Next Article in Journal
Modelling the Growth of Listeria monocytogenes on Fresh-Cut Cucumbers at Various Storage Temperatures
Previous Article in Journal
Counterfeit Detection of Iranian Black Tea Using Image Processing and Deep Learning Based on Patched and Unpatched Images
Previous Article in Special Issue
Advances in Purple Tea Research: Chemical Compositions, Anthocyanin Synthesis and Regulation, Processing, and Health Benefits
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 10
Issue 7
10.3390/horticulturae10070666
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Exogenous Calcium Alleviates the Photosynthetic Inhibition and Oxidative Damage of the Tea Plant under Cold Stress

by
Siwen Chen
1,†,
Long Wang
2,†,
Rui Kang
1,
Chunhui Liu
1,
Liyuan Xing
1,
Shaobo Wu
1,
Zhihui Wang
1,
Chunlai Wu
1,
Qiongqiong Zhou
1,* and
Renliang Zhao
1,*
1
College of Horticulture, Henan Agricultural University, Zhengzhou 450002, China
2
College of Resources and Environment, Henan Agricultural University, Zhengzhou 450002, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Horticulturae 2024, 10(7), 666; https://doi.org/10.3390/horticulturae10070666
Submission received: 20 May 2024 / Revised: 15 June 2024 / Accepted: 19 June 2024 / Published: 23 June 2024
(This article belongs to the Special Issue Advances in Cultivation and Breeding of Tea Plants)
Browse Figures
Review Reports Versions Notes

Abstract

:
Calcium (Ca2+), a second messenger, plays a crucial role in plant growth and development as well as in responding to biotic and abiotic stresses. In this work, we explored the role of exogenous calcium in alleviating cold stress and examined the relationship between calcium chloride (CaCl2) and calcium channel blockers, lanthanum chloride (LaCl3), in tea plants under cold stress at the physiological and transcriptional levels. Exogenous Ca2+ partially offsets the negative impacts of cold stress which increased the tolerance of tea plants by significantly raising the photochemical efficiency of PSII, protective enzyme activities, and the ABA content, which reduced the relative electrical conductivity (REC) level and the malondialdehyde (MDA) concentration. At the transcriptome level, exogenous Ca2+ significantly enhanced the expression of key genes involved in cold response pathways. Nevertheless, LaCl3 treatment not only significantly inhibited the activities of antioxidant enzymes including superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT), but also increased cold damage. This study aims to provide essential insight into the role of exogenous Ca2+ in tea plants responding to cold stress, and to better understand the molecular mechanisms that facilitate Ca-mediated cold tolerance.

1. Introduction

Plants inevitably suffer from various stresses during their life cycle, such as salt, heat, cold, drought, and pathogen attack. Low temperatures are a major environmental stress that adversely affect plant growth and its productive capacity, which also limits the geographical distribution and sustainability of plants. To adapt to low temperatures, plants have evolved a myriad of effective regulatory mechanisms that encourage physiological and biochemical adjustments in plant cells. During this process, plants experience numerous changes under cold stress, including direct and indirect disruption to cell membranes [1]. Cell membrane injury caused by cold stress can lead to electrolyte leakage and severe alterations of the cellular environment, leading to a decline in the function of organelles [2,3]. Meanwhile, antioxidant enzyme activity, the content of malondialdehyde (MDA), and chlorophyll fluorescence parameters can also reflect the degree of cold damage to plants. In addition, various protective osmoregulators such as soluble proteins, soluble sugars, and proline accumulate to increase plant tolerance to cold stress [4,5,6]. In general, the plant response to low temperature stress is characterized by three phases: perception and decoding, transmission of signals to cells, and adaptation of response gene expression profiles [7]. Damage caused by environmental stress can be alleviated by internal signaling compounds, such as reactive oxygen species (ROS), calcium ions (Ca2+), abscisic acid (ABA) and salicylic acid (SA), which affect the expression pattern of various genes and physiological activities [4,8,9].
Ca2+ serves as a second messenger in plant signal-transduction networks in addition to maintaining the integrity of plant cell walls and membranes [10]. In response to adverse stress, plants can alter the Ca2+ levels in the cytoplasm and generate Ca2+ oscillations, which contribute to calcium signal transduction and help coordinate adaptive responses [11]. In the process, the decoding of calcium signaling transients by Ca2+-binding protein sensors was recognized as a crucial regulatory step in the calcium signaling pathway. After the binding of Ca2+ ions, Ca2+ sensors (including CaM, CML, CDPK and CBL) undergo changes in the conformation of proteins that initiate the plant response and magnify the message by modulating their activity or capacity to interplay with downstream targets [12]. In particular, the role of calcium in mediating plant responses to both abiotic and biotic stimuli has been well documented. For example, in Arabidopsis, AtCML8, CML9, CML37, CML38, and CML39 were responsive to pathogenic bacteria, Pseudomonas syringae, salinity, and hormonal treatment [13,14,15]. OsCaM1-1, OsCML4, 5, 8, 11 and 24 were induced by osmotic, salt and drought stresses in rice [16,17,18]. ShCML44 from tomatoes [19], MdCML3 from apples [20], TaCML36 in wheat [21], VaCML21 from grapevines [22], and the ZmCaM and ZmCML genes of maize [23] were all induced under different abiotic and biotic stresses. ShCDPK family members were significantly changed after exposure to cold, drought, and Botrytis cinerea stress [24]. The cpk23 mutant of Arabidopsis increased tolerance to drought and salt stress, but AtCPK23 overexpression in plants decreased tolerance to drought and salt stress [25]. The CBL–CIPK network is also engaged in the physiological crosstalk between plant growth and stress acclimatization [26]. Taken together, Ca2+ sensors appear to play a role in plant abiotic and biotic stress regulation both positively and negatively.
Exogenous calcium (Ca2+) application has been shown to significantly reduce leaf damage and growth inhibition during cold stress, particularly in low-temperature-sensitive plants, such as peanut [27], cucumber [28], Chinese crab apple [29], tomato [30,31,32], and loquat plants [33]. Although pre-treatment with exogenous calcium significantly improves the physiological response, including growth, photosynthesis, and antioxidant systems, its underlying molecular mechanisms remain largely unknown. LaCl3 is a channel inhibitor of calcium that can chelate calcium ions, which affects the combination of Ca2+ and Ca2+ sensors, causing obstacles for cell signal transduction. This interference may disrupt cell signal transduction pathways, which are crucial for the plant’s response to environmental stresses.
The tea plant (Camellia sinensis), an evergreen economic woody crop, originated from southwestern China. Temperature remains a significant limiting factor in the distribution and production of tea plants, especially in northern China. However, with climate variability globally, the frequency of extreme weather events is increasing, for instance low temperatures, frost attacks, and cold spells. As such, tea plants often suffer from adversity during the growth period, causing a serious decline in tea quality and yield, and in severe cases even death of the tea plant, leading to great economic losses to the development of the tea industry [34]. Under cold stress, tea plants undergo a wide range of physiological and biochemical changes, including the alternations of cell membrane fluidity and protein activity, as well as the release of many bioactivities such as ROS and MDA [35]. Thus, improving the resistance of tea plants to defend against adverse injuries is a hot issue in tea science research. At present, the main method to reduce cold stress in tea production is to breed cold-resistant tea plants and optimize the cultivation conditions. Applying exogenous substances, on the other hand, is the simplest, most convenient and effective method [35]. The current study aimed to gain new insights into the molecular mechanisms of calcium-mediated cold stress responses in tea plants by using exogenous calcium and a Ca2+ channel inhibitor.

