reaction primers. Microbiology 2007, 76, 748–756. [Google Scholar] [CrossRef]
  79. Taylor, R.K.; Guilford, P.J.; Clark, R.G.; Hale, C.N.; Forster, R.L.S. Detection of Erwinia amylovora in plant material using novel polymerase chain reaction (PCR) primers. N. Z. J. Crop Hortic. Sci. 2001, 29, 35–43. [Google Scholar] [CrossRef]
  80. Pirc, M.; Ravnikar, M.; Tomlinson, J.; Dreo, T. Improved fireblight diagnostics using quantitative real-time PCR detection of Erwinia amylovora chromosomal DNA. Plant Pathol. 2009, 58, 872–881. [Google Scholar] [CrossRef]
  81. Shin, D.S.; Heo, G.I.l.; Son, S.H.; Oh, C.S.; Lee, Y.K.; Cha, J.S. Development of an Improved Loop-Mediated Isothermal Amplification Assay for On-Site Diagnosis of Fire Blight in Apple and Pear. Plant Pathol. J. 2018, 34, 191–198. [Google Scholar] [CrossRef]
  82. Gottsberger, R.A. Development and evaluation of a real-time PCR assay targeting chromosomal DNA of Erwinia amylovora. Lett. Appl. Microbiol. 2010, 51, 285–292. [Google Scholar] [CrossRef]
  83. Ham, H.; Kim, K.; Yang, S.; Kong, H.G.; Lee, M.-H.; Jin, Y.J.; Park, D.S. Discrimination and Detection of Erwinia amylovora and Erwinia pyrifoliae with a Single Primer Set. Plant Pathol. J. 2022, 38, 194–202. [Google Scholar] [CrossRef]
  84. Gavrilović, V.; Ivanović, Z.; Popović, T.; Živković, S. Characterization of Erwinia amylovora strains isolated from quince trees in Serbia using REP-PCR method. Acta Hortic. 2014, 1056, 169–172. [Google Scholar] [CrossRef]
  85. Doolotkeldieva, T.; Bobushova, S.; Schuster, C.; Konurbaeva, M.; Leclerque, A. Isolation and genetic characterization of Erwinia amylovora bacteria from Kyrgyzstan. Eur. J. Plant Pathol. 2019, 155, 677–686. [Google Scholar] [CrossRef]
  86. Refahi, M.; Baghaee-Ravari, S.; Mahdikhani-Moghaddam, E. Exploring possible variation among Iranian Erwinia amylovora strains using multilocus typing and tandem repeat analysis. J. Agric. Sci. Technol. 2017, 19, 745–754. [Google Scholar]
  87. Rezzonico, F.; Smits, T.H.M.; Duffy, B. Diversity, evolution, and functionality of clustered regularly interspaced short palindromic repeat (CRISPR) regions in the fire blight pathogen Erwinia amylovora. Appl. Environ. Microbiol. 2011, 77, 3819–3829. [Google Scholar] [CrossRef]
  88. Gaganidze, D.; Sadunishvili, T.; Aznarashvili, M.; Abashidze, E.; Gurielidze, M.; Carnal, S.; Rezzonico, F.; Zubadalashvili, M. Fire blight distribution in Georgia and characterization of selected Erwinia amylovora isolates. J. Plant Pathol. 2021, 103, 121–129. [Google Scholar] [CrossRef]
  89. Wallis, A.; Cox, K.D. Examining Spatial Distribution and Spread of Fire Blight in Apple Orchards: Two Case Studies. Plant Heal. Prog. 2021, 22, 445–449. [Google Scholar] [CrossRef]
  90. Parcey, M.; Gayder, S.; Castle, A.J.; Svircev, A.M. Function and Application of the CRISPR-Cas System in the Plant Pathogen Erwinia amylovora. Appl. Environ. Microbiol. 2022, 88, e0251321. [Google Scholar] [CrossRef] [PubMed]
  91. Zhang, Y.; Merighi, M.; Bazzi, C.; Geider, K. Genomic analysis by pulsed-field gel electrophoresis of Erwinia amylovora strains from the Mediterranean region including Italy. J. Plant Pathol. 1998, 80, 225–232. [Google Scholar]
  92. Yaich, M.; Fatmi, M.; Bougsiba, M.; Valentini, F.; Scuderi, G.; D’onghia, A.M.; Cirvilleri, G. Fire blight (Erwinia amylovora [Burrill] Winslow) in Morocco: Importance, geographical distribution and characterization. Phytopathol. Mediterr. 2011, 50, 212–227. [Google Scholar] [CrossRef]
  93. Hannou, N.; Llop, P.; Faure, D.; López, M.M.; Moumni, M. Characterization of Erwinia amylovora Strains from Middle Atlas Mountains in Morocco by PCR Based on Tandem Repeat Sequences. Eur. J. Plant Pathol. 2013, 136, 665–674. [Google Scholar] [CrossRef]
  94. Bühlmann, A.; Dreo, T.; Rezzonico, F.; Pothier, J.F.; Smits, T.H.M.; Ravnikar, M.; Frey, J.E.; Duffy, B. Phylogeography and population structure of the biologically invasive phytopathogen Erwinia amylovora inferred using minisatellites. Environ. Microbiol. 2014, 16, 2112–2125. [Google Scholar] [CrossRef]
  95. Barionovi, D.; Giorgi, S.; Stoeger, A.R.; Ruppitsch, W.; Scortichini, M. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29. J. Appl. Microbiol. 2006, 100, 1084–1094. [Google Scholar] [CrossRef]
  96. Fei, N.; Song, B.; Yang, Y.; Zhu, X.; Guan, W.; Zhao, T. Draft Genome Sequence Data for Erwinia amylovora Strain S618-2-2 Isolated from Pyrus Sinkiangensis in China. PhytoFrontiers 2023, 3, 694–696. [Google Scholar] [CrossRef]
  97. Frey, J.E.; Frey, B.; Frei, D.; Blaser, S.; Gueuning, M.; Bühlmann, A. Next generation biosecurity: Towards genome based identification to prevent spread of agronomic pests and pathogens using nanopore sequencing. PLoS ONE 2022, 17, e0270897. [Google Scholar] [CrossRef]
  98. Mendes, R.J.; Amaro, C.; Luz, J.P.; Tavares, F.; Santos, C. Variability within a clonal population of Erwinia amylovora disclosed by phenotypic analysis. PeerJ 2022, 10, e13695. [Google Scholar] [CrossRef]
  99. European Commission. Farm to Fork Strategy. Available online: https://food.ec.europa.eu/horizontal-topics/farm-fork-strategy_en (accessed on 4 October 2024).
  100. European Commission. Commission Regulation (EC) No 473/2002. Off. J. Eur. Communities 2002. [Google Scholar]
  101. McManus, P.S.; Stockwell, V.O.; Sundin, G.W.; Jones, A.L. Antibiotic use in plant agriculture. Annu. Rev. Phytopathol. 2002, 40, 443–465. [Google Scholar] [CrossRef] [PubMed]
  102. Lamichhane, J.R.; Osdaghi, E.; Behlau, F.; Köhl, J.; Jones, J.B.; Aubertot, J.N. Thirteen decades of antimicrobial copper compounds applied in agriculture. A review. Agron. Sustain. Dev. 2018, 38, 28. [Google Scholar] [CrossRef]
  103. Acimovic, S.A.G.; Meredith, C.L.; Santander, R.D.; Khodadadi, F. Proof of Concept for Shoot Blight and Fire Blight Canker Management with Postinfection Spray Applications of Prohexadione-Calcium and Acibenzolar-S-Methyl in Apple. Plant Dis. 2021, 105, 4095–4105. [Google Scholar] [CrossRef] [PubMed]
  104. Malnoy, M.; Martens, S.; Norelli, J.L.; Barny, M.A.; Sundin, G.W.; Smits, T.H.M.; Duffy, B. Fire blight: Applied genomic insights of the pathogen and host. Annu. Rev. Phytopathol. 2012, 50, 475–494. [Google Scholar] [CrossRef]
  105. Kamber, T.; Smits, T.H.M.; Rezzonico, F.; Duffy, B. Genomics and current genetic understanding of Erwinia amylovora and the fire blight antagonist Pantoea vagans. Trees–Struct. Funct. 2012, 26, 227–238. [Google Scholar] [CrossRef]
  106. Mechan Llontop, M.E.; Hurley, K.; Tian, L.; Bernal Galeano, V.A.; Wildschutte, H.K.; Marine, S.C.; Yoder, K.S.; Vinatzer, B.A. Exploring Rain as Source of Biological Control Agents for Fire Blight on Apple. Front. Microbiol. 2020, 11, 199. [Google Scholar] [CrossRef] [PubMed]
  107. Johnson, K.B.; Stockwell, V.O. Management of fire blight: A case study in microbial ecology. Annu. Rev. Phytopathol. 1998, 36, 227–248. [Google Scholar] [CrossRef]
  108. Broggini, G.A.L.; Duffy, B.; Holliger, E.; Schärer, H.J.; Gessler, C.; Patocchi, A. Detection of the fire blight biocontrol agent Bacillus subtilis BD170 (Biopro®) in a Swiss apple orchard. Eur. J. Plant Pathol. 2005, 111, 93–100. [Google Scholar] [CrossRef]
  109. Stockwell, V.O.; Johnson, K.B.; Sugar, D.; Loper, J.E. Control of fire blight by Pseudomonas fluorescens A506 and Pantoea vagans C9-1 applied as single strains and mixed inocula. Phytopathology 2010, 100, 1330–1339. [Google Scholar] [CrossRef]
  110. Rezzonico, F.; Smits, T.H.; Montesinos, E.; Frey, J.E.; Duffy, B. Genotypic comparison of Pantoea agglomerans plant and clinical strains. BMC Microbiol. 2009, 9, 204. [Google Scholar] [CrossRef]
  111. Pusey, P.L.; Stockwell, V.O.; Rudell, D.R. Antibiosis and acidification by Pantoea agglomerans strain E325 may contribute to suppression of Erwinia amylovora. Phytopathology 2008, 98, 1136–1143. [Google Scholar] [CrossRef] [PubMed]
  112. Neeno-Eckwall, E.C.; Kinkel, L.L.; Schottel, J.L. Competition and antibiosis in the biological control of potato scab. Can. J. Microbiol. 2001, 47, 332–340. [Google Scholar] [CrossRef]
  113. Francés, J.; Bonaterra, A.; Moreno, M.C.; Cabrefiga, J.; Badosa, E.; Montesinos, E. Pathogen aggressiveness and postharvest biocontrol efficiency in Pantoea agglomerans. Postharvest Biol. Technol. 2006, 39, 299–307. [Google Scholar] [CrossRef]
  114. Gromyko, O.; Tistechok, S.; Roman, I.; Aravitska, O.; Luzhetskyy, A.; Parnikoza, I.; Fedorenko, V. Isolation and characterization of culturable actinobacteria associated with Polytrichum strictum (Galindez Island, the maritime Antarctic). Ukr. Antarct. J. 2021, 2021, 82–97. [Google Scholar] [CrossRef]
  115. Dagher, F.; Nickzad, A.; Zheng, J.; Hoffmann, M.; Déziel, E. Characterization of the biocontrol activity of three bacterial isolates against the phytopathogen Erwinia amylovora. Microbiologyopen 2021, 10, e1202. [Google Scholar] [CrossRef]
  116. Arab, M.; Ahani Azari, A. Antagonistic potential of rhizospheric and endophytic bacteria against Fire blight, caused by Erwinia amylovora. Int. J. Mol. Clin. Microbiol. 2020, 10, 1331–1338. [Google Scholar]
  117. Sharifazizi, M.; Harighi, B.; Sadeghi, A. Evaluation of biological control of Erwinia amylovora, causal agent of fire blight disease of pear by antagonistic bacteria. Biol. Control. 2017, 104, 28–34. [Google Scholar] [CrossRef]
  118. Shemshura, O.; Alimzhanova, M.; Ismailova, E.; Molzhigitova, A.; Daugaliyeva, S.; Sadanov, A. Antagonistic activity and mechanism of a novel Bacillus amyloliquefaciens MB40 strain against fire blight. J. Plant Pathol. 2020, 102, 825–833. [Google Scholar] [CrossRef]
  119. Leathers, T.D.; Saunders, L.P.; Bowman, M.J.; Price, N.P.J.; Bischoff, K.M.; Rich, J.O.; Skory, C.D.; Nunnally, M.S. Inhibition of Erwinia amylovora by Bacillus nakamurai. Curr. Microbiol. 2020, 77, 875–881. [Google Scholar] [CrossRef]
  120. Choi, O.; Cho, J.; Kang, B.; Lee, Y.; Kim, J. Negatively Regulated Aerobactin and Desferrioxamine E by Fur in Pantoea ananatis Are Required for Full Siderophore Production and Antibacterial Activity, but Not for Virulence. Appl. Environ. Microbiol. 2022, 88, e0240521. [Google Scholar] [CrossRef]
  121. Sabri, M.; Habbadi, K.; Achbani, E.H.; Benkirane, R.; El Handi, K.; Ou-Zine, M.; Benali, T.; Elbeaino, T. Antagonistic effect of Leuconostoc mesenteroides on grapevine crown gall and fire blight. J. Crop Improv. 2022, 431–446. [Google Scholar] [CrossRef]
  122. Medhioub, I.; Cheffi, M.; Tounsi, S.; Triki, M.A. Study of Bacillus velezensis OEE1 potentialities in the biocontrol against Erwinia amylovora, causal agent of fire blight disease of rosaceous plants. Biol. Control. 2022, 167, 104842. [Google Scholar] [CrossRef]
  123. Büyükcam, A.; Tuncer, Ö.; Gür, D.; Sancak, B.; Ceyhan, M.; Cengiz, A.B.; Kara, A. Clinical and microbiological characteristics of Pantoea agglomerans infection in children. J. Infect. Public Health 2018, 11, 304–309. [Google Scholar] [CrossRef] [PubMed]
  124. Soutar, C.D.; Stavrinides, J. Molecular validation of clinical Pantoea isolates identified by MALDI-TOF. PLoS ONE 2019, 14, e0224731. [Google Scholar] [CrossRef]
  125. Sundin, G.W.; Werner, N.A.; Yoder, K.S.; Aldwinckle, H.S. Field Evaluation of Biological Control of Fire Blight in the Eastern United States. Plant Dis. 2009, 93, 386–394. [Google Scholar] [CrossRef]
  126. Kim, I.-Y.; Lew, B.; Zhao, Y.; Korban, S.S.; Choi, H.; Kim, K. Biocontrol of fire blight via microcapsule-mediated delivery of the bacterial antagonist Pantoea agglomerans E325 to apple blossoms. BioControl 2022, 67, 433–442. [Google Scholar] [CrossRef]
  127. Johnson, K.B.; Temple, T.N.; Achala, K.C.; Elkins, R.B. Refinement of Nonantibiotic Spray Programs for Fire Blight Control in Organic Pome Fruit. Plant Dis. 2022, 106, 623–633. [Google Scholar] [CrossRef]
  128. Buttimer, C.; McAuliffe, O.; Ross, R.P.; Hill, C.; O’Mahony, J.; Coffey, A. Bacteriophages and bacterial plant diseases. Front. Microbiol. 2017, 8, 34. [Google Scholar] [CrossRef]
  129. Ni, P.; Wang, L.; Deng, B.; Jiu, S.; Ma, C.; Zhang, C.; Almeida, A.; Wang, D.; Xu, W.; Wang, S. Combined application of bacteriophages and carvacrol in the control of Pseudomonas syringae pv. actinidiae planktonic and biofilm forms. Microorganisms 2020, 8, 837. [Google Scholar] [CrossRef]
  130. Attai, H.; Brown, P.J.B. Isolation and characterization T4-and T7-like phages that infect the bacterial plant pathogen agrobacterium tumefaciens. Viruses 2019, 11, 528. [Google Scholar] [CrossRef]
  131. Dömötör, D.; Frank, T.; Rákhely, G.; Doffkay, Z.; Schneider, G.; Kovács, T. Comparative analysis of two bacteriophages of Xanthomonas arboricola pv. juglandis. Infect. Genet. Evol. 2016, 43, 371–377. [Google Scholar] [CrossRef] [PubMed]
  132. Batinovic, S.; Wassef, F.; Knowler, S.A.; Rice, D.T.F.; Stanton, C.R.; Rose, J.; Tucci, J.; Nittami, T.; Vinh, A.; Drummond, G.R.; et al. Bacteriophages in Natural and Artificial Environments. Pathogens 2019, 8, 100. [Google Scholar] [CrossRef] [PubMed]
  133. Grace, E.R.; Rabiey, M.; Friman, V.P.; Jackson, R.W. Seeing the forest for the trees: Use of phages to treat bacterial tree diseases. Plant Pathol. 2021, 70, 1987–2004. [Google Scholar] [CrossRef]
  134. Parcey, M.; Gayder, S.; Castle, A.J.; Svircev, A.M. Molecular Profile of Phage Infection: A Novel Approach for the Characterization of Erwinia Phages Through qPCR. Int. J. Mol. Sci. 2020, 21, 553. [Google Scholar] [CrossRef]
  135. Park, J.; Lee, G.M.; Kim, D.; Park, D.H.; Oh, C.S. Characterization of the lytic bacteriophage phiEaP-8 effective against both Erwinia amylovora and Erwinia pyrifoliae causing severe diseases in apple and pear. Plant Pathol. J. 2018, 34, 445–450. [Google Scholar] [CrossRef] [PubMed]
  136. Lagonenko, A.L.; Sadovskaya, O.; Valentovich, L.N.; Evtushenkov, A.N. Characterization of a new ViI-like Erwinia amylovora bacteriophage phiEa2809. FEMS Microbiol. Lett. 2015, 362, fnv031. [Google Scholar] [CrossRef] [PubMed]
  137. Park, J.; Kim, B.; Song, S.; Lee, Y.W.; Roh, E. Isolation of Nine Bacteriophages Shown Effective Against Erwinia amylovora in Korea. Plant Pathol. J. 2022, 38, 248–253. [Google Scholar] [CrossRef]
  138. Roach, D.R.; Sjaarda, D.R.; Castle, A.J.; Svircev, A.M. Host exopolysaccharide quantity and composition impact erwinia: Amylovora bacteriophage pathogenesis. Appl. Environ. Microbiol. 2013, 79, 3249–3256. [Google Scholar] [CrossRef]
  139. Nazzaro, F.; Fratianni, F.; De Martino, L.; Coppola, R.; De Feo, V. Effect of essential oils on pathogenic bacteria. Pharmaceuticals 2013, 6, 1451–1474. [Google Scholar] [CrossRef]
  140. Bakkali, F.; Averbeck, S.; Averbeck, D.; Idaomar, M. Biological effects of essential oils—A review. Food Chem. Toxicol. 2008, 46, 446–475. [Google Scholar] [CrossRef]
  141. Choudhary, P.; Aggarwal, P.R.; Rana, S.; Nagarathnam, R.; Muthamilarasan, M. Molecular and metabolomic interventions for identifying potential bioactive molecules to mitigate diseases and their impacts on crop plants. Physiol. Mol. Plant Pathol. 2021, 114, 101624. [Google Scholar] [CrossRef]
  142. Sharifi-Rad, J.; Sureda, A.; Tenore, G.C.; Daglia, M.; Sharifi-Rad, M.; Valussi, M.; Tundis, R.; Sharifi-Rad, M.; Loizzo, M.R.; Oluwaseun Ademiluyi, A.; et al. Biological Activities of Essential Oils: From Plant Chemoecology to Traditional Healing Systems. Molecules 2017, 22, 70. [Google Scholar] [CrossRef] [PubMed]
  143. Vujanović, M.; Zengin, G.; Đurović, S.; Mašković, P.; Cvetanović, A.; Radojković, M. Biological activity of extracts of traditional wild medicinal plants from the Balkan Peninsula. S. Afr. J. Bot. 2019, 120, 213–218. [Google Scholar] [CrossRef]
  144. Akhlaghi, M.; Tarighi, S.; Taheri, P. Effects of plant essential oils on growth and virulence factors of Erwinia amylovora. J. Plant Pathol. 2020, 102, 409–419. [Google Scholar] [CrossRef]
  145. Loukhaoukha, R.; Saidi, F.; Jullien, F.; Benabdelkader, T. Chemical composition and antibacterial activity of Lavandula stoechas essential oil and its main components against Erwinia amylovora and Pectobacterium carotovorum subsp. carotovorum. Phytotherapie 2018, 16, 149–157. [Google Scholar] [CrossRef]
  146. Kokoskova, B.; Pouvova, D.; Pavela, R. Effectiveness of plant essential oils against Erwinia amylovora, Pseudomonas syringae pv. syringae and associated saprophytic bacteria on/in host plants. J. Plant Pathol. 2011, 93, 133–139. [Google Scholar]
  147. Ciocarlan, A.; Dragalin, I.; Aricu, A.; Lupascu, L.; Ciocarlan, N.; Vergel, K.; Duliu, O.G.; Hristozova, G.; Zinicovscaia, I. Chemical Profile, Elemental Composition, and Antimicrobial Activity of Plants of the Teucrium (Lamiaceae) Genus Growing in Moldova. Agronomy 2022, 12, 772. [Google Scholar] [CrossRef]
  148. Doukkali, L.; Tahiri, A.; Askarne, L.; Tazi, B.; Guenoun, F.; Ezrari, S.; Lahlali, R. Chemical composition and antibacterial activity of Moroccan Artemisia mesatlantica and A. absinthium essential oils against fire blight caused by Erwinia amylovora. Not. Sci. Biol. 2022, 14, 11173. [Google Scholar] [CrossRef]
  149. Mikiciński, A.; Sobiczewski, P.; Berczyński, S. Efficacy of fungicides and essential oils against bacterial diseases of fruit trees. J. Plant Prot. Res. 2012, 52, 467–471. [Google Scholar] [CrossRef]
  150. Proto, M.R.; Biondi, E.; Baldo, D.; Levoni, M.; Filippini, G.; Modesto, M.; Di Vito, M.; Bugli, F.; Ratti, C.; Minardi, P.; et al. Essential Oils and Hydrolates: Potential Tools for Defense Against Bacterial Plant Pathogens. Microorganisms 2022, 10, 702. [Google Scholar] [CrossRef]
  151. Doukkali, E.; Radouane, N.; Tahiri, A.; Tazi, B.; Guenoun, F.; Lahlali, R. Chemical composition and antibacterial activity of essential oils of Cinnamomum cassia and Syzygium aromaticum plants and their nanoparticles against Erwinia amylovora. Arch. Phytopathol. Plant Prot. 2022, 55, 217–234. [Google Scholar] [CrossRef]
  152. Ageitos, J.M.; Sánchez-Pérez, A.; Calo-Mata, P.; Villa, T.G. Antimicrobial peptides (AMPs): Ancient compounds that represent novel weapons in the fight against bacteria. Biochem. Pharmacol. 2017, 133, 117–138. [Google Scholar] [CrossRef]
  153. Li, S.; Wang, Y.; Xue, Z.; Jia, Y.; Li, R.; He, C.; Chen, H. The structure-mechanism relationship and mode of actions of antimicrobial peptides: A review. Trends Food Sci. Technol. 2021, 109, 103–115. [Google Scholar] [CrossRef]
  154. Ilyas, H.; Datta, A.; Bhunia, A. An Approach Towards Structure Based Antimicrobial Peptide Design for Use in Development of Transgenic Plants: A Strategy for Plant Disease Management. Curr. Med. Chem. 2017, 24, 1350–1364. [Google Scholar] [CrossRef] [PubMed]
  155. Boman, H.G. Peptide Antibiotics and Their Role in Innate Immunity. Annu. Rev. Immunol. 1995, 13, 61–92. [Google Scholar] [CrossRef]
  156. Koehbach, J.; Craik, D.J. The Vast Structural Diversity of Antimicrobial Peptides. Trends Pharmacol. Sci. 2019, 40, 517–528. [Google Scholar] [CrossRef]
  157. Erdem Büyükkiraz, M.; Kesmen, Z. Antimicrobial peptides (AMPs): A promising class of antimicrobial compounds. J. Appl. Microbiol. 2021, 1–24. [Google Scholar] [CrossRef] [PubMed]
  158. Mahlapuu, M.; Björn, C.; Ekblom, J. Antimicrobial peptides as therapeutic agents: Opportunities and challenges. Crit. Rev. Biotechnol. 2020, 40, 978–992. [Google Scholar] [CrossRef]
  159. Krishnan, M.; Choi, J.; Jang, A.; Kim, Y. A novel peptide antibiotic, Pro10-1D, designed from insect defensin shows antibacterial and anti-inflammatory activities in sepsis models. Int. J. Mol. Sci. 2020, 21, 6216. [Google Scholar] [CrossRef]
  160. Zhang, Q.Y.; Yan, Z.; Meng, Y.M.; Hong, X.Y.; Shao, G.; Ma, J.J.; Cheng, X.R.; Liu, J.; Kang, J.; Fu, C.Y. Antimicrobial peptides: Mechanism of action, activity and clinical potential. Mil. Med. Res. 2021, 8, 48. [Google Scholar] [CrossRef]
  161. Brogden, K.A. Antimicrobial peptides: Pore formers or metabolic inhibitors in bacteria? Nat. Rev. Microbiol. 2005, 3, 238–250. [Google Scholar] [CrossRef] [PubMed]
  162. Matsuzaki, K. Membrane Permeabilization Mechanisms. Antimicrob. Pept. 2019, 1117, 9–16. [Google Scholar] [CrossRef]
  163. Xu, C.; Ma, W.; Wang, K.; He, K.; Chen, Z.; Liu, J.; Yang, K.; Yuan, B. Correlation between Single-Molecule Dynamics and Biological Functions of Antimicrobial Peptide Melittin. J. Phys. Chem. Lett. 2020, 11, 4834–4841. [Google Scholar] [CrossRef]
  164. Lee, T.-H.; NHall, K.; Aguilar, M.-I. Antimicrobial Peptide Structure and Mechanism of Action: A Focus on the Role of Membrane Structure. Curr. Top. Med. Chem. 2015, 16, 25–39. [Google Scholar] [CrossRef] [PubMed]
  165. Melo, M.N.; Ferre, R.; Castanho, M.A.R.B. Antimicrobial peptides: Linking partition, activity and high membrane-bound concentrations. Nat. Rev. Microbiol. 2009, 7, 245–250. [Google Scholar] [CrossRef]
  166. Zhang, K.; Zhang, H.; Gao, C.; Chen, R.; Li, C. Antimicrobial Mechanism of pBD2 Against Staphylococcus aureus. Molecules 2020, 25, 3513. [Google Scholar] [CrossRef]
  167. Zhang, L.; Wang, Y.-H.; Zhang, X.; Lancaster, L.; Zhou, J.; Noller, H.F. The structural basis for inhibition of ribosomal translocation by viomycin. Proc. Natl. Acad. Sci. USA 2020, 117, 10271–10277. [Google Scholar] [CrossRef]
  168. Han, X.; Kou, Z.; Jiang, F.; Sun, X.; Shang, D. Interactions of Designed Trp-Containing Antimicrobial Peptides with DNA of Multidrug-Resistant Pseudomonas aeruginosa. DNA Cell Biol. 2021, 40, 414–424. [Google Scholar] [CrossRef]
  169. Zhang, R.; Wang, Z.; Tian, Y.; Yin, Q.; Cheng, X.; Lian, M.; Zhou, B.; Zhang, X.; Yang, L. Efficacy of antimicrobial peptide DP7, designed by machine-learning method, against methicillin-resistant staphylococcus aureus. Front. Microbiol. 2019, 10, 1175. [Google Scholar] [CrossRef]
  170. Yi, L.; Dang, J.; Zhang, L.; Wu, Y.; Liu, B.; Lü, X. Purification, characterization and bactericidal mechanism of a broad spectrum bacteriocin with antimicrobial activity against multidrug-resistant strains produced by Lactobacillus coryniformis XN8. Food Control 2016, 67, 53–62. [Google Scholar] [CrossRef]
  171. Graf, M.; Mardirossian, M.; Nguyen, F.; Seefeldt, A.C.; Guichard, G.; Scocchi, M.; Innis, C.A.; Wilson, D.N. Proline-rich antimicrobial peptides targeting protein synthesis. Nat. Prod. Rep. 2017, 34, 702–711. [Google Scholar] [CrossRef] [PubMed]
  172. Manabe, T.; Kawasaki, K. D-form KLKLLLLLKLK-NH 2 peptide exerts higher antimicrobial properties than its L-form counterpart via an association with bacterial cell wall components. Sci. Rep. 2017, 7, 43384. [Google Scholar] [CrossRef]
  173. Kurpe, S.R.; Grishin, S.Y.; Surin, A.K.; Panfilov, A.V.; Slizen, M.V.; Chowdhury, S.D.; Galzitskaya, O.V. Antimicrobial and Amyloidogenic Activity of Peptides. Can Antimicrobial Peptides Be Used Against SARS-CoV-2? Int. J. Mol. Sci. 2020, 21, 9552. [Google Scholar] [CrossRef]
  174. Liu, W.; Wu, Z.; Mao, C.; Guo, G.; Zeng, Z.; Fei, Y.; Wan, S.; Peng, J.; Wu, J. Antimicrobial Peptide Cec4 Eradicates the Bacteria of Clinical Carbapenem-Resistant Acinetobacter baumannii Biofilm. Front. Microbiol. 2020, 11, 1532. [Google Scholar] [CrossRef] [PubMed]
  175. Maselli, V.; Galdiero, E.; Salzano, A.M.; Scaloni, A.; Maione, A.; Falanga, A.; Naviglio, D.; Guida, M.; Di Cosmo, A.; Galdiero, S. OctoPartenopin: Identification and Preliminary Characterization of a Novel Antimicrobial Peptide from the Suckers of Octopus Vulgaris. Mar. Drugs 2020, 18, 380. [Google Scholar] [CrossRef]
  176. Montesinos, E. Antimicrobial peptides and plant disease control. FEMS Microbiol. Lett. 2007, 270, 1–11. [Google Scholar] [CrossRef]
  177. Luo, X.; Wu, W.; Feng, L.; Treves, H.; Ren, M. Short peptides make a big difference: The role of botany-derived amps in disease control and protection of human health. Int. J. Mol. Sci. 2021, 22, 11363. [Google Scholar] [CrossRef] [PubMed]
  178. Cabrefiga, J.; Montesinos, E. Lysozyme enhances the bactericidal effect of BP100 peptide against Erwinia amylovora, the causal agent of fire blight of rosaceous plants. BMC Microbiol. 2017, 17, 39. [Google Scholar] [CrossRef]
  179. Shanmugaraj, B.; Bulaon, C.J.I.; Malla, A.; Phoolcharoen, W. Biotechnological insights on the expression and production of antimicrobial peptides in plants. Molecules 2021, 26, 4032. [Google Scholar] [CrossRef]
  180. Oliveras, À.; Camó, C.; Caravaca-Fuentes, P.; Moll, L.; Riesco-Llach, G.; Gil-Caballero, S.; Badosa, E.; Bonaterra, A.; Montesinos, E.; Feliu, L.; et al. Peptide Conjugates Derived from flg15, Pep13, and PIP1 That Are Active Against Plant-Pathogenic Bacteria and Trigger Plant Defense Responses. Appl. Environ. Microbiol. 2022, 88, e0057422. [Google Scholar] [CrossRef]
  181. Badosa, E.; Ferre, R.; Planas, M.; Feliu, L.; Besalú, E.; Cabrefiga, J.; Bardají, E.; Montesinos, E. A library of linear undecapeptides with bactericidal activity against phytopathogenic bacteria. Peptides 2007, 28, 2276–2285. [Google Scholar] [CrossRef] [PubMed]
  182. Güell, I.; Micaló, L.; Cano, L.; Badosa, E.; Ferre, R.; Montesinos, E.; Bardají, E.; Feliu, L.; Planas, M. Peptidotriazoles with antimicrobial activity against bacterial and fungal plant pathogens. Peptides 2012, 33, 9–17. [Google Scholar] [CrossRef] [PubMed]
  183. Badosa, E.; Montesinos, L.; Camó, C.; Ruz, L.; Cabrefiga, J.; Francés, J.; Gascón, B.; Planas, M.; Feliu, L.; Montesinos, E. Control of fire blight infections with synthetic peptides that elicit plant defense responses. J. Plant Pathol. 2017, 99, 65–73. [Google Scholar] [CrossRef]
  184. Güell, I.; Cabrefiga, J.; Badosa, E.; Ferre, R.; Talleda, M.; Bardají, E.; Planas, M.; Feliu, L.; Montesinos, E. Improvement of the efficacy of linear undecapeptides against plant-pathogenic bacteria by incorporation of D-amino acids. Appl. Environ. Microbiol. 2011, 77, 2667–2675. [Google Scholar] [CrossRef]
  185. Nadal, A.; Montero, M.; Company, N.; Badosa, E.; Messeguer, J.; Montesinos, L.; Montesinos, E.; Pla, M. Constitutive expression of transgenes encoding derivatives of the synthetic antimicrobial peptide BP100: Impact on rice host plant fitness. BMC Plant Biol. 2012, 12, 159. [Google Scholar] [CrossRef]
  186. Baró, A.; Badosa, E.; Montesinos, L.; Feliu, L.; Planas, M.; Montesinos, E.; Bonaterra, A. Screening and identification of BP100 peptide conjugates active against Xylella fastidiosa using a viability-qPCR method. BMC Microbiol. 2020, 20, 229. [Google Scholar] [CrossRef]
  187. Montesinos, L.; Gascón, B.; Ruz, L.; Badosa, E.; Planas, M.; Feliu, L.; Montesinos, E. A Bifunctional Synthetic Peptide with Antimicrobial and Plant Elicitation Properties That Protect Tomato Plants from Bacterial and Fungal Infections. Front. Plant Sci. 2021, 12, 756357. [Google Scholar] [CrossRef] [PubMed]
  188. Mariz-Ponte, N.; Regalado, L.; Gimranov, E.; Tassi, N.; Moura, L.; Gomes, P.; Tavares, F.; Santos, C.; Teixeira, C. A Synergic Potential of Antimicrobial Peptides Against Pseudomonas syringae pv. Actinidiae. Molecules 2021, 26, 1461. [Google Scholar] [CrossRef]
  189. Mendes, R.J.; Regalado, L.; Luz, J.P.; Tassi, N.; Teixeira, C.; Gomes, P.; Tavares, F.; Santos, C. In vitro evaluation of five antimicrobial peptides against the plant pathogen Erwinia amylovora. Biomolecules 2021, 11, 554. [Google Scholar] [CrossRef]
  190. Mendes, R.J.; Sario, S.; Luz, J.P.; Tassi, N.; Teixeira, C.; Gomes, P.; Tavares, F.; Santos, C. Evaluation of three antimicrobial peptides mixtures to control the phytopathogen responsible for fire blight disease. Plants 2021, 10, 2637. [Google Scholar] [CrossRef]
  191. Monroc, S.; Badosa, E.; Besalú, E.; Planas, M.; Bardají, E.; Montesinos, E.; Feliu, L. Improvement of cyclic decapeptides against plant pathogenic bacteria using a combinatorial chemistry approach. Peptides 2006, 27, 2575–2584. [Google Scholar] [CrossRef] [PubMed]
  192. Coca, M.; Peñas, G.; Gómez, J.; Campo, S.; Bortolotti, C.; Messeguer, J.; Segundo, B.S. Enhanced resistance to the rice blast fungus Magnaporthe grisea conferred by expression of a cecropin A gene in transgenic rice. Planta 2006, 223, 392–406. [Google Scholar] [CrossRef] [PubMed]
  193. Rahnamaeian, M.; Langen, G.; Imani, J.; Khalifa, W.; Altincicek, B.; Von Wettstein, D.; Kogel, K.H.; Vilcinskas, A. Insect peptide metchnikowin confers on barley a selective capacity for resistance to fungal ascomycetes pathogens. J. Exp. Bot. 2009, 60, 4105–4114. [Google Scholar] [CrossRef] [PubMed]
  194. Ali, G.S.; Reddy, A.S.N. Inhibition of fungal and bacterial plant pathogens by synthetic peptides: In vitro growth inhibition, interaction between peptides and inhibition of disease progression. Mol. Plant-Microbe Interact. 2000, 13, 847–859. [Google Scholar] [CrossRef] [PubMed]
  195. Jan, P.S.; Huang, H.Y.; Chen, H.M. Expression of a synthesized gene encoding cationic peptide cecropin B in transgenic tomato plants protects against bacterial diseases. Appl. Environ. Microbiol. 2010, 76, 769–775. [Google Scholar] [CrossRef]
  196. Datta, A.; Ghosh, A.; Airoldi, C.; Sperandeo, P.; Mroue, K.H.; Jimenez-Barbero, J.; Kundu, P.; Ramamoorthy, A.; Bhunia, A. Antimicrobial Peptides: Insights into Membrane Permeabilization, Lipopolysaccharide Fragmentation and Application in Plant Disease Control. Sci. Rep. 2015, 5, 11951. [Google Scholar] [CrossRef]
Figure 1. World distribution of Erwinia amylovora. https://gd.eppo.int/taxon/ERWIAM/distribution (accessed on 20 March 2024).
Figure 1. World distribution of Erwinia amylovora. https://gd.eppo.int/taxon/ERWIAM/distribution (accessed on 20 March 2024).
Horticulturae 10 01178 g001
Figure 2. Diagram of different control measures against fire blight.
Figure 2. Diagram of different control measures against fire blight.
Horticulturae 10 01178 g002
Figure 3. Models of antibacterial mechanisms of antimicrobial peptides (AMPs).
Figure 3. Models of antibacterial mechanisms of antimicrobial peptides (AMPs).
Horticulturae 10 01178 g003
Table 1. Primers for specific identification of Erwinia amylovora with different molecular techniques.
Table 1. Primers for specific identification of Erwinia amylovora with different molecular techniques.
PrimerSequence (5′-3′)TechniqueReferences
RS24580-205F γCACTGCGCCTGTTGTTCAPCR[83]
205R γATGTATCTGGTAGCCGGGTAAGTT
G1-FCCTGCATAAATCACCGCTGACAGCTCAATGPCR[79]
G2-RGCTACCACTGATCGCTCGAATCAAATCGGC
FER1-FAGCAGCAATTAATGGCAAGTATAGTCAPCR[78]
FER1-RAATTTAATCAGGTCACCTCTGTTCAAC
rgER2R ΦAAAAGAGACATCTGGATTCAGACAATPCR[73]
Ams116FTCCCACATACTGTGAATCATCCAqPCR[80]
Ams189RGGGTATTTGCGCTAATTTTATTCG
Ams141T ΤFAM-CCAGAATCTGGCCCGCGTATACCG-TAMRA
ITS15FTGAGTAATGAGCGAGCTAAGTGAAGqPCR[80]
ITS93RCGCAATGCTCATGGACTCAA
ITS43T ΤFAM-AGGCGTCAGCGCGCAGCAAC-TAMRA
hpEaFCCG TGGAGACCGATCTTTTAqPCR[82]
hpEaRAAGTTTCTCCGCCCTACGAT
hpEaP ΤFAM-TCGTCGAATGCTGCCTCTCT-MGB
Ea_Shin2018_F3ATAATAAGAGAATGGCGCTATGLAMP[81]
Ea_Shin2018_B3TCTACATCTCCACCTTTGG
Ea_Shin2018_FIPTAATGAAGTTGAATCTCAGGCATGAGAAAAAATCCATTGTAAAACCTTCG
Ea_Shin2018_BIPGATGGATTGCTTAGTGAGCTCAGCCAATCTCTCCACAACCG
Ea_Shin2018_LoopFAAAGTTGTTTTCATCCCACGGA
γ This set of primers also amplifies for Erwinia pyrifoliae but with a different amplicon size; Φ Reverse primer used in combination with FER1-F; Τ Probe for qPCR.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Mendes, R.J.; Regalado, L.; Rezzonico, F.; Tavares, F.; Santos, C. Deciphering Fire Blight: From Erwinia amylovora Ecology to Genomics and Sustainable Control. Horticulturae 2024, 10, 1178. https://doi.org/10.3390/horticulturae10111178

AMA Style

Mendes RJ, Regalado L, Rezzonico F, Tavares F, Santos C. Deciphering Fire Blight: From Erwinia amylovora Ecology to Genomics and Sustainable Control. Horticulturae. 2024; 10(11):1178. https://doi.org/10.3390/horticulturae10111178

Chicago/Turabian Style

Mendes, Rafael J., Laura Regalado, Fabio Rezzonico, Fernando Tavares, and Conceição Santos. 2024. "Deciphering Fire Blight: From Erwinia amylovora Ecology to Genomics and Sustainable Control" Horticulturae 10, no. 11: 1178. https://doi.org/10.3390/horticulturae10111178

APA Style

Mendes, R. J., Regalado, L., Rezzonico, F., Tavares, F., & Santos, C. (2024). Deciphering Fire Blight: From Erwinia amylovora Ecology to Genomics and Sustainable Control. Horticulturae, 10(11), 1178. https://doi.org/10.3390/horticulturae10111178

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop