KASP Markers for Identifying Roselle (Hibiscus sabdariffa L.) Key Varieties Based on Genetic Polymorphisms Revealed by ddRAD-Seq
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Roselle gDNA Extraction
2.3. Library Construction for ddRAD-Seq Analysis
2.4. Raw Sequencing Data Processing and SNP Calling
2.5. Phylogenetic Analysis Using Polymorphic SNPs
2.6. Development of Kompetitive Allele Specific PCR (KASP) Markers
3. Results
3.1. DdRAD-Seq Analysis and SNP Exploration in Roselle Genotypes
3.2. Genetic Diversity Evaluation of Roselle Varieties Using SNP Markers from ddRAD-Seq
3.3. Nine KASP Markers Were Developed for Variety Identification on Roselles
3.4. Evaluation of the KASP Genotyping System with an Additional 54 Roselle Accessions
4. Discussion
4.1. The Integration of a Molecular Marker-Based Genotyping System Is Crucial for Enhancing Germplasm Identification Beyond Traditional Morphological Indicators
4.2. DdRAD-Seq as an Effective Tool for Polymorphism Exploration and Genetic Diversity Analysis on Roselle Genotype
4.3. The KASP Genotyping Technique Can Be Successfully Applied to Roselle Germplasm Identification
4.4. Limitations and Future Perspectives
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
| Sample Code | TTDARES Code | Original Identifier | Variety | Phenotype | Source | 
|---|---|---|---|---|---|
| 0611 | - 1 | - | Taitung No. 5 | Peach Calyx, Ovoid fruit, oval leaf | TTDARES | 
| 1 | TTD01 | A123 | - 1 | Black calyx | Burkina Faso | 
| 2 | TTD02 | A125 | - | - | Burkina Faso | 
| 3 | TTD03 | A126 | - | Black calyx | Burkina Faso | 
| 4 | TTD04 | A128 white | - | - | Burkina Faso | 
| 5 | - | A128 pinky | - | Pink calyx, spheroid fruit, digitate leaf | Burkina Faso | 
| 6 | - | A129 | - | Oblate fruit, oval leaf | Burkina Faso | 
| 8 | TTD07 | A130 | - | - | Burkina Faso | 
| 9 | TTD08 | A131 | - | - | Burkina Faso | 
| 10 | - | Taibai | Taibai | Ovoid fruit, penta lobed leaf | Taitung | 
| 10 2* | TTD09 | A132 | - | - | Burkina Faso | 
| 11 | - | - | Taitung No. 3 | Dark red calyx, ovoid fruit, penta lobed leaf | TTDARES | 
| 12 | - | - | Taitung No. 1 | Red calyx, ovoid fruit, penta lobed leaf | TTDARES | 
| 13 | - | - | Taitung No. 2 | Red calyx, crown fruit, penta lobed leaf | TTDARES | 
| 15 | - | - | Taitung No. 4 | Dual (red/white) fruit, ellipsoid fruit, penta lobed leaf | TTDARES | 
| 17 | TTD16 | Nukung | - | - | Costa Rica | 
| 18 | TTD17 | t141 | Local variety ‘Victor’ | - | Chiayi Agricultural Experiment Branch, Taiwan Agricultural Research Institute | 
| 19 | TTD18 | YMC | - | - | Jamaica | 
| 20 | TTD19 | t141C A2 Variegated leaves | Local variety ‘Victor’ | Variegated leaves | Natural Variation of t141 | 
| 21 | TTD20 | Green(TS-95) | Local variety ‘Victor’ | - | Taitung | 
| 22 | TTD21 | Kuang-Hui | - | early-ripening variety (Sept. fruiting) | Local variety (provided by Kuang-Hui Lin) | 
| 23 | TTD22 | Tamsui | - | early-ripening variety (Aug. fruiting) | Local variety (provided by National Chiayi University) | 
| 24 | - | Cocktail White | Cocktail White | White calyx, oblate fruit, digitate leaf | Known-You | 
| 25 | - | Cocktail Red | Cocktail Red | Red calyx, oblate fruit, digitate leaf | Known-You | 
| 28 | - | VI060115, 2017A01573 | ACC Martin | Purplish red calyx, crown fruit, penta lobed | Mali | 
| 30 | CT03 | Cocktail Purple | Cocktail Purple | - | Known-you | 
| 31 | CT04 | Lobed leaves | Cocktail Red Violet | - | Known-you | 
| 32 | - | VI060119, 2017A01577 | Koor | Green calyx, ovoid fruit, penta lobed | Mali | 
| 32 * | CT05 | Tamsui | Cocktail Tamsui | - | Tamsui | 
| 34 | AV02 | VI060116-1, 2017A01574 | Dah Blanc | - | Mali | 
| 35 | - | VI060123-A, 2017A01580 | L7 | Green calyx, ellipsoid fruit, penta lobed leaf | Mali | 
| 35 * | AV03 | VI060117-1, 2017A01575 | Dah Rouge | - | Mali | 
| 36 | - | VI060124, 2017A01581 | Mandeka | White calyx, spheroid fruit, digitate leaf | Mali | 
| 36 * | AV04 | VI060118, 2017A01576 | llafia | - | Mali | 
| 38 | AV06 | VI060121, 2017A01578 | L24 | - | Mali | 
| 39 | AV07 | VI060122, 2017A01580 | L28 | - | Mali | 
| 40 | - | VI060125-A, 2017A01582 | Marohe de Bozola | Pink calyx, acuminate ovoid fruit, penta lobed leaf | Mali | 
| 43 | - | VI060128, 2017A01585 | Vert CDH | White calyx, ovoid fruit, penta lobed leaf | Mali | 
| 45 | - | VI060130-B, 2017A01587 | Vimto | Purplish red calyx, crown fruit, penta lobed leaf | Mali | 
| 46 | AV14 | VI060126, 2017A01583 | Novorongo | - | Mali | 
| 47 | AV15 | VI060127, 2017A01584 | Samandah | - | Mali | 
| 49 | AV17 | VI060129-1, 2017A01586 | Vert Fatick | - | Mali | 
| 52 | TARI02 | 2010A00445 | Katiap Deng Or In Ranong ‘Som Mynmar’ | - | NPGRC 3 | 
| 53 | TARI03 | 2010A00446 | Rau Chua | - | NPGRC | 
| 54 | TARI04 | 2010A00447 | Kra Tiyap Daeng | - | NPGRC | 
| 55 | TARI05 | 2010A00448 | Kra-Jeat-Daeng[TOT5437] | - | NPGRC | 
| 56 | TARI06 | 2010A00449 | Kra-Jeat-Daeng[TOT5438] | - | NPGRC | 
| 57 | TARI07 | 2010A00450 | Kra-Jeat-Daeng[TOT5439] | - | NPGRC | 
| 58 | TARI08 | 2010A00451 | TOT5516 | - | NPGRC | 
| 59 | TARI09 | 2010A00452 | TOT5523 | - | NPGRC | 
| 60 | TARI10 | 2010A00453 | TOT5674 | - | NPGRC | 
| 61 | TARI11 | 2010A00454 | TOT5770 | - | NPGRC | 
| 62 | TARI12 | 2010A00455 | Ribena | - | NPGRC | 
| 64 | TARI14 | 2010A00457 | Som Phody[TOT7482] | - | NPGRC | 
| 65 | TARI15 | 2010A00458 | Som Pho Di | - | NPGRC | 
| 66 | TARI16 | 2010A00459 | Somphodee | - | NPGRC | 
| 67 | TARI17 | 2010A00460 | TOT7813 | - | NPGRC | 
| 68 | TARI18 | 2010A00461 | TOT7843 | - | NPGRC | 
| 71 | TARI21 | 2017A01560 | BISSAP[VI038286] | - | NPGRC | 
| 72 | TARI22 | 2017A01561 | BISSAP[VI038287] | - | NPGRC | 
| 72 * | uncertain | - | - | - | - | 
| 73 | TARI23 | 2017A01562 | MAK SOMPODI | - | NPGRC | 
| 73 * | uncertain | - | - | - | - | 
| 74 | TARI24 | 2017A01563 | CHUKUR SHAK | - | NPGRC | 
| 76 | TARI26 | 2017A01565 | SABUJ CUKAIR | - | NPGRC | 
| 76 * | uncertain | - | - | - | - | 
| 77 | TARI27 | 2017A01566 | KRA CHIAP DAENG | - | NPGRC | 
| 79 | TARI29 | 2017A01568 | VI049883 | - | NPGRC | 
| 81 | TARI31 | 2017A01570 | SOMPHODEE[VI055841] | - | NPGRC | 
| 82 | TARI32 | 2017A01571 | SOMPHODEE[VI055972] | - | NPGRC | 
| 83 | TARI33 | 2017A01572 | SOMPHODEE[VI055985] | - | NPGRC | 
| SNP Marker 1 | Primer Name | Sequence (5′-3′) | Ta (°C) 2 | 
|---|---|---|---|
| For sequencing | |||
| 20162_54 | Hs20162s-F1 | GCAGCTAGTTTCAATACTAGATGAATG | 52.4 | 
| Hs20162s-R1 | CTAGTTCTGAAAACCATAGCCCTGT | 54.2 | |
| 36343_44 | Hs36343s-F1 | TGGGCTTCAGTAAAATGGCAG | 54.4 | 
| Hs36343s-R1 | GCATACCTTCGACACAACTCCG | 56.0 | |
| 42308_57 | Hs42308-F1 | GCAGAGCATCAACAGCACCCG | 60.2 | 
| Hs42308s-R1 | GCTTCTGTAGGTGTATCCTGCAAAG | 55.4 | |
| 42728_45 | Hs42728s-F1 | TTTGTAGGAATACAAGTGACCAGCA | 54.7 | 
| Hs42728s-R1 | GAAAATTCAGGTGTTTGCGTGT | 53.4 | |
| 46313_71 | Hs46313s-F1 | GCACAAGTAAATCCTACTGCAATTTATG | 56.0 | 
| Hs46313s-R1 | TCAACAGCACGCAAACCATC | 54.3 | |
| 6542_68 | Hs6542s-F1 | AGAAGTGCCAACCCCGTGTA | 54.4 | 
| Hs6542s-R1 | TTGACCCTGAGTTTGTTGGATG | 54.0 | |
| 69354_27 | Hs69354s-F1 | AGTCGGTGATATGCTTTTGTGC | 53.5 | 
| Hs69354s-R1 | GATCGGAGAAGGTCGAACATG | 53.5 | |
| 92456_35 | Hs92456s-F1 | GCAGGTACTTTCACAACCATCCA | 55.5 | 
| Hs92456s-R1 | GCTTGTTCGAGCTTCCCAAG | 54.1 | |
| 95813_33 | Hs95813s-F1 | CAGGTCTTCATGCAAGCCATG | 55.5 | 
| Hs95813s-R1 | AGCCGTTGGGGTCCACCT | 56.3 | |
| For KASP genotyping | |||
| 20162_54 | Hs20162-F5-(FAM) | ATTTCGAAATCATTTGAAGGTGGT | 54.9 | 
| Hs20162-F5-(HEX) | ATTTCGAAATCATTTGAAGGTGGC | 57.3 | |
| Hs20162s-R1 | CTAGTTCTGAAAACCATAGCCCTGT | 54.2 | |
| 36343_44 | Hs36343-F1 | TGCAGCCAACTTCGATCTGTTGTG | 61.0 | 
| Hs36343-R1-(FAM) | GTCCTCTGATAGACGGAAACTGGTTGTAAC | 60.7 | |
| Hs36343-R1-(HEX) | GTCCTCTGATAGACGGAAACTGGTTGTAAT | 60.3 | |
| 42308_57 | Hs42308a-F1-(FAM) | CCGTCGACTCCACATTCTAACAACA | 59.0 | 
| Hs42308a-F1-(HEX) | CCGTCGACTCCACATTCTAACAACG | 60.6 | |
| Hs42308a-R1 | CCTTTGCTTTTCTCATGGTATGCTTC | 58.5 | |
| 42728_45 | Hs42728-F1-(FAM) | GTTTTTGTAGGAATACAAGTGACCAGCAA | 59.0 | 
| Hs42728-F1-(HEX) | GTTTTTGTAGGAATACAAGTGACCAGCAT | 58.3 | |
| Hs42728-R1 | GGTGTTTGCGTGTATCATTTCATTTGC | 61.3 | |
| 46313_71 | Hs46313-F1 | CACAAGTAAATCCTACTGCAATTTATGGAGC | 60.6 | 
| Hs46313-R1-(FAM) | ACAGCACGCAAACCATCGGAAG | 60.8 | |
| Hs46313-R1-(HEX) | ACAGCACGCAAACCATCGGAAA | 61.1 | |
| 6542_68 | Hs6542-F1 | CCGTGTATCATTCCAAAATGAAGCA | 58.9 | 
| Hs6542-R1-(FAM) | TTGTTGGATGCCACCTTTTCCC | 59.5 | |
| Hs6542-R1-(HEX) | TTGTTGGATGCCACCTTTTCCA | 58.8 | |
| 69354_27 | Hs69354-F1-(FAM) | GCAGTCGGTGATATGCTTTTGTGCTC | 61.8 | 
| Hs69354-F1-(HEX) | GCAGTCGGTGATATGCTTTTGTGCTA | 60.4 | |
| Hs69354-R1 | GATCGGAGAAGGTCGAACATGAACA | 60.2 | |
| 92456_35 | Hs92456-F2 | TGCAGGTACTTTCACAACCATCCAAG | 60.1 | 
| Hs92456-R2-(FAM) | ACTGCTTCTGCTCGGCATCATG | 59.0 | |
| Hs92456-R2-(HEX) | ACTGCTTCTGCTCGGCATCATC | 58.1 | |
| 95813_33 | Hs95813-F1-(FAM) | TGCAAGCCATGCATCTCATCG | 59.2 | 
| Hs95813-F1-(HEX) | TGCAAGCCATGCATCTCATCA | 57.3 | |
| Hs95813s-R1 | AGCCGTTGGGGTCCACCT | 56.3 | |
| FAM and HEX label for KASP genotyping | |||
| 5′ FAM tag | GAAGGTGACCAAGTTCATGCT | N/A 3 | |
| 5′ HEX tag | GAAGGTCGGAGTCAACGGATT | N/A | |


References
- Da-Costa-Rocha, I.; Bonnlaender, B.; Sievers, H.; Pischel, I.; Heinrich, M. Hibiscus sabdariffa L.—A phytochemical and pharmacological review. Food Chem. 2014, 165, 424–443. [Google Scholar] [CrossRef] [PubMed]
- Mardiah; Zakaria, F.R.; Prangdimurti, E.; Damanik, R. Anti-inflammatory of purple roselle extract in diabetic rats induced by streptozotocin. Proc. Food Sci. 2015, 3, 182–189. [Google Scholar] [CrossRef]
- Yang, M.-Y.; Peng, C.-H.; Chan, K.-C.; Yang, Y.-S.; Huang, C.-N.; Wang, C.-J. The hypolipidemic effect of Hibiscus sabdariffa polyphenols via inhibiting lipogenesis and promoting hepatic lipid clearance. J. Agric. Food Chem. 2010, 58, 850–859. [Google Scholar] [CrossRef] [PubMed]
- Mozaffari-Khosravi, H.; Jalali-Khanabadi, B.A.; Afkhami-Ardekani, M.; Fatehi, F.; Noori-Shadkam, M. The effects of sour tea (Hibiscus sabdariffa) on hypertension in patients with type II diabetes. J. Hum. Hypertens. 2009, 23, 48–54. [Google Scholar] [CrossRef] [PubMed]
- Hong, S.; Choi, S.R.; Kim, J.; Jeong, Y.-M.; Kim, J.-S.; Ahn, C.-H.; Kwon, S.-Y.; Lim, Y.P.; Shin, A.-Y.; Kim, Y.-M. Identification of accession-specific variants and development of KASP markers for assessing the genetic makeup of Brassica rapa seeds. BMC Genom. 2022, 23, 326. [Google Scholar] [CrossRef] [PubMed]
- Saxena, R.K.; Saxena, K.; Varshney, R.K. Application of SSR markers for molecular characterization of hybrid parents and purity assessment of ICPH 2438 hybrid of pigeonpea [Cajanus cajan (L.) Millspaugh]. Mol. Breed. 2010, 26, 371–380. [Google Scholar] [CrossRef]
- Kim, T.; Lee, J.H.; Seo, H.H.; Moh, S.H.; Choi, S.S.; Kim, J.; Kim, S.-G. Genome assembly of Hibiscus sabdariffa L. provides insights into metabolisms of medicinal natural products. G3 Genes Genom. Genet. 2024, 14, jkae134. [Google Scholar] [CrossRef]
- Kim, Y.-M.; Kim, S.; Koo, N.; Shin, A.-Y.; Yeom, S.-I.; Seo, E.; Park, S.-J.; Kang, W.-H.; Kim, M.-S.; Park, J. Genome analysis of Hibiscus syriacus provides insights of polyploidization and indeterminate flowering in woody plants. DNA Res. 2017, 24, 71–80. [Google Scholar]
- Kim, W.J.; Kim, D.S.; Kim, S.H.; Kim, J.-B.; Goh, E.J.; Kang, S.-Y. Analysis of genetic similarity detected by AFLP and PCoA among genotypes of kenaf (Hibiscus cannabinus L.). J. Crop Sci. Biotechnol. 2010, 13, 243–249. [Google Scholar] [CrossRef]
- Coetzee, R.; Herselman, L.; Labuschagne, M.T. Genetic diversity analysis of kenaf (Hibiscus cannabinus L.) using AFLP (amplified fragment length polymorphism) markers. Plant Genet. Resour.-C. 2009, 7, 122–126. [Google Scholar] [CrossRef]
- Cheng, Z.; Lu, B.-R.; Sameshima, K.; Fu, D.-X.; Chen, J.-K. Identification and genetic relationships of kenaf (Hibiscus cannabinus L.) germplasm revealed by AFLP analysis. Genet. Resour. Crop Ev. 2004, 51, 393–401. [Google Scholar] [CrossRef]
- Mohammed, O.; Islam, A.A.; Jahan, M.A.; Yaakob, Z.; Osman, M. Genetic relationship between roselle (Hibiscus sabdariffa L.) and kenaf (Hibiscus cannabinus L.) accessions through optimization of PCR based RAPD method. Emir. J. Food Agr. 2014, 26, 247–258. [Google Scholar]
- Guo, A.; Zhou, P.; Su, J. Random amplified polymorphic DNA (RAPD) analyses among Hibiscus cannabinus and related species. J. Trop. Subtrop. Bot. 2002, 10, 306–312. [Google Scholar]
- Cheng, Z.; Lu, B.R.; Baldwin, B.S.; Sameshima, K.; Chen, J.K. Comparative studies of genetic diversity in kenaf (Hibiscus cannabinus L.) varieties based on analysis of agronomic and RAPD data. Hereditas 2002, 136, 231–239. [Google Scholar] [CrossRef]
- Park, S.H.; Ginibun, F.C.; Roh, M.S.; Li, M.-X.; Suh, J.K.; Joung, Y.H. Evaluation of roselle based on the internal transcribed spacer sequence of rRNA gene. Emir. J. Food Agr. 2015, 27, 659–661. [Google Scholar] [CrossRef]
- Torres-Morán, M.I.; Escoto-Delgadillo, M.; Ron-Parra, J.; Parra-Tovar, G.; Mena-Munguía, S.; Rodríguez-García, A.; Rodríguez-Sahagún, A. Relationships among twelve genotypes of roselle (Hibiscus sabdariffa L.) cultivated in western Mexico. Ind. Crop. Prod. 2011, 34, 1079–1083. [Google Scholar] [CrossRef]
- Zhang, L.; Li, A.; Wang, X.; Xu, J.; Zhang, G.; Su, J.; Qi, J.; Guan, C. Genetic diversity of kenaf (Hibiscus cannabinus) evaluated by inter-simple sequence repeat (ISSR). Biochem. Genet. 2013, 51, 800–810. [Google Scholar] [CrossRef]
- Tao, A.F.; Qi, J.M.; Li, A.Q.; Fang, P.P.; Lin, L.H.; Wu, J.M.; Wu, W.R. The analysis of genetic diversity and relationship of elite kenaf germplasm based on inter-simple sequence repeats. Acta Agronom. Sin. 2005, 12, 1668. [Google Scholar]
- Sharma, H.K.; Sarkar, M.; Choudhary, S.B.; Kumar, A.A.; Maruthi, R.; Mitra, J.; Karmakar, P.G. Diversity analysis based on agro-morphological traits and microsatellite based markers in global germplasm collections of roselle (Hibiscus sabdariffa L.). Ind. Crop. Prod. 2016, 89, 303–315. [Google Scholar] [CrossRef]
- Satya, P.; Karan, M.; Chakraborty, K.; Biswas, C.; Karmakar, P. Comparative analysis of diversification and population structure of kenaf (Hibiscus cannabinus L.) and roselle (H. sabdariffa L.) using SSR and RGA (resistance gene analogue) markers. Plant Syst. Evol. 2014, 300, 1209–1218. [Google Scholar] [CrossRef]
- Elshire, R.J.; Glaubitz, J.C.; Sun, Q.; Poland, J.A.; Kawamoto, K.; Buckler, E.S.; Mitchell, S.E. A robust, simple genotyping-by-sequencing (GBS) approach for high diversity species. PLoS ONE 2011, 6, e19379. [Google Scholar] [CrossRef] [PubMed]
- Varshney, R.K.; Nayak, S.N.; May, G.D.; Jackson, S.A. Next-generation sequencing technologies and their implications for crop genetics and breeding. Trends Biotechnol. 2009, 27, 522–530. [Google Scholar] [CrossRef] [PubMed]
- Mardis, E.R. The impact of next-generation sequencing technology on genetics. Trends Genet. 2008, 24, 133–141. [Google Scholar] [CrossRef] [PubMed]
- Baird, N.A.; Etter, P.D.; Atwood, T.S.; Currey, M.C.; Shiver, A.L.; Lewis, Z.A.; Selker, E.U.; Cresko, W.A.; Johnson, E.A. Rapid SNP discovery and genetic mapping using sequenced RAD markers. PLoS ONE 2008, 3, e3376. [Google Scholar] [CrossRef]
- Tian, H.-L.; Wang, F.-G.; Zhao, J.-R.; Yi, H.-M.; Wang, L.; Wang, R.; Yang, Y.; Song, W. Development of maizeSNP3072, a high-throughput compatible SNP array, for DNA fingerprinting identification of Chinese maize varieties. Mol. Breeding 2015, 35, 136. [Google Scholar] [CrossRef]
- Sindhu, A.; Ramsay, L.; Sanderson, L.-A.; Stonehouse, R.; Li, R.; Condie, J.; Shunmugam, A.S.K.; Liu, Y.; Jha, A.B.; Diapari, M.; et al. Gene-based SNP discovery and genetic mapping in pea. Theor. Appl. Genet. 2014, 127, 2225–2241. [Google Scholar] [CrossRef]
- Varshney, R.K.; Thiel, T.; Sretenovic-Rajicic, T.; Baum, M.; Valkoun, J.; Guo, P.; Grando, S.; Ceccarelli, S.; Graner, A. Identification and validation of a core set of informative genic SSR and SNP markers for assaying functional diversity in barley. Mol. Breeding 2008, 22, 1–13. [Google Scholar] [CrossRef]
- Semagn, K.; Babu, R.; Hearne, S.; Olsen, M. Single nucleotide polymorphism genotyping using Kompetitive Allele Specific PCR (KASP): Overview of the technology and its application in crop improvement. Mol. Breeding 2014, 33, 1–14. [Google Scholar] [CrossRef]
- Steele, K.A.; Quinton-Tulloch, M.J.; Amgai, R.B.; Dhakal, R.; Khatiwada, S.P.; Vyas, D.; Heine, M.; Witcombe, J.R. Accelerating public sector rice breeding with high-density KASP markers derived from whole genome sequencing of indica rice. Mol. Breeding 2018, 38, 38. [Google Scholar] [CrossRef]
- Islam, M.S.; Thyssen, G.N.; Jenkins, J.N.; Fang, D.D. Detection, validation, and application of genotyping-by-sequencing based single nucleotide polymorphisms in upland cotton. Plant Genome 2015, 8, plantgenome2014.2007.0034. [Google Scholar] [CrossRef]
- Ryu, J.; Kim, W.J.; Im, J.; Kim, S.H.; Lee, K.-S.; Jo, H.-J.; Kim, E.-Y.; Kang, S.-Y.; Lee, J.-H.; Ha, B.-K. Genotyping-by-sequencing based single nucleotide polymorphisms enabled Kompetitive Allele Specific PCR marker development in mutant Rubus genotypes. Electron. J. Biotechnol. 2018, 35, 57–62. [Google Scholar] [CrossRef]
- Owen, H.; Pearson, K.; Roberts, A.M.; Reid, A.; Russell, J. Single nucleotide polymorphism assay to distinguish barley (Hordeum vulgare L.) varieties in support of seed certification. Genet. Resour. Crop Ev. 2019, 66, 1243–1256. [Google Scholar] [CrossRef]
- Ryu, J.; Kim, W.J.; Im, J.; Kang, K.-W.; Kim, S.H.; Jo, Y.D.; Kang, S.-Y.; Lee, J.-H.; Ha, B.-K. Single nucleotide polymorphism (SNP) discovery through genotyping-by-sequencing (GBS) and genetic characterization of Dendrobium mutants and cultivars. Sci. Hortic. 2019, 244, 225–233. [Google Scholar] [CrossRef]
- Li, W.; Zeng, X.; Li, S.; Chen, F.; Gao, J. Development and application of two novel functional molecular markers of BADH2 in rice. Electron. J. Biotechnol. 2020, 46, 1–7. [Google Scholar] [CrossRef]
- Richards, E.; Reichardt, M.; Rogers, S. Preparation of genomic DNA from plant tissue. Curr. Protoc. Mol. Biol. 1994, 27, 2.3.1–2.3.7. [Google Scholar] [CrossRef]
- Etter, P.D.; Bassham, S.; Hohenlohe, P.A.; Johnson, E.A.; Cresko, W.A. SNP discovery and genotyping for evolutionary genetics using RAD sequencing. In Molecular Methods for Evolutionary Genetics; Orgogozo, V., Rockman, M.V., Eds.; Humana Press: Totowa, NJ, USA, 2011; pp. 157–178. [Google Scholar]
- Rochette, N.C.; Rivera-Colón, A.G.; Catchen, J.M. Stacks 2: Analytical methods for paired-end sequencing improve RADseq-based population genomics. Mol. Ecol. 2019, 28, 4737–4754. [Google Scholar] [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Ortiz, E.M. Vcf2phylip v2. 0: Convert a VCF Matrix into Several Matrix Formats for Phylogenetic Analysis; Zenodo: Geneva, Switzerland, 2019. [Google Scholar]
- Kozlov, A.M.; Darriba, D.; Flouri, T.; Morel, B.; Stamatakis, A. RAxML-NG: A fast, scalable and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics 2019, 35, 4453–4455. [Google Scholar] [CrossRef]
- Mahajan, R.; Sapra, R.; Srivastava, U.; Singh, M.; Sharma, G. Minimal Descriptiors for Charecterization and Evaluation of Agri Horticultural Crops-Part 1; National Bureau of Plant Genetic Resources: New Delhi, India, 2000. [Google Scholar]
- Guo, Y.; Ye, F.; Sheng, Q.; Clark, T.; Samuels, D.C. Three-stage quality control strategies for DNA re-sequencing data. Brief. Bioinform. 2014, 15, 879–889. [Google Scholar] [CrossRef]
- Wang, J.; Raskin, L.; Samuels, D.C.; Shyr, Y.; Guo, Y. Genome measures used for quality control are dependent on gene function and ancestry. Bioinformatics 2015, 31, 318–323. [Google Scholar] [CrossRef]
- Mammadov, J.; Aggarwal, R.; Buyyarapu, R.; Kumpatla, S. SNP markers and their impact on plant breeding. Int. J. Plant Genom. 2012, 2012, 728398. [Google Scholar] [CrossRef] [PubMed]
- Vignal, A.; Milan, D.; SanCristobal, M.; Eggen, A. A review on SNP and other types of molecular markers and their use in animal genetics. Genet. Sel. Evol. 2002, 34, 275–305. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.-Q.; Fan, X.-C.; Zhang, Y.; Sun, L.; Liu, C.-H.; Jiang, J.-F. Establishment and application of an SNP molecular identification system for grape cultivars. J. Integr. Agr. 2022, 21, 1044–1057. [Google Scholar] [CrossRef]
- Tang, W.; Lin, J.; Wang, Y.; An, H.; Chen, H.; Pan, G.; Zhang, S.; Guo, B.; Yu, K.; Li, H.; et al. Selection and validation of 48 KASP markers for variety identification and breeding guidance in conventional and hybrid rice (Oryza sativa L.). Rice 2022, 15, 48. [Google Scholar] [CrossRef]
- Islam, A.S.M.F.; Blair, M.W. Molecular characterization of mung bean germplasm from the USDA core collection using newly developed KASP-based SNP markers. Crop Sci. 2018, 58, 1659–1670. [Google Scholar] [CrossRef]




| Sample Code | Variety/Accession | Calyx Color | Fruit Shape | Fruit End | Leaf Shape | Source | 
|---|---|---|---|---|---|---|
| 5 | A128 Pinky | Pink | Spheroid | Acuminate closure | Digitate | Burkina Faso | 
| 6 | A129 | Others (Red/Green/Brown) | Oblate | Closure | Oval | Burkina Faso | 
| 10 | Taibai | Dual (Pink/White) | Ovoid | Closure | Penta lobed | Taitung | 
| 11 | Taitung No. 3 | Dark red | Ovoid | Closure | Penta lobed | TTDARES 1 | 
| 12 | Taitung No. 1 | Red | Ovoid | Closure | Penta lobed | TTDARES | 
| 13 | Taitung No. 2 | Red | Crown type | Open | Penta lobed | TTDARES | 
| 15 | Taitung No. 4 | Dual (Red/White) | Ellipsoid | Closure | Penta lobed | TTDARES | 
| 24 | Cocktail White | White | Oblate | Closure | Digitate | Known-You 2 | 
| 25 | Cocktail Red | Red | Oblate | Closure | Digitate | Known-You | 
| 28 | ACC Martin | Purplish red | Crown type | Open | Penta lobed | Mali | 
| 32 | Koor | Green | Ovoid | Closure | Penta lobed | Mali | 
| 35 | L7 | Green | Ellipsoid | Closure | Penta lobed | Mali | 
| 36 | Mandeka | White | Spheroid | Closure | Digitate | Mali | 
| 40 | Marohe de Bozola var. | Pink | Acuminate Ovoid | Acuminate closure | Penta lobed | Mali | 
| 43 | Van CDH | White | Ovoid | Closure | Penta lobed | Mali | 
| 45 | Vimto | Purplish red | Crown type | Open | Penta lobed | Mali | 
| 0611 | Taitung No. 5 (F1 hybrid) | Peach | Ovoid | Closure | Oval | TTDARES | 
| RAD-Seq Sequencing and Data Filtration | ||
|---|---|---|
| Yield (Mb) | 25,494 | |
| Number of Clusters | 229,672,776 | |
| Reads contained adapter | 604,527 (0.3%) | |
| Barcode not found | 12,326,064 (5.4%) | |
| Low quality read | 179,899 (0.1%) | |
| Retained reads | 216,562,286 (94.3%) | |
| Sequence quantity in roselle varieties following RAD-seq demultiplexing | ||
| Sample code | Input reads | Retained reads | 
| 5 | 14,065,695 | 14,062,201 | 
| 6 | 7,252,520 | 7,252,287 | 
| 10 | 14,561,865 | 14,561,787 | 
| 11 | 16,594,179 | 16,594,107 | 
| 12 | 14,390,450 | 14,389,592 | 
| 13 | 10,969,163 | 10,968,799 | 
| 15 | 16,251,445 | 16,251,177 | 
| 24 | 13,221,398 | 13,221,276 | 
| 25 | 9,539,321 | 9,539,088 | 
| 28 | 14,399,999 | 14,399,915 | 
| 32 | 10,273,806 | 10,273,604 | 
| 35 | 20,485,691 | 20,485,457 | 
| 36 | 8,513,968 | 8,512,334 | 
| 40 | 10,453,714 | 10,453,488 | 
| 43 | 13,398,691 | 13,398,617 | 
| 45 | 12,583,084 | 12,582,873 | 
| 0611 | 9,607,297 | 9,606,971 | 
| Sample Code | Homozygous SNPs | Heterozygous SNPs | Transitions | Transversions | Average Depth | Hom/Het 1 | Ts/Tv 2 | 
|---|---|---|---|---|---|---|---|
| 5 | 12,674 | 23,182 | 16,425 | 8452 | 108 | 0.55 | 1.94 | 
| 6 | 11,114 | 21,012 | 14,987 | 7676 | 65 | 0.53 | 1.95 | 
| 10 | 16,320 | 21,846 | 16,101 | 8208 | 99 | 0.75 | 1.96 | 
| 11 | 17,178 | 22,336 | 16,537 | 8444 | 118 | 0.77 | 1.96 | 
| 12 | 16,571 | 22,642 | 16,357 | 8567 | 91 | 0.73 | 1.91 | 
| 13 | 14,439 | 19,400 | 14,227 | 7212 | 79 | 0.74 | 1.97 | 
| 15 | 15,772 | 22,563 | 16,311 | 8534 | 106 | 0.70 | 1.91 | 
| 24 | 15,711 | 20,257 | 15,416 | 7693 | 88 | 0.78 | 2.00 | 
| 25 | 14,097 | 17,754 | 13,408 | 6733 | 66 | 0.79 | 1.99 | 
| 28 | 15,985 | 21,286 | 16,036 | 8209 | 112 | 0.75 | 1.95 | 
| 32 | 12,951 | 18,627 | 13,605 | 6926 | 83 | 0.70 | 1.96 | 
| 35 | 16,517 | 22,295 | 16,324 | 8452 | 142 | 0.74 | 1.93 | 
| 36 | 13,008 | 17,085 | 12,874 | 6652 | 68 | 0.76 | 1.94 | 
| 40 | 14,933 | 20,158 | 15,279 | 7778 | 85 | 0.74 | 1.96 | 
| 43 | 13,847 | 20,188 | 14,811 | 7688 | 101 | 0.69 | 1.93 | 
| 45 | 14,289 | 20,629 | 15,322 | 7932 | 99 | 0.69 | 1.93 | 
| 0611 | 9130 | 22,372 | 15,092 | 7831 | 79 | 0.41 | 1.93 | 
| Sample Code | 20162_54 | 36343_44 | 42308_57 | 42728_45 | 46313_71 | 6542_68 | 69354_27 | 92456_35 | 95813_33 | 
|---|---|---|---|---|---|---|---|---|---|
| 5 | T | A | A | A | C | G | C | C | G | 
| 6 | T | A | A | A | C | G | C | C | G | 
| 10 | C | G | A | T | C | G | C | C | G | 
| 11 | T | G | A | T | C | G | C | C | G | 
| 12 | T | G | A | T | C | G | A | G | G | 
| 13 | T | G | A | T | C | G | A | C | G | 
| 15 | T | G | A | T | C | T | C | C | G | 
| 24 | T | G | A | A | T | T | A | C | G | 
| 25 | T | G | A | A | T | T | C | C | A | 
| 28 | T | A | A | A | C | G | C | G | A | 
| 32 | T | G | A | A | C | T | A | C | A | 
| 35 | T | G | A | A | C | G | C | G | A | 
| 36 | T | G | A | A | C | T | C | C | G | 
| 40 | T | A | G | A | C | G | C | G | A | 
| 43 | T | G | G | A | C | G | C | C | A | 
| 45 | T | A | A | A | C | G | C | G | A | 
| 0611 | T | 1 A/G | A | A/T | C | G | C | C | G | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, S.-J.; Ou, J.-Y.; Lin, Y.-C.; Chen, J.-W.; Chen, K.-Y.; Wu, Y.-L.; Hu, C.-H.; Lee, J.-Y.; Wu, J.-W.; Hsu, F.-C. KASP Markers for Identifying Roselle (Hibiscus sabdariffa L.) Key Varieties Based on Genetic Polymorphisms Revealed by ddRAD-Seq. Horticulturae 2024, 10, 1325. https://doi.org/10.3390/horticulturae10121325
Huang S-J, Ou J-Y, Lin Y-C, Chen J-W, Chen K-Y, Wu Y-L, Hu C-H, Lee J-Y, Wu J-W, Hsu F-C. KASP Markers for Identifying Roselle (Hibiscus sabdariffa L.) Key Varieties Based on Genetic Polymorphisms Revealed by ddRAD-Seq. Horticulturae. 2024; 10(12):1325. https://doi.org/10.3390/horticulturae10121325
Chicago/Turabian StyleHuang, Shih-Jie, Jheng-Yang Ou, Yao-Cheng Lin, Jing-Wen Chen, Kai-Yi Chen, Yu-Lin Wu, Chun-Hao Hu, Ju-Yin Lee, Jia-Wei Wu, and Fu-Chiun Hsu. 2024. "KASP Markers for Identifying Roselle (Hibiscus sabdariffa L.) Key Varieties Based on Genetic Polymorphisms Revealed by ddRAD-Seq" Horticulturae 10, no. 12: 1325. https://doi.org/10.3390/horticulturae10121325
APA StyleHuang, S.-J., Ou, J.-Y., Lin, Y.-C., Chen, J.-W., Chen, K.-Y., Wu, Y.-L., Hu, C.-H., Lee, J.-Y., Wu, J.-W., & Hsu, F.-C. (2024). KASP Markers for Identifying Roselle (Hibiscus sabdariffa L.) Key Varieties Based on Genetic Polymorphisms Revealed by ddRAD-Seq. Horticulturae, 10(12), 1325. https://doi.org/10.3390/horticulturae10121325
 
        


 
                         
       