2. Materials and Methods

2.1. Plant Materials and Treatments

One-year-old tea seedlings of different cold-resistant varieties (C. sinensis cv. Longjing 43, Xinyang 10, and Huangjinya) were pre-cultured in a growth chamber at the Tea Research Laboratory of Henan Agricultural University (Zhengzhou, China). The tea seedling growth medium consisted of peat, vermiculite, and perlite in a ratio of 2:1:1. The growth conditions were adjusted to a 16 h light/8 h dark photoperiod, day/night temperature of 25/22 °C, relative humidity of 75%, and photon flux density of 200 μmol m−2s−1. After pre-culture for 7 days, the tea seedlings were sprayed evenly with ddH2O (CK), CaCl2 (20 mmol/L), and LaCl3 (5 mmol/L) until complete absorption, and then subjected to cold treatments under 4 °C for 72 h, while the control group continued to be exposed to 25 °C. The third leaf was sampled after 0, 12, 24, 48, and 72 h, immediately frozen in liquid nitrogen and stored in the refrigerator at −80 °C for total RNA extraction with measurement of physiological and biochemical indexes. Each treatment was performed three times independently for biological replication.

2.2. Cold Tolerance Assays

The maximum quantum yield of PSII (Fv/Fm) was determined using Imaging-PAM (IMAG-MAXI, Heinz Walz Effeltrich, Effeltrich, Germany). After 30 min of dark adaptation, the leaves were subjected to a burst of intense red light that was emitted from a set of six light-emitting diodes on a uniform irradiation area. The REC was estimated according to Hong et al. [36]. Activities of antioxidant enzymes including superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) were determined spectrophotometrically following the instructions of the kits (Suzhou Keming Biotechnology, Suzhou, China). Spectrophotometry was also used to determine the MDA content using a commercially available assay kit (Suzhou Keming Biotechnology, Suzhou, China).

2.3. Quantification of ABA by HPLC

ABA was quantified following the method of Nie et al. [37]. 0.3 g samples were homogenized in 1.5 mL of pre-cooled 80% methanol, incubated overnight at 4 °C, and centrifuged at 8000× g for 10 min at 4 °C, with the supernatant transferred to a fresh tube. The residue was exacted with 0.5 mL of 80% methanol for 2 h, and the supernatant was centrifuged and recovered. Samples of 10 μL were injected for HPLC analysis, with a detection wavelength of 254 nm. HPLC analysis was carried out on a Waters 2695 system (Waters, Milford, MA, USA) equipped with a Diode Array Detector. A Compass C18 (2) reversed-phase column (250 mm × 4.6 mm, 5 μm) was used in the analysis, and the mobile phase was 1% aqueous acetic acid solution: methanol = 60:40 (V/V). The flow rate was 1 mL/min and the column temperature was set to 35 °C. Triplicate samples were run for each treatment.

2.4. RNA Isolation

Tea leaf RNA was extracted using the RNAPrep Pure Plant kit (Tiangen biotech, Beijing, China). The concentration of RNA was ascertained using a NanoDrop 2000 spectrophotometer (Thermo Fisher, Waltham, MA, USA), and the quality of the RNA was identified through electrophoresis. Two ug of total RNA was used for reverse transcription using the PrimeScript™ RT reagent kit with a gDNA Eraser (TaKaRa, Kyoto, Japan).

2.5. qRT-PCR Analysis

A qRT-PCR analysis was conducted with a 7500 Fast Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) by mixing the primers, SYBR® Green PCR Master Mix (Vazyme, Nanjing, China), cDNA template and RNase-free water in a total volume of 20 µL. Primers are listed in Table 1. The polypyrimidine tract-binding protein CsPTB (GenBank accession number: GAAC01052498.1) was used as a housekeeping gene to normalize gene expression because of its stable expression in tea plants [38]. Relative gene expression was calculated using the 2−ΔΔCT method [39]. The real-time PCR program was as follows: 95 °C for 30 s; 40 cycles of 95 °C for 5 s, and 60 °C for 34 s.

2.6. Statistical Analysis

SPSS 17.0 was used to determine statistical significance, using a one-way analysis of variance (ANOVA) and Tukey’s HSD test at p < 0.05. Data are represented as the mean ± SD of at least three independent experiments. Prism 8 software (GraphPad Software, San Diego, CA, USA) was used to draw the bar charts, and TBtools v2.097 software was used to generate the heatmap.

3. Results

3.1. Effect of CaCl2 and LaCl3 on Chlorophyll Fluorescence of Tea Plants under Cold Stress

The chlorophyll fluorescence technique has been widely used to detect the effects of stress on photosynthetic activity, including cold stress. In our study, we observed that low temperatures and different tea varieties had significant effects on chlorophyll fluorescence parameters (Figure 1). Under room temperature conditions, no significant differences were observed in chlorophyll fluorescence among the three varieties after spraying with CaCl2, LaCl3 and H2O (CK), respectively, but cold stress significantly decreased the value of Fv/Fm. Exogenous CaCl2 application increased the value of Fv/Fm under cold stress and improved the photochemical efficiency of PSII, whereas LaCl3-treated tea plants showed a significant decline among the three tea cultivars. It is possible that exogenous CaCl2 and LaCl3 positively and negatively regulate cold-induced photosynthetic inhibition, respectively.

3.2. Influence of CaCl2 and LaCl3 on the Relative Conductivity and MDA Levels of Tea Plants under Cold Stress

To explore the influence of exogenous CaCl2 in managing plasma membranes’ integrity against the action of cold stress, REC and MDA were measured. Results indicated that no significant difference was found on the REC among the three varieties at room temperature after the application of CaCl2, LaCl3 and H2O (CK), respectively, while the level of REC increased significantly after low temperature stress. Compared with room temperature, the REC of ‘LJ 43’, ‘HJY’ and ‘XY 10’ showed the highest values after LaCl3 treatment under low temperature stress. On the contrary, CaCl2 spraying significantly decreased the increment of REC after low temperature stress in the three tea varieties (Figure 2A).
MDA levels are important indicators of the extent of membrane lipid peroxidation and degradation of the plasma membrane. We measured the levels of MDA in plants to determine whether exogenous Ca2+ could protect plants from cold-induced lipid peroxidation. During cold stress, the contents of MDA increased in the three tea varieties, although Ca2+ spraying significantly reduced this effect by 26%, 28% and 23% in ‘LJ 43’, ‘HJY’ and ‘XY10’, respectively. On the contrary, LaCl3 treatment led to a consistent increment in MDA content under cold stress (Figure 2B). The results of the multivariate analysis revealed an interaction between temperature and variety, with varying electrical conductivity and MDA content among different tea varieties under distinct temperature conditions. These results suggest that cold treatment caused severe oxidative stress in tea plants and exogenous calcium is involved in cold resistance.

3.3. Effect of CaCl2 and LaCl3 on Antioxidant Enzymes Activities in Tea Plants under Cold Stress

Antioxidant enzymes are vital for the prevention of oxidative stress in plants by activating protective antioxidant enzymes, such as SOD, POD, and CAT, which can effectively reduce the damage caused by adverse stress in the plants. In the absence of cold stress, CaCl2 or LaCl3 application did not affect antioxidant enzyme activities in ‘LJ 43’, ‘HJY’, and ‘XY 10’. After cold stress treatment, activities of antioxidant enzymes decreased compared to the control group, however, CaCl2-pretreated plants showed significantly higher levels of SOD, POD and CAT activity at 12 h and 24 h under low temperature conditions. On the contrary, the application of LaCl3 caused a decrease in the activity of the three enzymes, which was lower than in water-treated plants under cold stress (Figure 3). These results suggest that Ca2+ modulates antioxidant enzyme activities in tea plants to stop cold-induced ROS production.

3.4. Effect of CaCl2 and LaCl3 on the ABA Content in Tea Plants under Cold Stress

The plant hormone ABA plays a critical role in the regulation of osmotic stress tolerance. To explore whether there is a relationship between ABA and Ca2+ signaling pathways under low temperature stress, we measured the content of ABA in ‘LJ 43’ tea leaves treated with CaCl2, LaCl3 and H2O, respectively. The results showed that ABA content was increased with exogenous CaCl2 treatment relative to that with H2O treatment under 25 °C. Low temperatures considerably increased the ABA content in ‘LJ 43’ compared with the tea plants treated with H2O, and exogenous LaCl3 application either prevented or even decreased its accumulation (Figure 4). The results indicate that exogenous Ca2+ improves cold stress tolerance in tea plants by regulating ABA.

3.5. Effect of CaCl2 and LaCl3 on Cold-Related Gene Expression in Tea Plants under Cold Stress

To further explore the regulatory mechanism of Ca2+-mediated cold resistance, the expression levels of selected genes that are tightly correlated with the cold response pathway were analyzed. There was a considerable upregulation of cold-related gene expressions under cold stress. CsCML39, CsCBF1, CsCOR47, CsDHN2, CsWRKY2 and CsNAC26 were induced after exposure to cold treatment within the first 24 h. In ‘LJ 43’, CaCl2 treatment significantly increased the levels of CsCML39 and CsWRKY2 transcripts within 48 h compared to CK, while CsCOR47, CsDHN2 and CsNAC26 expression was significantly increased within the first 12 h. In ‘HJY’ and ‘XY10’, CaCl2 treatment induced the expression of CsCML39 within 48 h compared to CK, however the expression of CsCBF1, CsDHN2 and CsWRKY2 genes was mostly downregulated. Meanwhile, the increase in expression of all genes was blocked by LaCl3 treatment during cold stress (Figure 5). The results indicate that exogenous CaCl2 was involved in the regulation of the expression of cold-related genes in tea plants under low temperature stress, and that CsCML39, CsCOR47, CsDHN2, CsNAC26 and CsWRKY2 likely play crucial roles in tea plant responses to cold stress and cold stress tolerance.

4. Discussion

Tea plants, being a leaf-harvested crop, are inevitably exposed to low temperature stresses over their entire life cycle. Low temperatures during late autumn, winter, and early spring often cause damage to tea plants, thereby affecting their yield and quality, which is detrimental to the growth and development of the tea industry. It impacts plant metabolism and growth by inhibiting the electron transport chain and disrupting the function of enzymes involved in plant metabolism [40]. When plants are stimulated by low temperatures, the concentration of Ca2+ in cells increases very rapidly, generating a specific Ca2+ signal (Ca2+ signature), which then initiates downstream signaling [41], thus causing complex defense mechanisms that reduce the damage from low temperatures on the plants. In this work, we explored the role of exogenous calcium in the amelioration of cold stress and examined the interactions between calcium chloride (CaCl2) and calcium channel blockers lanthanum chloride (LaCl3) in tea plants under cold stress at the physiological and transcriptional levels.
Plants display a variety of cold-induced physiological and biochemical reactions, including the formation of ROS, changes in membrane lipid composition, and osmolytes [42,43]. Previous research has indicated that the application of exogenous Ca2+ promotes plant growth, photosynthesis, and the antioxidant system, ultimately increasing cold tolerance. Exogenous Ca2+ improved wheat tolerance to cold stress via modulating antioxidant machinery, photosynthetic rate, and membrane damage [44]. Tomato seedlings treated with CaCl2 exhibited improved photosynthesis, antioxidant activities, stomatal aperture, and chloroplast area under low night temperature stress [32]. CaCl2 treatment relieved chilling injury in loquat fruits by increasing antioxidant enzymes activity and the AsA–GSH cycle system to stop ROS [33]. Exogenous CaCl2 significantly activates both antioxidant enzymes and glutathione, minimizing cell damage caused by cold stress in Bermudagrass [45]. In this study, CaCl2, LaCl3, and H2O (CK) treatments were applied to three tea varieties, ‘LJ 43’, ‘HJY’ and ‘XY 10’, at room temperature and low temperatures, respectively, to investigate the role of calcium ions in the cold resistance of the tea plant. Our results showed that exogenous Ca2+ significantly increased chlorophyll fluorescence indicators (Fv/Fm) and the activity of antioxidant enzymes, including SOD, POD, and CAT, while reducing electrolyte loss and the MDA content of tea leaves under low temperatures. In contrast, the application of a calcium channel inhibitor showed the opposite results. These physiological responses suggest that signaling pathways involving Ca2+ fluxes are crucial for preserving the stability and integrity of plant cell walls and membranes, which is consistent with previous research.
ABA, an essential plant hormone, is involved in the regulation of cold tolerance. The synthesis of ABA is induced in response to adverse environmental conditions, which triggers metabolic changes that enhance resistance to stress [46]. A growing body of evidence suggests that many plants experience cold stress in conjunction with increased levels of endogenous ABA. For instance, significant increases in ABA content were observed in the leaves of wild strawberries after low temperature stress [47], and cold stress markedly increased the ABA content in maize [48]. Exogenous ABA could also alleviate cold-induced oxidative damage in cold-sensitive and cold-resistant Bermudagrass genotypes [49] and ABA spraying of zucchini fruit could regulate phenolic metabolism and non-enzymatic antioxidant systems to enhance cold tolerance [50]. ABA has been shown to enhance the levels of osmotic adjustment substances and ROS-scavenging enzymes in plants by modulating the expression of stress-responsive genes, consequently leading to an improvement in their cold tolerance [51,52]. In our study, the ABA contents of the tea plant were very similar under room temperatures, while significant elevations in ABA content were observed in the leaves of the tea plant after low temperature stress, and the ABA content of tea plants treated with exogenous CaCl2 was significantly higher than that treated with LaCl3. These findings align with previous research demonstrating that an increase in ABA levels is a widespread physiological response to low temperatures.
Accumulating evidence reveals that CMLs can interact with transcription factors and impact their function. In Arabidopsis, AtCML24 interacts with CAMTA2 and WRKY46 to regulate ALMT1-dependent Al resistance [53]. Transcription factors are recognized for their crucial involvement in both abiotic and biotic stress responses [54]. In tea plants, many transcription factors (DHN, WRKY, HD-ZIP, LOX, NAC, HSP) and metabolic genes are induced in response to cold stress [55]. A number of DHN genes encoding dehydrins play a vital role in the response to cold stress, and these genes can act as cryoprotectants, molecular chaperones, and antioxidants [56]. Transcription of the DHN gene, together with the CBF genes, correlates with increased cold tolerance [57,58]. Our study showed that CaCl2 application significantly increased CsDHN2 expression levels for the three genotypes under cold stress, and it was higher in the cold-resistant tea variety ‘LJ 43’ than the other tea varieties. The transcription factors WRKY are crucial in regulating plant adverse stress. CsWRKY2 was identified in tea plants and its expression was significantly increased under cold stress, which played an important role in the ABA signaling pathway and could be expressed in the CBF non-dependent pathway [59]. The present study also showed that CsWRKY2 was significantly increased under cold stress. Nevertheless, it should be noted that, while the expression of this gene in ‘LJ43’ was further upregulated by CaCl2, in ‘HJY’ and ‘XY 10’ the control treatment had the highest gene expression levels (Figure 5), which might contribute to the differences found in cold stress tolerance among tea varieties. Samarina et al. revealed the CsNAC gene expression profiles in various tea cultivars under abiotic stress circumstances [60], and Wang et al. identified several CsNAC genes, including CsNAC17 and CsNAC30, that were highly sensitive to abiotic stresses [61]. Our results confirmed that the CsNAC26 gene participated in the low temperature response of the tea plant, and CsNAC26 expression was higher in cold-resistant tea varieties. Taken together, CsDHN2, CsWRKY2, and CsNAC26 had different expression patterns and could be promoted or repressed by CaCl2 and LaCl3 under cold stress.
Ca2+ is known as an important secondary messenger for plant stress resistance. During Ca2+ signal transmission, CML plays an important role in direct or indirect regulation of Ca2+ transporters by binding to transporters or altering the activity of regulatory proteins [62]. Despite being one of the major types of Ca2+ sensors, the role of CMLs in cold stress has been partially revealed. The overexpression of SlCML37 in tomato fruit may increase antioxidant activity as well as improve cold tolerance [63]. The grapevine VaCML21 gene was found to play a positive regulatory role in the plant response to cold stress [22]. CML3, CML17.2, CML36, and CML41 genes were associated with the cold stress response in papaya fruit [64]. Similarly, AtCML24 expression was induced under cold treatment, which might contribute to the cold-induced transduction of the Ca2+ signal [65]. It is worth noting that in our study, the expression of CsCML39 gene was up-regulated in the three tea varieties under low temperature stress, and the gene was promoted by CaCl2 treatment and inhibited by LaCl3 treatment. These results further support the importance of Ca2+ fluxes for the regulation of cold-stress responses and the enhancement of cold tolerance in tea plants. However, the function of CMLs and the underlying mechanism of CML39-regulated cold responses in tea plants deserves further study. Moreover, a model containing these main concepts has been represented in Figure 6. In order to cope with cold stress, tea plants have evolved a series of physiological and molecular mechanisms to rescue the metabolic disorders in plant cells caused by cold stress. Low temperatures may active transduction pathways involving Ca2+ and hormonal signals, inducing the expression of cold-related genes, which in turn modulate physiological responses aimed to reduce cold damage and enhance stress tolerance.

5. Conclusions

It was found that exogenous calcium (CaCl2) treatment effectively inhibited lipid peroxidation levels by decreasing the REC level and MDA content, enhanced the antioxidant enzyme activities of SOD, POD and CAT, and also induced the accumulation of ABA content in tea leaves under low temperature stress. The effect was reversed with calcium channel inhibitors (LaCl3). Cold stress-related genes such as CsCML39, CsDHN2, CsWRKY2 and CsNAC26 showed different expression patterns at room temperature and during cold stress, which could be promoted or inhibited by CaCl2 and LaCl3, respectively. This study confirmed that the response of tea plants to low temperature stress is closely related to the calcium signaling pathway, and that exogenous calcium supply improves the cold resistance of tea plants by affecting the expression of physiological indicators of cold resistance and cold response genes.

Author Contributions

S.C.: Writing—original draft, Writing—review & editing. L.W.: Conceptualization, Investigation, Data curation, Formal analysis. R.K.: Data curation, Investigation, Formal analysis. C.L.: Investigation, Data curation, Formal analysis. L.X.: Investigation. S.W.: Investigation. Z.W.: Investigation. C.W.: Investigation, Software. Q.Z.: Conceptualization, Funding acquisition, Supervision, Writing—review & editing. R.Z.: Investigation, Data curation, Writing—review & editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (32102437) and the Henan Provincial Science and Technology Research Project (222102110048, 232102110253).

Data Availability Statement

The original contributions presented in this study are included in the article.

Conflicts of Interest

The authors declare no conflicts of interests.

References

  1. Manasa, S.L.; Panigrahy, M.; Panigrahi, K.C.; Rout, G.R. Overview of cold stress regulation in plants. Bot. Rev. 2022, 88, 359–387. [Google Scholar] [CrossRef]
  2. Aroca, R.; Porcel, R.; Ruiz-Lozano, J.M. Regulation of root water uptake under abiotic stress conditions. J. Exp. Bot. 2011, 63, 43–57. [Google Scholar] [CrossRef]
  3. Chen, Y.; Jiang, J.; Chang, Q.; Gu, C.; Chen, F. Cold acclimation induces freezing tolerance via antioxidative enzymes, proline metabolism and gene expression changes in two chrysanthemum species. Mol. Biol. Rep. 2014, 41, 815–822. [Google Scholar] [CrossRef]
  4. Chinnusamy, V.; Zhu, J.; Zhu, J.K. Cold stress regulation of gene expression in plants. Trends Plant Sci. 2007, 12, 444–451. [Google Scholar] [CrossRef]
  5. Kazemi-Shahandashti, S.S.; Maali-Amiri, R.; Zeinali, H.; Khazaei, M.; Talei, A.; Ramezanpour, S.S. Effect of short-term cold stress on oxidative damage and transcript accumulation of defense-related genes in chickpea seedlings. J. Plant Physiol. 2014, 171, 1106–1116. [Google Scholar] [CrossRef]
  6. Dikilitas, M.; Simsek, E.; Roychoudhury, A. Role of proline and glycine betaine in overcoming abiotic stresses. Prot. Chem. Agents Amelior. Plant Abiotic Stress. 2020, 1–23. [Google Scholar] [CrossRef]
  7. Guan, Y.; Hwarari, D.; Korboe, H.M.; Ahmad, B.; Cao, Y.; Movahedi, A.; Yang, L. Low temperature stress-induced perception and molecular signaling pathways in plants. Environ. Exp. Bot. 2023, 207, 105190. [Google Scholar] [CrossRef]
  8. Kudla, J.; Batistič, O.; Hashimoto, K. Calcium signals: The lead currency of plant information processing. Plant Cell 2010, 22, 541–563. [Google Scholar] [CrossRef] [PubMed]
  9. Sadak, M.S. Physiological role of signal molecules in improving plant tolerance under abiotic stress. Int. J. Chem. Tech. Res. 2016, 9, 46–60. [Google Scholar]
  10. Anil, V.S.; Sankara Rao, K. Purification and characterization of a Ca2+-dependent protein kinase from sandalwood (Santalum album L.): Evidence for Ca2+-induced conformational changes. Phytochemistry 2001, 58, 203–212. [Google Scholar] [CrossRef] [PubMed]
  11. Reddy, A.S.; Ali, G.S.; Celesnik, H.; Day, I.S. Coping with stresses: Roles of calcium-and calcium/calmodulin-regulated gene expression. Plant Cell 2011, 23, 2010–2032. [Google Scholar] [CrossRef]
  12. Yuan, P.; Yang, T.; Poovaiah, B. Calcium signaling-mediated plant response to cold stress. Int. J. Mol. Sci. 2018, 19, 3896. [Google Scholar] [CrossRef] [PubMed]
  13. Zhu, X.; Robe, E.; Jomat, L.; Aldon, D.; Mazars, C.; Galaud, J.P. CML8, an Arabidopsis Calmodulin-like protein.; plays a role in Pseudomonas syringae plant immunity. Plant Cell Physiol. 2016, 58, 307–319. [Google Scholar]
  14. Vanderbeld, B.; Snedden, W.A. Developmental and stimulus-induced expression patterns of Arabidopsis calmodulin-like genes CML37, CML38 and CML39. Plant Mol. Biol. 2007, 64, 683–697. [Google Scholar] [CrossRef] [PubMed]
  15. Leba, L.J.; Perochon, A.; Cheval, C.; Ranty, B.; Galaud, J.P.; Aldon, D. CML9, a multifunctional Arabidopsis thaliana calmodulin-like protein involved in stress responses and plant growth? Plant Signal. Behav. 2012, 7, 1121–1124. [Google Scholar] [CrossRef] [PubMed]
  16. Xu, G.Y.; Rocha, P.S.C.F.; Wang, M.L.; Xu, M.L.; Cui, Y.C.; Li, L.Y.; Zhu, Y.X.; Xia, X. A novel rice calmodulin-like gene, OsMSR2, enhances drought and salt tolerance and increases ABA sensitivity in Arabidopsis. Planta 2011, 234, 47–59. [Google Scholar] [CrossRef] [PubMed]
  17. Chinpongpanich, A.; Limruengroj, K.; Phean-O-Pas, S.; Limpasen, T.; Buaboocha, T. Expression analysis of calmodulin and calmodulin-like genes from rice, Oryza sativa L. BMC Res. Notes 2012, 5, 625. [Google Scholar] [CrossRef] [PubMed]
  18. Yuenyong, W.; Chinpongpanich, A.; Comai, L.; Chadchawan, S.; Buaboocha, T. Downstream components of the calmodulin signaling pathway in the rice salt stress response revealed by transcriptome profiling and target identification. BMC Plant Biol. 2018, 18, 335. [Google Scholar] [CrossRef] [PubMed]
  19. Munir, S.; Liu, H.; Xing, Y.; Hussain, S.; Ouyang, B.; Zhang, Y.; Li, H.; Ye, Z. Overexpression of calmodulin-like (ShCML44) stress-responsive gene from Solanum habrochaites enhances tolerance to multiple abiotic stresses. Sci. Rep. 2016, 6, 31772. [Google Scholar] [CrossRef]
  20. Li, C.; Meng, D.; Zhang, J.; Cheng, L. Genome-wide identification and expression analysis of calmodulin and calmodulin-like genes in apple (Malus × domestica). Plant Physiol. Biochem. 2019, 139, 600–612. [Google Scholar] [CrossRef]
  21. Lu, L.; Rong, W.; Zhou, R.H.; Huo, N.X.; Zhang, Z.Y. TaCML36, a wheat calmodulin-like protein, positively participates in an immune response to. Crop J. 2019, 7, 608–618. [Google Scholar] [CrossRef]
  22. Aleynova, O.A.; Kiselev, K.V.; Ogneva, Z.V.; Dubrovina, A.S. The grapevine Calmodulin-like protein gene CML21 is regulated by alternative splicing and involved in abiotic stress pesponse. Int. J. Mol. Sci. 2020, 21, 7939. [Google Scholar] [CrossRef]
  23. Wang, Z.; Wang, L.; Li, J.; Yang, W.; Ci, J.; Ren, X.; Wang, W.; Wang, Y.; Jiang, L.; Yang, W. Identification and expression analysis revealed drought stress-responsive Calmodulin and Calmodulin-like genes in maize. J. Plant Interact. 2022, 17, 450–461. [Google Scholar] [CrossRef]
  24. Li, Y.; Zhang, H.; Liang, S.; Chen, X.; Liu, J.; Zhang, Y.; Wang, A. Identification of CDPK gene family in Solanum habrochaites and its function analysis under stress. Int. J. Mol. Sci. 2022, 23, 4227. [Google Scholar] [CrossRef]
  25. Ma, S.Y.; Wu, W.H. AtCPK23 functions in Arabidopsis responses to drought and salt stresses. Plant Mol. Biol. 2007, 65, 511–518. [Google Scholar] [CrossRef] [PubMed]
  26. Mao, J.; Mo, Z.; Yuan, G.; Xiang, H.; Visser, R.G.F.; Bai, Y.; Liu, H.; Wang, Q.; van der Linden, C.G. The CBL-CIPK network is involved in the physiological crosstalk between plant growth and stress adaptation. Plant Cell Environ. 2022, 46, 3012–3022. [Google Scholar] [CrossRef] [PubMed]
  27. Song, Q.; Liu, Y.; Pang, J.; Yong, J.W.H.; Chen, Y.; Bai, C.; Gille, C.; Shi, Q.; Wu, D.; Han, X. Supplementary calcium restores peanut (Arachis hypogaea) growth and photosynthetic capacity under low nocturnal temperature. J. Plant Physiol. 2020, 258, 153373. [Google Scholar] [CrossRef] [PubMed]
  28. Feng, Q.; Yang, S.; Wang, Y.; Lu, L.; Sun, M.; He, C.; Wang, J.; Li, Y.; Yu, X.; Li, Q. Physiological and molecular mechanisms of ABA and CaCl2 regulating chilling tolerance of Cucumber seedlings. Plants 2021, 10, 2746. [Google Scholar] [CrossRef] [PubMed]
  29. Li, L.; Su, H.; Ma, H.; Lyu, D. Differential proteomic analysis reveals the effect of calcium on Malus baccata Borkh. leaves under temperature stress. Int. J. Mol. Sci. 2017, 18, 1755. [Google Scholar] [CrossRef]
  30. Liu, Y.F.; Qi, M.F.; Li, T.L. Photosynthesis, photoinhibition, and antioxidant system in tomato leaves stressed by low night temperature and their subsequent recovery. Plant Sci. 2012, 34, 263–273. [Google Scholar] [CrossRef]
  31. Zhang, G.; Liu, Y.; Ni, Y.; Meng, Z.; Lu, T.; Li, T. Exogenous calcium alleviates low night temperature stress on the photosynthetic apparatus of tomato leaves. PLoS ONE 2014, 9, e97322. [Google Scholar] [CrossRef] [PubMed]
  32. Liu, Y.F.; Zhang, G.X.; Qi, M.F.; Li, T.L. Effects of calcium on photosynthesis, antioxidant system and chloroplast ultrastructure in tomato leaves under low night temperature stress. J. Plant Growth Regul. 2015, 34, 263–273. [Google Scholar] [CrossRef]
  33. Hou, Y.; Li, Z.; Zheng, Y.; Jin, P. Effects of CaCl2 treatment alleviates chilling injury of Loquat fruit (Eribotrya japonica) by modulating ROS homeostasis. Foods 2021, 10, 1662. [Google Scholar] [CrossRef] [PubMed]
  34. Zhao, Y.; Xu, Y.; Zhang, L.; Zhao, M.; Wang, C. Adapting tea production to climate change under rapid economic development in China from 1987 to 2017. Agronomy 2022, 12, 3192. [Google Scholar] [CrossRef]
  35. Wang, Y.; Samarina, L.; Mallano, A.I.; Tong, W.; Xia, E. Recent progress and perspectives on physiological and molecular mechanisms underlying cold tolerance of tea plants. Front. Plant Sci. 2023, 14, 1145609. [Google Scholar] [CrossRef] [PubMed]
  36. Hong, S.W.; Lee, U.; Vierling, E. Arabidopsis hot mutants define multiple functions required for acclimation to high temperatures. Plant Physiol. 2003, 132, 757–767. [Google Scholar] [CrossRef] [PubMed]
  37. Nie, W.F.; Li, Y.; Chen, Y.; Zhou, Y.; Yu, T.; Zhou, Y.; Yang, Y. Spectral light quality regulates the morphogenesis, architecture, and flowering in pepper (Capsicum annuum L.). J. Photochem. Photobiol. B 2023, 241, 112673. [Google Scholar] [CrossRef]
  38. Hao, X.Y.; Horvath, D.P.; Chao, W.S.; Yang, Y.J.; Wang, X.C.; Xiao, B. Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze). Int. J. Mol. Sci. 2014, 15, 22155–22172. [Google Scholar] [CrossRef]
  39. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  40. Dhingra, M. Physiological responses and tolerance mechanisms of low temperature stress in plants. Int. J. Adv. Res. 2015, 3, 637–646. [Google Scholar]
  41. Ding, Y.; Shi, Y.; Yang, S. Molecular regulation of plant responses to environmental temperatures. Mol. Plant 2020, 13, 544–564. [Google Scholar] [CrossRef]
  42. Thomashow, M.F. PLANT COLD ACCLIMATION: Freezing tolerance genes and regulatory mechanisms. Annu. Rev. Plant Biol. 2004, 50, 571–599. [Google Scholar] [CrossRef] [PubMed]
  43. Browse, J.; Xin, Z. Temperature sensing and cold acclimation. Curr. Opin. Plant Biol. 2001, 4, 241–246. [Google Scholar] [CrossRef] [PubMed]
  44. Zhang, Q.; Liu, Y.; Yu, Q.; Ma, Y.; Gu, W.; Yang, D. Physiological changes associated with enhanced cold resistance during maize (Zea mays) germination and seedling growth in response to exogenous calcium. Crop Pasture Sci. 2020, 71, 529–538. [Google Scholar] [CrossRef]
  45. Shi, H.; Ye, T.; Zhong, B.; Liu, X.; Chan, Z. Comparative proteomic and metabolomic analyses reveal mechanisms of improved cold stress tolerance in bermudagrass (Cynodon dactylon (L.) Pers.) by exogenous calcium. J. Integr. Plant Biol. 2014, 56, 1064–1079. [Google Scholar] [CrossRef] [PubMed]
  46. Tuteja, N. Abscisic acid and abiotic stress signaling. Plant Signal. Behav. 2007, 2, 135–138. [Google Scholar] [CrossRef] [PubMed]
  47. Shen, J.; Liu, J.; Yuan, Y.; Chen, L.; Ma, J.; Li, X.; Li, J. The mechanism of abscisic acid regulation of wild Fragaria species in response to cold stress. BMC Genom. 2022, 23, 670. [Google Scholar] [CrossRef] [PubMed]
  48. Guo, Q.; Li, X.; Niu, L.; Jameson, P.E.; Zhou, W. Transcription-associated metabolomic adjustments in maize occur during combined drought and cold stress. Plant Physiol. 2021, 186, 677–695. [Google Scholar] [CrossRef] [PubMed]
  49. Huang, X.; Shi, H.; Hu, Z.; Liu, A.; Amombo, E.; Chen, L.; Fu, J. ABA is involved in regulation of cold stress response in bermudagrass. Front. Plant Sci. 2017, 8, 1613. [Google Scholar] [CrossRef] [PubMed]
  50. Castro-Cegrí, A.; Sierra, S.; Hidalgo-Santiago, L.; Esteban-Muñoz, A.; Jamilena, M.; Garrido, D.; Palma, F. Postharvest treatment with abscisic acid alleviates chilling injury in Zucchini fruit by regulating phenolic metabolism and non-enzymatic antioxidant system. Antioxidants 2023, 12, 211. [Google Scholar] [CrossRef]
  51. Pospíšilová, J.; Synková, H.; Haisel, D.; Baťková, P. Effect of abscisic acid on photosynthetic parameters during ex vitro transfer of micropropagated tobacco plantlets. Biol. Plant. 2009, 53, 11–20. [Google Scholar] [CrossRef]
  52. Verslues, P.E.; Zhu, J.K. Before and beyond ABA: Upstream sensing and internal signals that determine ABA accumulation and response under abiotic stress. Biochem. Soc. Trans. 2005, 33, 375–379. [Google Scholar] [CrossRef]
  53. Zhu, X.; Wang, P.; Bai, Z.; Herde, M.; Ma, Y.; Li, N.; Liu, S.; Huang, C.F.; Yang, Z.B. Calmodulin-like protein CML24 interacts with CAMTA2 and WRKY46 to regulate ALMT1-dependent Al resistance in Arabidopsis thaliana. New Phytol. 2005, 233, 2471–2487. [Google Scholar] [CrossRef]
  54. Liu, F.; Xi, M.; Liu, T.; Wu, X.; Ju, L.; Wang, D. The central role of transcription factors in bridging biotic and abiotic stress responses for plants’ resilience. New Crops. 2024, 1, 100005. [Google Scholar] [CrossRef]
  55. Shen, W.; Li, H.; Teng, R.; Wang, Y.; Wang, W.; Zhuang, J. Genomic and transcriptomic analyses of HD-Zip family transcription factors and their responses to abiotic stress in tea plant (Camellia sinensis). Genomics 2018, 111, 1142–1151. [Google Scholar] [CrossRef] [PubMed]
  56. Hao, X.; Tang, H.; Wang, B.; Yue, C.; Wang, L.; Zeng, J.; Yang, Y.; Wang, X. Integrative transcriptional and metabolic analyses provide insights into cold spell response mechanisms in young shoots of the tea plant. Tree Physiol. 2018, 38, 1655–1671. [Google Scholar] [CrossRef]
  57. Paul, A.; Kumar, S. Dehydrin2 is a stress-inducible, whereas Dehydrin1 is constitutively expressed but up-regulated gene under varied cues in tea [Camellia sinensis (L.) O. Kuntze]. Mol. Biol. Rep. 2013, 40, 3859–3863. [Google Scholar] [CrossRef]
  58. Li, Y.; Zhou, Y.; Xie, X.; Shu, X.; Deng, W.; Jiang, C. Cloning and expression analysis of dehydrin gene (csDHN) in tea plant (Camellia sinensis). J. Agric. Biotechnol. 2016, 24, 332–341. [Google Scholar]
  59. Wang, Y.; Shu, Z.; Wang, W.; Jiang, X.; Li, D.; Pan, J.; Li, X. CsWRKY2, a novel WRKY gene from Camellia sinensis, is involved in cold and drought stress responses. Biol. Plant. 2016, 60, 443–451. [Google Scholar] [CrossRef]
  60. Samarina, L.S.; Malyukova, L.S.; Efremov, A.M.; Simonyan, T.A.; Matskiv, A.O.; Koninskaya, N.G.; Rakhmangulov, R.S.; Gvasaliya, M.V.; Malyarovskaya, V.I.; Ryndin, A.V. Physiological, biochemical and genetic responses of Caucasian tea (Camellia sinensis (L.) Kuntze) genotypes under cold and frost stress. PeerJ 2020, 8, e9787. [Google Scholar] [CrossRef]
  61. Wang, Y.X.; Liu, Z.W.; Wu, Z.J.; Li, H.; Zhuang, J. Transcriptome-wide identification and expression analysis of the NAC gene family in tea plant [Camellia sinensis (L.) O. Kuntze]. PLoS ONE 2016, 11, e0166727. [Google Scholar] [CrossRef]
  62. Wayne, A.S.; Hillel, F. Calmodulin as a versatile calcium signal transducer in plants. New Phytol. 2001, 151, 35–66. [Google Scholar]
  63. Tang, M.; Xu, C.; Cao, H.; Shi, Y.; Chen, J.; Chai, Y.; Li, Z. Tomato calmodulin-like protein SlCML37 is a calcium (Ca2+) sensor that interacts with proteasome maturation factor SlUMP1 and plays a role in tomato fruit chilling stress tolerance. J. Plant Physiol. 2021, 258, 153373. [Google Scholar] [CrossRef]
  64. Ding, X.; Zhang, L.; Hao, Y.; Xiao, S.; Wu, Z.; Chen, W.; Li, X.; Zhu, X. Genome-wide identification and expression analyses of the calmodulin and calmodulin-like proteins reveal their involvement in stress response and fruit ripening in papaya. Postharvest Biol. Technol. 2018, 143, 13–27. [Google Scholar] [CrossRef]
  65. Delk, N.A.; Johnson, K.A.; Chowdhury, N.I.; Braam, J. CML24, regulated in expression by diverse stimuli, encodes a potential Ca2+ sensor that functions in responses to abscisic acid, daylength, and ion stress. Plant Physiol. 2005, 139, 240–253. [Google Scholar] [CrossRef] [PubMed]
Horticulturae 10 00666 g001
Figure 1. Effect of CaCl2 and LaCl3 on chlorophyll fluorescence in tea plants under cold stress. (A) Fv/Fm value under different treatments; (B) color image under different treatments using Imaging-PAM chlorophyll fluorometer. The three varieties were treated with exogenous calcium and a calcium inhibitor for 72 h at room temperature and a low temperature, respectively. The treatment means with different (lowercase) letters are significant at p < 0.05.
Figure 1. Effect of CaCl2 and LaCl3 on chlorophyll fluorescence in tea plants under cold stress. (A) Fv/Fm value under different treatments; (B) color image under different treatments using Imaging-PAM chlorophyll fluorometer. The three varieties were treated with exogenous calcium and a calcium inhibitor for 72 h at room temperature and a low temperature, respectively. The treatment means with different (lowercase) letters are significant at p < 0.05.
Horticulturae 10 00666 g001
Horticulturae 10 00666 g002
Figure 2. Effect of CaCl2 and LaCl3 on REC and MDA contents in tea plants under cold stress. (A) Relative electrical conductivity; (B) MDA contents. ET, exogenous treatment; TT, temperature treatment. Different letters indicate significant differences (p < 0.05) among different treatments of the same tea variety according to Tukey’s HSD test; * indicates p < 0.05, *** indicates p < 0.001, ns means non-significance.
Figure 2. Effect of CaCl2 and LaCl3 on REC and MDA contents in tea plants under cold stress. (A) Relative electrical conductivity; (B) MDA contents. ET, exogenous treatment; TT, temperature treatment. Different letters indicate significant differences (p < 0.05) among different treatments of the same tea variety according to Tukey’s HSD test; * indicates p < 0.05, *** indicates p < 0.001, ns means non-significance.
Horticulturae 10 00666 g002
Horticulturae 10 00666 g003
Figure 3. Effect of CaCl2 and LaCl3 on antioxidant enzymes (POD, SOD, CAT) activities in tea plants under cold stress. Different letters represent significant differences (p < 0.05) among treatments for each temperature period according to Tukey’s HSD test.
Figure 3. Effect of CaCl2 and LaCl3 on antioxidant enzymes (POD, SOD, CAT) activities in tea plants under cold stress. Different letters represent significant differences (p < 0.05) among treatments for each temperature period according to Tukey’s HSD test.
Horticulturae 10 00666 g003
Horticulturae 10 00666 g004
Figure 4. Effect of CaCl2 and LaCl3 on ABA contents in ’LJ 43’ tea cultivar under cold stress. Different letters represent significant differences (p < 0.05) among treatments for each temperature period according to Tukey’s HSD test.
Figure 4. Effect of CaCl2 and LaCl3 on ABA contents in ’LJ 43’ tea cultivar under cold stress. Different letters represent significant differences (p < 0.05) among treatments for each temperature period according to Tukey’s HSD test.
Horticulturae 10 00666 g004
Horticulturae 10 00666 g005
Figure 5. Effects of CaCl2 and LaCl3 treatments on expression of cold responsive genes in different tea varieties under low temperature stress. ** represents significant differences at p < 0.01 compared to CK; * represents significant differences at p < 0.05 compared to CK.
Figure 5. Effects of CaCl2 and LaCl3 treatments on expression of cold responsive genes in different tea varieties under low temperature stress. ** represents significant differences at p < 0.01 compared to CK; * represents significant differences at p < 0.05 compared to CK.
Horticulturae 10 00666 g005
Horticulturae 10 00666 g006
Figure 6. A proposed model for Ca2+-mediated cold stress in tea plants.
Figure 6. A proposed model for Ca2+-mediated cold stress in tea plants.
Horticulturae 10 00666 g006
Table 1. Primers for qRT-PCR.
Table 1. Primers for qRT-PCR.
Gene NamePrimer Sequences (5′–3′)Primer Sequences (5′–3′)
CsCML39F: TGGACTCCGATGGAAGCCTAACR: GCCTCGCTCATATCGGGTAAAA
CsCBF1F: AACTGAAACTGCGACTGAGACGAR: AGGCGGTGGAGGAGGTAGC
CsCOR47F: CACAAATGTAGAAACCATCCCCR: CTCCTTCCTTCAAATCTACAACAGT
CsDHN2F: ACT TATGGCACCGGCACTAR: CCTTCCTCCTCCCTCCTTGAC
CsWRKY2F: GAGACAGAAATGAGCAGGGAAAAR: TGTATCGGTGTCAGTTGGGTAGA
CsNAC26F: ACAAACTACGCCACAATGC R: AGGGAGGGTTCTTTTCAGG
CsPTBF: ACCAAGCACACTCCACACTATCGR: TGCCCCCTTATCATCATCCACAA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, S.; Wang, L.; Kang, R.; Liu, C.; Xing, L.; Wu, S.; Wang, Z.; Wu, C.; Zhou, Q.; Zhao, R. Exogenous Calcium Alleviates the Photosynthetic Inhibition and Oxidative Damage of the Tea Plant under Cold Stress. Horticulturae 2024, 10, 666. https://doi.org/10.3390/horticulturae10070666

AMA Style

Chen S, Wang L, Kang R, Liu C, Xing L, Wu S, Wang Z, Wu C, Zhou Q, Zhao R. Exogenous Calcium Alleviates the Photosynthetic Inhibition and Oxidative Damage of the Tea Plant under Cold Stress. Horticulturae. 2024; 10(7):666. https://doi.org/10.3390/horticulturae10070666

Chicago/Turabian Style

Chen, Siwen, Long Wang, Rui Kang, Chunhui Liu, Liyuan Xing, Shaobo Wu, Zhihui Wang, Chunlai Wu, Qiongqiong Zhou, and Renliang Zhao. 2024. "Exogenous Calcium Alleviates the Photosynthetic Inhibition and Oxidative Damage of the Tea Plant under Cold Stress" Horticulturae 10, no. 7: 666. https://doi.org/10.3390/horticulturae10070666

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop