Next Article in Journal
The Effects of Planting Density, Training System and Cultivar on Vegetative Growth and Fruit Production in Young Mango (Mangifera indica L.) Trees
Previous Article in Journal
Climate Influence on Leaf Appearance and Ligustroflavone and Rhoifolin Compounds of Turpinia arguta (Lindl.) Seem. from Different Chinese Habitats
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 10
Issue 9
10.3390/horticulturae10090936
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Serendipita indica: A Promising Biostimulant for Improving Growth, Nutrient Uptake, and Sugar Accumulation in Camellia oleifera

by
Wan-Lin Fu
1,†,
Wei-Jia Wu
1,†,
Zhi-Yan Xiao
2,
Fang-Ling Wang
2,
Jun-Yong Cheng
3,
Ying-Ning Zou
1,
Abeer Hashem
4,
Elsayed Fathi Abd_Allah
5 and
Qiang-Sheng Wu
1,*
1
College of Horticulture and Gardening, Yangtze University, Jingzhou 434025, China
2
Wuhan Forestry Workstation, Wuhan 430023, China
3
Hubei Academy of Forestry Science, Wuhan 430075, China
4
Botany and Microbiology Department, College of Science, King Saud University, Riyadh 11451, Saudi Arabia
5
Plant Production Department, College of Food and Agricultural Sciences, King Saud University, Riyadh 11451, Saudi Arabia
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Horticulturae 2024, 10(9), 936; https://doi.org/10.3390/horticulturae10090936
Submission received: 30 July 2024 / Revised: 22 August 2024 / Accepted: 28 August 2024 / Published: 2 September 2024
(This article belongs to the Special Issue Plant–Microbe Interactions and Their Importance for Horticultural Crop Productivity)
Browse Figures
Versions Notes

Abstract

:
Serendipita indica is a very promising root-associated endophytic fungus that is widely used on various plants; however, whether it affects the growth and physiological activity of an oilseed crop (Camellia oleifera) under field conditions remains unclear. In this study, we analyzed the effects of S. indica inoculation on root colonization rate, growth rate, photosynthetic parameters, mineral element concentrations and related gene expression, and sugar concentrations and expression of their transporter genes in four-year-old C. oleifera trees in the field. The results showed that the root colonization rate of C. oleifera increased from 3.37% to 9.42% following being inoculated with S. indica. Inoculation with S. indica significantly increased the plant height (46.81%), net photosynthetic rate (69.16%), nitrogen balance index (14.44%), chlorophyll index (21.08%), leaf K (7.4%), leaf Ca (13.52%), root P (17.75%), root K (12.80%), soil NH4+-N (17.78%), available K (26.66%), Olsen-P (184.30%), easily extractable glomalin-related soil protein (39.26%), and soil organic carbon (16.25%) concentrations compared to the uninoculated treatment. Inoculation with S. indica also significantly up-regulated the expression of CoHKT1;1 and CoCAX1;2 in the leaves and roots and CoPht1;1, CoPht1;2, and CoPht1;3 in the leaves. Plants inoculated with S. indica also presented significantly higher leaf glucose, fructose, and sucrose concentrations, accompanied by up-regulated expression of CoSWEET2a, CoSWEET7, CoSWEET9b, CoSWEET17a, and CoSWEET17b. These results suggest that S. indica has significant potential as a biostimulant for enhancing the growth and nutritional profile of C. oleifera, thereby contributing to sustainable oilseed production.

1. Introduction

Serendipita indica (formerly Piriformospora indica) is a root-associated endophytic fungus belonging to the family Thelephoraceae of the phylum Basidiomycota that can colonize the root epidermal cells, cortical cells, and intracellular space of many plants to establish symbiotic relationships with plant hosts [1]. The fungus can be cultured on artificial medium [2]. The effects of S. indica on plants are manifested in promoting plant growth and accelerating the uptake of mineral elements such as nitrogen and phosphorus [3] in different plants, including peach [4], corn [5], and Artemisia annua [6]. S. indica can initiate a signaling cascade involving the activation of 3-phosphoinositide-dependent protein kinase 1, oxidative signal inducible 1, and mitogen-activated protein kinases 3/6 to promote the growth of host plants [7]. Moreover, S. indica significantly induces plant resistance to biotic and abiotic stresses [1], such as flooding [4], salinity [5], drought [3], and heavy metals [6]. These characteristics make S. indica very promising for agricultural applications in the field, especially for improving nutritional absorption and reducing pesticide use [8].
Camellia oleifera is a significant woody plant cultivated for edible oil production globally, with China being the largest producer and having a cultivation area covering 4.5 × 106 hm2 [9,10]. Additionally, C. oleifera is a deep-rooted species that effectively mitigates soil erosion [8,11], while its fallen leaves and withered branches contribute to increased soil organic matter [12]. The oil of C. oleifera is known for its moisturizing, antioxidant, and anti-inflammatory effects and is widely used in skin and hair care products as well as an adjunctive treatment for cardiovascular disease and inflammation [13,14]. However, in China, C. oleifera is mainly planted in mountain areas with poor soil, which results in limited fruit yield and tree growth [14]. Liu et al. [15] reported that the rhizosphere soil of C. oleifera in the field was abundant in arbuscular mycorrhizal (AM) fungi populations. The inoculation of AM fungi and S. indica enhanced the growth and phosphorus uptake of potted C. oleifera plants [16]. S. indica possesses a high-affinity phosphate transporter, known as PiPT, which is classified within the phosphate:proton symporter family, a subgroup of the Major Facilitator Superfamily [16,17]. AM fungi are not yet able to be propagated in vitro on a large scale, while S. indica is able to be cultured in vitro on artificial media [18].
In C. oleifera, a lot of gene identifications and their functional analyses have been carried out around the stress response and seed development, such as the Aux/IAA gene family, the CCCH-type zinc finger protein gene family, and the SWEET gene family [19,20,21]. Liu et al. [22] also revealed that S. indica partly improved the plant growth of trifoliate orange, associated with high expression of IAA synthetic and transporter genes. Since S. indica has AM-fungus-like functions, we therefore hypothesized that S. indica can promote the growth as well as regulate the physiological activity of C. oleifera in the field. To confirm this hypothesis, this study inoculated S. indica on field C. oleifera trees to investigate its potential effects on tree growth, photosynthetic characteristics, nutrient acquisition, and soil properties, with a focus on the molecular mechanisms of P, K, Ca, and sugars.

2. Materials and Methods

2.1. Preparation of S. indica

S. indica was provided by the Institute of Root Biology, Yangtze University. The fungal blocks stored at −75 °C were activated at 30 °C for 72 h in dark. The 1 × 1 cm2 size mycelial blocks on PDA solid medium were cut and inoculated into PDB liquid medium for proliferation culture at 150 r/min and 30 °C for 7 days. Subsequently, the mycelium was filtered and rinsed three times with distilled water. The 1 g of fresh mycelium was combined with 100 mL of distilled water and pulverized with a juicer, and the concentration of the propagule suspension was 1.77 × 109 CFU/mL. A flow chart of S. indica proliferation is presented in Figure 1a.

2.2. Experimental Set-Up and Design

Four-year-old C. oleifera plants with essentially uniform growth (average height of 66.3 cm, stem diameter of 7.7 mm, and leaf number of 74) were inoculated on 21 March 2023, in Xianhedian, Huangpi, Wuhan, Hubei, China (114°21′56″ E, 31°06′27″ N). The soil nutrient levels were: NH4+-N of 34.15 mg/kg, Olsen-P of 34.8 mg/kg, available K of 47.05 mg/kg, organic carbon of 6.28 g/kg, and pH of 5.6. The orchard was located in a subtropical monsoon climate with an altitude of 52 m, an average annual temperature of 15 °C, and an average annual precipitation of about 800 mm.
The inoculation dosage of S. indica was 2 L of propagule suspension per plant. A ring groove with 25 cm wide and 15 cm deep was dug under the crown of C. oleifera plants to expose the roots. The S. indica’s suspension was shaken well and evenly poured into the ring groove so that it directly colonized the roots (Figure 1b). The no-inoculation with S. indica (Control) was applied with an autoclaved propagule suspension of S. indica.
The experiment was a one-way experimental design with two treatments, including S. indica inoculation and Control. Each treatment was replicated four times for a total of 16 trees (2 trees in one replication). The experiment was terminated on 18 October 2023.

2.3. Determination of Growth Behavior and Root Fungal Colonization Rate

Seven months after the inoculation of C. oleifera, the fourth fully expanded leaf at the top of the current year’s branch and the current year’s roots from the ring groove were collected. In the field, they were immediately frozen using liquid nitrogen and brought back to the laboratory for subsequent analysis. Plant height, stem diameter (10 cm from the ground), and leaf number were determined before the inoculation and 7 months after the inoculation, and their rate was estimated on a monthly basis on the change. Root fungi were stained as per the trypan blue staining method [23]. Root fungal colonization rate (%) = root length of S. indica colonization/total length of examined root segments × 100.

2.4. Measurement of Photosynthetic Characteristics

Measurements of the net photosynthetic rate, intercellular CO2 concentration, stomatal conductance, and transpiration rate were made on the 5th fully expanded leaf from the top at 9:00 a.m. on 18 October 2023, using a Li-6400 photosynthesizer (Li-COR Inc., Lincoln, NE, USA). The nitrogen balance index (Nbi), chlorophyll index (Chl), and flavonoid index (Flav) were measured on the 4th fully expanded leaf from the top using a portable plant polyphenol meter (Force-A, Orsay, France).

2.5. Determination of P, K, Ca, and Sugar Concentrations in Leaves and Roots

Root and leaf P, K, and Ca concentrations were measured using an ICP spectrometer (Thermo Fisher Scientific Inc., Waltham, MA, USA) after the plant samples were dried, ground, sieved, and digested. The fructose, glucose, and sucrose concentrations in the leaves and roots were determined using the colorimetric method described by Wu et al. [13].

2.6. Determination of Soil Properties

The soil adhering to the surface of the roots was collected for analysis of the soil properties. The soil available nutrient levels, including NH4+-N, Olsen-P, and available K were determined using a high-precision Soil Ntrient Detector Shandong (Shandong Hengmei Electronic Technology Co., Ltd., Weifang, China). Easily extractable glomalin-related soil protein (EG) and difficultly extractable glomalin-related soil protein (DG) were extracted from the air-dried soil using the protocol of He et al. [24], and the sum of the two was the total glomalin-related soil protein (TG). The protein concentration was determined using the Bradford [25] method. The soil organic carbon (SOC) content was determined via the wet oxidation method [26].

2.7. Transporter Genes Expression

The total RNA from the leaves and roots was extracted, verified for integrity and purity, and then reversed to cDNA. Six phosphorus transporter genes (CoPht1;1, CoPht1;2, CoPht1;3, CoPht1;4, CoPHO1;1, and CoPHO1;3), one potassium transporter gene (CoHKT1;1), two calcium transporter genes (CoCAX1;1 and CoCAX1;2), and ten SWEET genes [27] were chosen, and their specific primer sequences (Table 1) were designed by Primer Premier 5.0 software. qRT-PCR was performed on a real-time quantitative PCR instrument (Bio-Rad Laboratories, Hercules, CA, USA). The quantitative results were calculated using the 2−∆∆Ct method of Livak and Schmittgen [28]. For SWEET genes, GAPDH was selected as the internal reference gene; for the mineral element transporter genes, EF-1α was selected as the internal reference gene.

2.8. Statistical Analysis

The analysis of variance for the experimental data was performed using SAS 8.1 software, and significant differences were calculated using Duncan’s new multiple range tests (p < 0.05). For percentages, an arcsine conversion was performed to achieve homogeneity. Correlation analyses were performed using Origin (v2022; OriginLab Corporation, Northampton, MA, USA), and Sigmaplot (v10.0; SigmaPlot Software Inc., Chicago, IL, USA) was used to draw figures. The homogeneity test of variance and 95% confidence interval analysis of mean value were performed using SPSS (v24.0; IBM Corp., Armonk, NY, USA).

3. Results

3.1. Effect of Inoculation with S. indica on the Growth and Root Colonization Rate of Field C. oleifera

Inoculation with S. indica significantly increased the root fungal colonization rate from 3.37% to 9.42% compared with the Control treatment (Figure 2b; Supplementary Material Table S1). Inoculation with S. indica also distinctly increased the plant height (Figure 2c,d; Supplementary Material Table S1) by 46.81% compared with the Control treatment. Inoculation with S. indica did not affect leaf number (Figure 2e; Supplementary Material Table S1) or stem diameter (Figure 2f; Supplementary Material Table S1).

3.2. Effect of Inoculation with S. indica on the Leaf Photosynthetic Characteristics of Field C. oleifera

Inoculation with S. indica significantly increased the net photosynthetic rate, Nbi, and Chl in the leaves of field C. oleifera plants by 69.16%, 14.44%, and 21.08%, respectively, while significantly decreasing the intercellular CO2 concentration by 17.39% compared with the Control treatment (Figure 3a,c,e; Supplementary Material Table S1). There were no significant changes in leaf stomatal conductance (Figure 3b; Supplementary Material Table S1), transpiration rate (Figure 3d; Supplementary Material Table S1), and Flav (Figure 3e; Supplementary Material Table S1) following S. indica inoculation.

3.3. Effect of Inoculation with S. indica on P, K, and Ca Concentrations and Their Transporter Gene Expression in Field C. oleifera

Compared with the Control treatment, the treatment with S. indica inoculation significantly boosted leaf K (7.40%) and Ca concentrations (13.52%) and root P (17.75%) and K (12.80%) concentrations, respectively, along with no significant different in leaf P and root Ca concentrations (Figure 4a; Supplementary Material Table S1).
Inoculation with S. indica significantly increased the expression of CoPht1;1, CoPht1;2, CoPht1;3, CoPHO1;1, CoPHO1;3, CoCAX1;1, CoCAX1;2, and CoHKT1;1 in leaves by 3.13-, 2.19-, 611.21-, 1.43-, 2.69-, 2.34-, 29.44-, and 32.56-fold, respectively, along with a 1.28-fold down-regulation of leaf CoPht1;4 expression (Figure 4b; Supplementary Material Table S1). In addition, inoculation with S. indica significantly increased the expression of CoCAX1;1 and CoHKT1;1 in roots by 2.21- and 2.10-fold, respectively, whereas it decreased the expression of CoPht1;1, CoPht1;2, CoPht1;3, and CoPht1;4 in roots by 5.56-, 1.22-, 3.78-, and 1.58-fold, respectively.

3.4. Effect of Inoculation with S. indica on Sugar Concentrations and CsSWEET Gene Expression in Field C. oleifera

Inoculation with S. indica significantly increased the concentration of sucrose, fructose and glucose in leaves by 28.07%, 29.17%, and 56.01%, respectively, coupled with a significant decrease in root sucrose (21.27%), compared with the Control treatment (Figure 5a; Supplementary Material Table S1). Inoculation with S. indica significantly up-regulated the expression of CoSWEET2a, CoSWEET7, CoSWEET9b, CoSWEET17a, and CoSWEET17b in leaves by 1.34-, 2.96-, 1.52-, 1.50-, and 9.00-fold, respectively, while significantly down-regulating the expression of CoSWEET1b and CoSWEET10 in the leaves by 1.68- and 3.88-fold, respectively (Figure 5b; Supplementary Material Table S1). In addition, inoculation with S. indica significantly boosted the expression of CoSWEET1a, CoSWEET1b, CoSWEET7, CoSWEET9a, CoSWEET10, and CoSWEET17a in the roots by 2.68-, 8.54-, 1.75-, 2.11-, 4.28-, and 4.8-fold, respectively, whereas it significantly restricted the expression of CoSWEET2a and CoSWEET2b in the roots by 2.53- and 4-fold, respectively.

3.5. Effect of Inoculation with S. indica on the Soil Properties of Field C. oleifera

Compared with the no-inoculation Control, inoculation with S. indica significantly boosted the soil NH4+-N, available K, Olsen-P, EG, and SOC concentration by 17.78%, 26.66%, 184.30%, 39.26%, and 16.25%, respectively, followed by no significant change in DG and TG (Figure 6a,b; Supplementary Material Table S1).

3.6. Correlation Studies

The leaf sucrose, fructose, and glucose concentrations were significantly positively correlated with CoSWEET2a, CoSWEET7, CoSWEET9b, CoSWEET17a, and CoSWEET17b, while negatively correlated with CoSWEET1b and CoSWEET10 (Figure 7a). In the roots, sucrose was significantly positively correlated with CoSWEET2a and CoSWEET2b, whereas it was negatively with CoSWEET1a, CoSWEET1b, CoSWEET7, CoSWEET9a, CoSWEET10, and CoSWEET17a (Figure 7b).
In the leaves, the P concentration was significantly positively correlated with CoPht1;3 only, and the Ca and K concentrations were significantly positively correlated with the expression of their transporter genes (Figure 7c); in the roots, the P concentration was significantly negatively correlated with CoPht1;1, CoPht1;3, and CoPht1;4 and K was significantly positively correlated with CoHKT1;1 expression (Figure 7d).
The root fungal colonization rate was significantly positively correlated with the leaf net photosynthetic rate, Nbi, Chl, leaf fructose, leaf glucose, and leaf sucrose, while it was negatively correlated with the intercellular CO2 concentration (Figure 7e). In addition, the root fungal colonization rate was significantly positively correlated with the soil NH4+-N, available K, Olsen-P, SOC, EG, leaf and root P, leaf Ca, and leaf and root K (Figure 7f).

4. Discussion

S. indica can improve the growth of host plants by colonizing their roots [29]. Our study found, for the first time, that inoculation with S. indica promoted the root fungal colonization rate and thus boost the physiological parameters of C. oleifera in the field, which is in line with the earlier results in king grass [30], tobacco [31], Vicia villosa [24], and peach [4]. Nevertheless, the root fungal colonization rate was relatively low. Trypan blue can stain the colonization of endophytic fungi and AM fungi and it was not entirely clear whether the root colonization was S. indica or AM fungi. The use of precise molecular detection techniques is necessary for future work. Additionally, S. indica was more effective at promoting the plant height of potted C. oleifera than AM fungi [16]. These results demonstrated that S. indica is an efficient endophytic fungus that can be used on C. oleifera, both in potted and field conditions. However, the results of this study were performed on a small amount of study materials and only one assay was performed, which had some limitations. Therefore, longer and multi-site serial observations are warranted in future studies. In addition, there is an urgent need to investigate whether the effect of S. indica inoculation on C. oleifera plantations is dependent on plantation management patterns, tree age, and fertilizer application.
Photosynthesis, the process by which plants convert light energy into chemical energy, is influenced by various external factors [32]. This study showed that inoculation with S. indica significantly increased the leaf net photosynthetic rate, Nbi, and Chl of C. oleifera. The root fungal colonization rate was significantly and positively correlated with the net photosynthetic rate, while it was negatively correlated with the intercellular CO2 concentration, which indicated that S. indica promoted the photosynthetic rate of C. oleifera by increasing the chlorophyll concentration to produce more leaf carbohydrates, such as glucose, fructose, and sucrose. Such results are in agreement with the findings of earlier studies on Panicum miliaceum inoculated with S. indica. Additionally, Shukla et al. [29] demonstrated that S. indica improved photosynthesis in rice under arsenic stress by elongating the leaf palisade and spongy tissues, thereby enhancing CO2 uptake and promoting photosynthesis [33]. The present study also demonstrated that inoculation with S. indica significantly increased leaf sucrose, fructose, and glucose concentrations in C. oleifera and decreased the root sucrose concentrations, which is consistent with the results obtained from the inoculation of S. indica on Vicia villosa plants [24]. Sugar is a source of energy to regulate plant growth and metabolic processes [34]. The decrease in root sucrose concentrations suggested that more sucrose was cleaved into the glucose required by root-associated endophytic fungi [35]. The change in sugar allocation may be related to the overall growth strategy of the plant, which allocates more resources to aboveground parts to support growth and defense under abundant photosynthetic product conditions [24].
SWEET proteins are able to transport sugars from intracellular to extracellular areas, or from one cell to another, facilitating intercellular communication and collaboration and ensuring that all parts of the plant have access to carbon sources [36]. SWEET genes play an important role in plant growth and development, including seed germination, pollen development, flower formation, and fruit maturation [21]. In this study, the expression of leaf CoSWEET2a, CoSWEET7, CoSWEET9b, CoSWEET17a, and CoSWEET17b genes was significantly increased by S. indica inoculation and that of leaf CoSWEET1b and CoSWEET10 was decreased. In grapevine, VvSWEET10 and VvSWEET15 were highly expressed in the fruits and transported hexose during fruit ripening, thereby affecting the sugar levels of grape berries [36]. In this study, CoSWEET10 was significantly negatively correlated with the leaf sucrose, fructose, and glucose concentrations. It has been demonstrated that AM fungi reduced the transcription levels of SWEET genes in potato plants [37]. The leaf sucrose levels in S. indica-colonized plants remained unchanged, while SWEET11b expression was increased, indicating that SWEET genes have tissue-specific expression patterns [38]. Increased expression of SWEET genes may promote efficient distribution and accumulation of sugars among leaf cells, whereas decreased expression of SWEET genes may be the result of the regulation of sugar accumulation [35]. The expression of CoSWEET1a, CoSWEET1b, CoSWEET7, CoSWEET9a, CoSWEET10, and CoSWEET17a in roots was up-regulated by S. indica inoculation, along with a decrease in root sucrose, suggesting that sugars are rapidly translocated to other sites or supplied to the endophytic fungus for its requirement [39]. In citrus fruits, S. indica colonization distinctly increased the expression of CsSWEET in sarcocarps, followed by no change in fruit glucose and fructose and a significant increase in fruit sucrose [40]. Thus, the symbiotic relationship between plants and root-associated endophytic fungi is effective for sugar allocation [33]. S. indica helps host plants to optimize their sugar resources at different growth stages or in different environmental conditions, thereby enhancing survival and adaptation.
Plant development and growth can be affected by beneficial endophytic fungi [41]. In plant–endophytic fungi interaction, endophytic fungi can benefit from root exudation, and, in turn, they benefit the host plant in a variety of ways [33], including increased uptake of mineral elements (e.g., P and K) [42]. P is an essential element for energy metabolism in plant P and is mainly found in ATP and nucleic acids [16]. The increase in P concentrations in the roots nut not the leaves suggests that S. indica was involved in the acquisition of root P rather than the subsequent transfer of P from the roots to leaves. This is consistent with the findings obtained by Yang et al. [43] in trifoliate orange inoculated with S. indica. However, the results of P transporter gene expression showed that inoculation with S. indica suppressed root CoPht1;1, CoPht1;2, CoPht1;3, and CoPht1;4 expression and increased leaf CoPht1;1, CoPht1;2, and CoPht1;3 expression, which is in line with the results obtained by Cao et al. [16] when inoculating AM fungi on C. oleifera and Bandyopadhyay et al. [44] inoculating S. indica on Oryza sativa. The Pht1 subfamily belongs to the high-affinity P transporter proteins located in the cell membrane, which are induced by P deficiency stress and are involved in the transport of phosphate from the rhizosphere soil to the root inside [44,45] and the decrease in the expression of CoPht1 under S. indica inoculation conditions may be a result of the high soil Olsen-P levels in the present experimental site. Correlation analysis also revealed that root P was significantly and negatively correlated with root CoPht1;1, CoPht1;3, and CoPht1;4 expression and that leaf P was only significantly positively correlated with leaf CoPht1;3 expression. This suggests that P uptake in C. oleifera is a complex process that is not entirely dependent on S. indica colonization in the field.
The present study also showed a significant increase in the Ca concentration in the leaves of C. oleifera but not in the roots after inoculation with S. indica. This is in agreement with the results of Solanki et al. [46] in Oryza sativa. Ca plays an important role in cellular structural stability and signaling [47]. Correlation analyses showed a significantly positive correlation for Ca with CoCAX1;1 and CoCAX1;2 in the leaves but not the roots. The CAX (Ca2+/H+ cation exchanger) protein localizes to the vesicles or vesicular membranes that are responsible for the regulation of intracellular Ca2+ concentration, as well as being involved in the response to various abiotic stresses [48,49,50]. Such results imply that S. indica is involved in leaf Ca2+ transport to increase cytoarchitectural stability and potentially the stress response [46].
K is one of the macroelements for plant growth and is involved in the osmoregulation and activation of related enzymes [46,51]. The present study showed that leaf and root K concentrations and CoHKT1;1 expression in the leaves and roots were significantly elevated after S. indica colonization, which is in agreement with the results described by Solanki et al. [46] regarding Oryzae sativa. Correlation analysis also confirmed that K was significantly and positively correlated with CoHKT1;1 expression both in the leaves and roots. HKT is known to play a key role in maintaining plant survival under saline conditions and in increasing the K+/Na+ ratio [52]. This suggests that S. indica increases the K uptake in plants by up-regulating HKT1;1 expression, which is critical for enhancing photosynthesis [53]. Moreover, S. indica also increased the soil available K levels and the root fungal colonization rate was positively correlated with the soil available K concentration. This is consistent with the findings of Zhou et al. [54] in field tangor citrus colonized by AM fungi. Endophytic fungi facilitate the release or transformation of available K in the soil [24], but further studies are needed to determine how S. indica mineralizes the soil K [55].
The results of this study also showed that S. indica increased the soil NH4+-N levels and Olsen-P, SOC, and EG concentrations. Among them, EG, a newly produced component of glomalin-related soil protein, has the function of cementing soil particles and stores organic carbon and mineral elements [13]. In this study, the root fungal colonization rate was significantly and positively correlated with the EG concentration. The increase in EG content in the soil may have the capacity of improved soil structure [54], which is in line with the results of Cheng et al. [55], who inoculated S. indica on navel orange. However, whether and how S. indica enhances the soil structure by increasing EG needs to be further investigated.

5. Conclusions

In this study, S. indica inoculation significantly improved plant height, photosynthetic efficiency, the chlorophyll index, and mineral element absorption through up-regulating the expression of CoHKT1;1 and CoCAX1;2 in the leaves and roots and CoPht1;1, CoPht1;2, and CoPht1;3 in the leaves. In addition, the soil available nutrient concentrations were also increased following S. indica inoculation. S. indica inoculation also increased leaf sugar concentrations by up-regulating CoSWEET2a, CoSWEET7, CoSWEET9b, CoSWEET17a, and CoSWEET17b. Therefore, S. indica provides a new strategy for the sustainable production of C. oleifera in the field. Further experiments are needed to understand whether the effects of inoculating S. indica are dependent on different environments, endophytic fungi, and varieties.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae10090936/s1, Table S1: The 95% confidence interval for the mean of analyzed variables in this study.

Author Contributions

Conceptualization, Q.-S.W. and Y.-N.Z.; methodology, W.-L.F. and W.-J.W.; software, W.-L.F. and W.-J.W.; investigation, W.-J.W.; resources, Z.-Y.X. and F.-L.W.; data curation, W.-J.W.; writing—original draft preparation, W.-J.W.; writing—review and editing, Y.-N.Z., J.-Y.C., A.H., E.F.A. and Q.-S.W.; supervision, Q.-S.W. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Forestry Research Project of Hubei Province ((2020) LYKJ24) and the Science and Technology Promotion Project of Wuhan (No. 16, Wuyuanlinfa (2022)). The authors would like to extend their sincere appreciation to Researchers Supporting Project Number (RSP2024R134), King Saud University, Riyadh, Saudi Arabia.

Data Availability Statement

All the data supporting the findings of this study are included in this article.

Acknowledgments

The authors would like to extend their sincere appreciation to Researchers Supporting Project Number (RSP2024R134), King Saud University, Riyadh, Saudi Arabia.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Xu, G.; Li, C.T.; Gui, W.; Xu, M.Q.; Lu, J.; Qian, M.S.; Zhang, Y.Y.; Yang, G.Q. Colonization of Piriformospora indica enhances rice resistance against the brown planthopper Nilaparvata lugens. Pest Manag. Sci. 2024, 80, 4386–4398. [Google Scholar] [CrossRef]
  2. Yang, L.; Cao, J.L.; Zou, Y.N.; Wu, Q.S.; Kuča, K. Piriformospora indica: A root endophytic fungus and its roles in plants. Not. Bot. Horti Agrobo. 2020, 48, 1–13. [Google Scholar] [CrossRef]
  3. Sun, C.; Johnson, J.M.; Cai, D.G.; Sherameti, I.; Oelmüller, R.; Lou, B.G. Piriformospora indica confers drought tolerance in Chinese cabbage leaves by stimulating antioxidant enzymes, the expression of drought related genes and the plastid-localized CAS protein. J. Plant Physiol. 2010, 167, 1009–1017. [Google Scholar] [CrossRef] [PubMed]
  4. Liang, S.M.; Hashem, A.; Abd-Allah, E.F.; Wu, Q.S. Root-associated symbiotic fungi enhance waterlogging tolerance of peach seedlings by increasing flavonoids and activities and gene expression of antioxidant enzymes. Chem. Biol. Technol. Agric. 2023, 10, 124. [Google Scholar] [CrossRef]
  5. Singh, M.; Sharma, J.G.; Giri, B. Augmentative role of arbuscular mycorrhizal fungi, Piriformospora indica, and plant growth-promoting bacteria in mitigating salinity stress in maize (Zea mays L.). J. Growth Regul. 2024, 43, 1195–1215. [Google Scholar] [CrossRef]
  6. Rahman, S.U.; Khalid, M.; Hui, N.; Rehman, A.; Kayani, S.I.; Fu, X.Q.; Zheng, H.; Shao, J.; Khan, A.A.; Ali, M.; et al. Piriformospora indica alter root-associated microbiome structure to enhance Artemisia annua L. tolerance to arsenic. J. Hazard. Mater. 2023, 457, 131752. [Google Scholar] [CrossRef]
  7. Kundu, A.; Vadassery, J. Molecular mechanisms of Piriformospora indica mediated growth promotion in plants. Plant Signal. Behav. 2022, 17, 2096785. [Google Scholar] [CrossRef] [PubMed]
  8. Wu, W.J.; Wang, F.L.; Han, M.Z.; Liu, Y.Y.; Liu, R.C.; Zou, Y.N.; Wu, Q.S. Effects of root endophytic fungi on growth, gas exchange, and soil properties of field Camellia oleifera plants. Non-Wood For. Res. 2023, 41, 163–169+190. [Google Scholar] [CrossRef]
  9. Wen, Y.; Su, S.C.; Ma, L.Y.; Yang, S.Y.; Wang, Y.W.; Wang, X.N. Effects of canopy microclimate on fruit yield and quality of Camellia oleifera. Sci. Hortic. 2018, 235, 132–141. [Google Scholar] [CrossRef]
  10. Chen, Y.; Zheng, J.J.; Yang, Z.J.; Xu, C.H.; Liao, P.H.; Pu, S.S.; EI-Kassaby, Y.A.; Feng, J.L. Role of soil nutrient elements transport on Camellia oleifera yield under different soil types. BMC Plant Biol. 2023, 23, 378. [Google Scholar] [CrossRef]
  11. Liu, J.Y.; Zhang, M.X.; Fan, J.; Ding, W.N.; Chen, L.S.; Luo, J.; Liu, Y.Z.; Mei, L. The synergistic effects of AMF inoculation and boron deficiency on the growth and physiology of Camellia oleifera seedlings. Forests 2023, 14, 1126. [Google Scholar] [CrossRef]
  12. Alexis, M.A.; Rasse, D.P.; Knicker, H.; Anquetil, C.; Rumpel, C. Evolution of soil organic matter after prescribed fire: A 20-year chronosequence. Geoderma 2012, 189, 98–107. [Google Scholar] [CrossRef]
  13. Wu, W.J.; Zou, Y.N.; Hashem, A.; Avila-Quezada, G.D.; Abd_Allah, E.F.; Wu, Q.S. Rhizoglomus intraradices is more prominent in improving soil aggregate distribution and stability than in improving plant physiological activities. Agronomy 2023, 13, 1427. [Google Scholar] [CrossRef]
  14. Wu, W.J.; Zou, Y.N.; Xiao, Z.Y.; Wang, F.L.; Hashem, A.; Abd_Allah, E.F.; Wu, Q.S. Changes in fatty acid profiles in seeds of Camellia oleifera treated by mycorrhizal fungi and glomalin. Horticulturae 2024, 10, 580. [Google Scholar] [CrossRef]
  15. Liu, R.C.; Xiao, Z.Y.; Hashem, A.; Abd_Allah, E.F.; Wu, Q.S. Mycorrhizal fungal diversity and its relationship with soil properties in Camellia oleifera. Agriculture 2021, 11, 470. [Google Scholar] [CrossRef]
  16. Cao, M.A.; Liu, R.C.; Xiao, Z.Y.; Hashem, A.; Abd_Allah, E.F.; Alsayed, M.F.; Harsonowati, W.; Wu, Q.S. Symbiotic fungi alter the acquisition of phosphorus in Camellia oleifera through regulating root architecture, plant phosphate transporter gene expressions and soil phosphatase activities. J. Fungi 2022, 8, 800. [Google Scholar] [CrossRef]
  17. Pedersen, B.P.; Kumar, H.; Waight, A.B.; Risenmay, A.J.; Roe-Zurz, Z.; Chau, B.H.; Schlessinger, A.; Bonomi, M.; Harries, W.; Sali, A.; et al. Crystal structure of a eukaryotic phosphate transporter. Nature 2013, 496, 533–536. [Google Scholar] [CrossRef]
  18. Moreira, B.C.; Mendes, F.C.; Mendes, I.R.; Paula, T.A.; Junior, P.P.; Salomão, L.C.C.; Stürmer, S.L.; Otoni, W.C.; Guarçoni M., A.; Kasuya, M.C.M. The interaction between arbuscular mycorrhizal fungi and Piriformospora indica improves the growth and nutrient uptake in micropropagation-derived pineapple plantlets. Sci. Hortic. 2015, 197, 183–192. [Google Scholar] [CrossRef]
  19. Zhang, T.Z.; Liang, K.; Chen, H.; Zhu, Y.Y.; Xu, J. Identification and analysis of AUX/IAA gene family in Camellia oleifera. Mol. Plant Breed. 2024, 22, 2847–2855. [Google Scholar] [CrossRef]
  20. Xing, K.F.; Yao, X.Z.; Zhou, J.; Xie, H.X.; Chen, R.P.; Zhao, Y.; Rong, J.; Zhang, J. Identification and alaysis of CCCH type zinc finger protein gene family in Camellia oleifera under cold stress. Non-Wood For. Res. 2024, 42, 11–19. [Google Scholar] [CrossRef]
  21. Du, B.S.; Zou, X.H.; Wang, Z.H.; Zhang, X.Y.; Cao, Y.B.; Zhang, L.Y. Genome-wide identification and expression analysis of the SWEET gene family in Camellia oleifera. Biotechnol. Bull. 2024, 40, 179–190. [Google Scholar] [CrossRef]
  22. Liu, R.C.; Yang, L.; Zou, Y.N.; Wu, Q.S. Root-associated endophytic fungi modulate endogenous auxin and cytokinin levels to improve plant biomass and root morphology of trifoliate orange. Hortic. Plant J. 2023, 9, 463–472. [Google Scholar] [CrossRef]
  23. Phillips, J.M.; Hayman, D.S. Improved procedures for clearing roots and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection. Trans. Br. Mycol. Soc. 1970, 55, 158–160. [Google Scholar] [CrossRef]
  24. He, W.X.; Wu, Q.S.; Hashem, A.; Abd_Allah, E.F.; Muthuramalingam, P.; Al-Arjani, A.-B.F.; Zou, Y.N. Effects of symbiotic fungi on sugars and soil fertility and structure-mediated changes in plant growth of Vicia villosa. Agriculture 2022, 12, 1523. [Google Scholar] [CrossRef]
  25. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
  26. Walkley, A.; Black, I.A. An examination of the Degtjareff method for determining soil organic matter, and a proposed modification of the chromic acid titration method. Soil Sci. 1934, 37, 29–38. [Google Scholar] [CrossRef]
  27. Du, B.S.; Cao, Y.B.; Zhou, J.; Chen, Y.Q.; Ye, Z.H.; Huang, Y.M.; Zhao, X.Y.; Zou, X.H.; Zhang, L.Y. Sugar import mediated by sugar transporters and cell wall invertases for seed development in Camellia oleifera. Hortic. Res. 2024, 11, uhae133. [Google Scholar] [CrossRef]
  28. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and 2−∆∆Ct method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  29. Shukla, J.; Narayan, S.; Mishra, A.; Shirke, P.A.; Kumar, M. Reduction of arsenic accumulation in rice grain by endophytic fungus Serendipita indica. Rhizosphere 2023, 26, 100680. [Google Scholar] [CrossRef]
  30. Zhang, K.L.; Zhang, H.X.; Xie, C.; Zhu, Z.; Lin, L.; An, Q.; Li, D. Piriformospora indica colonization enhances remediation of cadmium and chromium co-contaminated soils by king grass through plant growth promotion and rhizosphere microecological regulation. J. Hazard. Mater. 2023, 46, 132728. [Google Scholar] [CrossRef]
  31. Li, H.; Fu, S.; Zhu, J.W.; Gao, W.; Chen, L.; Li, X.; Liu, Y. Nitric oxide generated by Piriformospora indica-induced nitrate reductase promotes tobacco growth by regulating root architecture and ammonium and nitrate transporter gene expression. J. Plant Interact. 2022, 17, 861–872. [Google Scholar] [CrossRef]
  32. Xu, T.Y.; Niu, X.; Wang, B.; Qiu, X.H.; Shou, Y.; Luo, J.N.; Guo, Y.J. Variations in leaf functional traits and photosynthetic parameters of Cunninghamia lanceolata provenances. Forests 2023, 14, 1708. [Google Scholar] [CrossRef]
  33. Abdolmaleki, A.K.; Pirdashti, H.; Yaghoubian, Y.; Abbasian, A.; Ghadirnezhad Shiade, S.R. Endophytic fungi improve growth and yield of wheat (Triticum aestivum L.) under limited light conditions. Gesunde Pflanz. 2023, 75, 1517–1529. [Google Scholar] [CrossRef]
  34. Göbel, M.; Fichtner, F. Functions of sucrose and trehalose 6-phosphate in controlling plant development. J. Plant Physiol. 2023, 291, 154140. [Google Scholar] [CrossRef]
  35. Thompson, M.; Gamage, D.; Hirotsu, N.; Martin, A.; Seneweera, S. Effects of elevated carbon dioxide on photosynthesis and carbon partitioning: A perspective on root sugar sensing and hormonal crosstalk. Front. Physiol. 2017, 8, 253220. [Google Scholar] [CrossRef]
  36. Ye, Z.H.; Du, B.S.; Zhou, J.; Cao, Y.B.; Zhang, L.Y. Camellia oleifera CoSWEET10 is crucial for seed development and drought resistance by mediating sugar transport in transgenic Arabidopsis. Plants 2023, 12, 2818. [Google Scholar] [CrossRef]
  37. Manck-Götzenberger, J.; Requena, N. Arbuscular mycorrhiza symbiosis induces a major transcriptional reprogramming of the potato SWEET sugar transporter family. Front. Plant Sci. 2016, 7, 191086. [Google Scholar] [CrossRef]
  38. De Rocchis, V.; Jammer, A.; Camehl, I.; Franken, P.; Roitsch, T. Tomato growth promotion by the fungal endophytes Serendipita indica and Serendipita herbamans is associated with sucrose de-novo synthesis in roots and differential local and systemic effects on carbohydrate metabolisms and gene expression. J. Plant Physiol. 2022, 276, 153755. [Google Scholar] [CrossRef]
  39. Waqar, S.; Bhat, A.A.; Khan, A.A. Endophytic fungi: Unravelling plant-endophyte interaction and the multifaceted role of fungal endophytes in stress amelioration. Plant Physiol. Biochem. 2023, 206, 108174. [Google Scholar] [CrossRef]
  40. Li, Q.S.; Srivastava, A.K.; Zou, Y.N.; Wu, Q.S. Field inoculation responses of arbuscular mycorrhizal fungi versus endophytic fungi on sugar metabolism associated changes in fruit quality of Lane late navel orange. Sci. Hortic. 2023, 308, 111587. [Google Scholar] [CrossRef]
  41. Liu, X.X.; Jiang, X.X.; He, X.Y.; Zhao, W.R.; Cao, Y.Y.; Guo, T.T.; Li, T.; Ni, H.T.; Tang, X.Y. Phosphate-solubilizing Pseudomonas sp. strain P34-L promotes wheat growth by colonizing the wheat rhizosphere and improving the wheat root system and soil phosphorus nutritional status. J. Plant Growth Regul. 2019, 38, 1314–1324. [Google Scholar] [CrossRef]
  42. Bouzouina, M.; Kouadria, R.; Lotmani, B. Fungal endophytes alleviate salt stress in wheat in terms of growth, ion homeostasis and osmoregulation. J. Appl. Microbiol. 2021, 130, 913–925. [Google Scholar] [CrossRef] [PubMed]
  43. Yang, L.; Zou, Y.N.; Tian, Z.H.; Wu, Q.S.; Kuča, K. Effects of beneficial endophytic fungal inoculants on plant growth and nutrient absorption of trifoliate orange seedlings. Sci. Hortic. 2021, 277, 109815. [Google Scholar] [CrossRef]
  44. Bandyopadhyay, P.; Yadav, B.G.; Kumar, S.G.; Kumar, R.; Kogel, K.; Kumar, S. Piriformospora indica and Azotobacter chroococcum consortium facilitates higher acquisition of N, P with improved carbon allocation and enhanced plant growth in Oryza sativa. J. Fungi 2022, 8, 453. [Google Scholar] [CrossRef]
  45. Zhou, J.Q.; Lu, M.Q.; Zhang, C.H.; Qu, X.J.; Liu, Y.Y.; Yang, J.; Yuan, J. Isolation and functional characterisation of the PHT1 gene encoding a high-affinity phosphate transporter in Camellia oleifera. J. Hortic. Sci. Biotechnol. 2020, 95, 553–564. [Google Scholar] [CrossRef]
  46. Solanki, S.; Gupta, S.; Kapoor, R.; Varma, A. Chemically synthesized AgNPs and Piriformospora indica synergistically augment nutritional quality in black rice. J. Fungi 2023, 9, 611. [Google Scholar] [CrossRef]
  47. Vadassery, J.; Ranf, S.; Drzewiecki, C.; Mithöfer, A.; Mazars, C.; Scheel, D.; Lee, J.; Oelmüller, R. A cell wall extract from the endophytic fungus Piriformospora indica promotes growth of Arabidopsis seedlings and induces intracellular calcium elevation in roots. Plant J. 2009, 59, 193–206. [Google Scholar] [CrossRef]
  48. Catalá, R.; Santos, E.; Alonso, J.M.; Ecker, J.R.; Martínez-Zapater, J.M.; Salinas, J. Mutations in the Ca2+/H+ transporter CAX1 increase CBF/DREB1 expression and the cold-acclimation response in Arabidopsis. Plant Cell 2003, 15, 2940–2951. [Google Scholar] [CrossRef]
  49. Pittman, J.K.; Hirschi, K.D. CAX-ing a wide net: Cation/H+ transporters in metal remediation and abiotic stress signalling. Plant Biol. 2016, 18, 741–749. [Google Scholar] [CrossRef]
  50. Wang, Y.; Kang, Y.; Ma, C.L.; Miao, R.Y.; Wu, C.L.; Long, Y.; Ge, T.; Wu, Z.N.; Hou, X.Y.; Zhang, J.X.; et al. CNGC2 is a Ca2+ influx channel that prevents accumulation of apoplastic Ca2+ in the leaf. Plant Physiol. 2017, 173, 1342–1354. [Google Scholar] [CrossRef]
  51. Paola, A.; Pierre, B.; Vincenza, C.; Bruce, V. Short term clay mineral release and re-capture of potassium in a Zea mays field experiment. Geoderma 2016, 264, 54–60. [Google Scholar] [CrossRef]
  52. Gao, R.; Jia, Y.T.; Xu, X.; Fu, P.; Zhou, J.Q.; Yang, G.H. Structural insights into the Oryza sativa cation transporters HKTs in salt tolerance. J. Integr. Plant Biol. 2024, 66, 700–708. [Google Scholar] [CrossRef] [PubMed]
  53. Boorboori, M.R.; Zhang, H.Y. The role of Serendipita indica (Piriformospora indica) in improving plant resistance to drought and salinity stresses. Biology 2022, 11, 952. [Google Scholar] [CrossRef]
  54. Zhou, L.J.; Wang, Y.; Alqahtani, M.D.; Wu, Q.S. Positive changes in fruit quality, leaf antioxidant defense system, and soil fertility of Beni-Madonna Tangor citrus (Citrus nanko × C. amakusa) after field AMF inoculation. Horticulturae 2023, 9, 1324. [Google Scholar] [CrossRef]
  55. Cheng, X.F.; Xie, M.M.; Li, Y.; Liu, B.Y.; Liu, C.Y.; Wu, Q.S.; Kuča, K. Effects of field inoculation with arbuscular mycorrhizal fungi and endophytic fungi on fruit quality and soil properties of Newhall navel orange. Appl. Soil Ecol. 2022, 17, 104308. [Google Scholar] [CrossRef]
Horticulturae 10 00936 g001
Figure 1. A flow chart of Serendipita indica proliferation (a) and field inoculation (b).
Figure 1. A flow chart of Serendipita indica proliferation (a) and field inoculation (b).
Horticulturae 10 00936 g001
Horticulturae 10 00936 g002
Figure 2. Root colonization of Serendipita indica ((a); trypan blue staining) and changes in root fungal colonization rate (b), plant height (c,d), stem diameter (e), and leaf number (f) of field Camellia oleifera following Serendipita indica colonization for seven months. Data represent means ± SD (n = 4); different letters above the bars indicate significant (p < 0.05) differences. The yellow arrow in (a) indicates that pear-shaped spores occur within the root cortex cells. Abbreviations: S. indica, Serendipita indica.
Figure 2. Root colonization of Serendipita indica ((a); trypan blue staining) and changes in root fungal colonization rate (b), plant height (c,d), stem diameter (e), and leaf number (f) of field Camellia oleifera following Serendipita indica colonization for seven months. Data represent means ± SD (n = 4); different letters above the bars indicate significant (p < 0.05) differences. The yellow arrow in (a) indicates that pear-shaped spores occur within the root cortex cells. Abbreviations: S. indica, Serendipita indica.
Horticulturae 10 00936 g002
Horticulturae 10 00936 g003
Figure 3. Changes in net photosynthetic rate (a), stomatal conductance (b), intercellular CO2 concentration (c), transpiration rate (d), nitrogen balance index (Nbi) (e), chlorophyll index (Chl) (e), and flavonoid index (Flav) (e) in the leaves of field Camellia oleifera plants following Serendipita indica colonization for seven months. Data represent means ± SD (n = 4); different letters above the bars indicate significant (p < 0.05) differences. Abbreviations: S. indica, Serendipita indica.
Figure 3. Changes in net photosynthetic rate (a), stomatal conductance (b), intercellular CO2 concentration (c), transpiration rate (d), nitrogen balance index (Nbi) (e), chlorophyll index (Chl) (e), and flavonoid index (Flav) (e) in the leaves of field Camellia oleifera plants following Serendipita indica colonization for seven months. Data represent means ± SD (n = 4); different letters above the bars indicate significant (p < 0.05) differences. Abbreviations: S. indica, Serendipita indica.
Horticulturae 10 00936 g003
Horticulturae 10 00936 g004
Figure 4. Changes in P, K, and Ca concentrations (a) and the expression levels of their transporter genes (b) in the leaves and roots of field Camellia oleifera plants following Serendipita indica colonization for seven months. Data represent means ± SD (n = 4); different letters above the bars indicate significant (p < 0.05) differences. Abbreviations: S. indica, Serendipita indica.
Figure 4. Changes in P, K, and Ca concentrations (a) and the expression levels of their transporter genes (b) in the leaves and roots of field Camellia oleifera plants following Serendipita indica colonization for seven months. Data represent means ± SD (n = 4); different letters above the bars indicate significant (p < 0.05) differences. Abbreviations: S. indica, Serendipita indica.
Horticulturae 10 00936 g004
Horticulturae 10 00936 g005
Figure 5. Changes in fructose, glucose, and sucrose concentrations (a) and CoSWEET gene expression (b) in the leaves and roots of field Camellia oleifera plants following Serendipita indica colonization for seven months. Data represent means ± SD (n = 4); different letters above the bars indicate significant (p < 0.05) differences. Abbreviations: S. indica, Serendipita indica.
Figure 5. Changes in fructose, glucose, and sucrose concentrations (a) and CoSWEET gene expression (b) in the leaves and roots of field Camellia oleifera plants following Serendipita indica colonization for seven months. Data represent means ± SD (n = 4); different letters above the bars indicate significant (p < 0.05) differences. Abbreviations: S. indica, Serendipita indica.
Horticulturae 10 00936 g005
Horticulturae 10 00936 g006
Figure 6. Changes in soil NH4+-N (a), available K (a), Olsen-P (a), EG (b), DG (b), TG (b), and SOC (b) concentration in field Camellia oleifera plants following Serendipita indica colonization for seven months. Data represent means ± SD (n = 4); different letters above the bars indicate significant (p < 0.05) differences. Abbreviations: S. indica, Serendipita indica.
Figure 6. Changes in soil NH4+-N (a), available K (a), Olsen-P (a), EG (b), DG (b), TG (b), and SOC (b) concentration in field Camellia oleifera plants following Serendipita indica colonization for seven months. Data represent means ± SD (n = 4); different letters above the bars indicate significant (p < 0.05) differences. Abbreviations: S. indica, Serendipita indica.
Horticulturae 10 00936 g006
Horticulturae 10 00936 g007
Figure 7. Heat map of the correlation between variables (n = 8). (a) The correlation between leaf sugars and corresponding CoSWEET expression; (b) the correlation between root sugars and corresponding CoSWEET expression; (c) the correlation between leaf P, K, and Ca and their corresponding transporter gene expression; (d) the correlation between root P, K, and Ca and their corresponding transporter gene expression; (e) the correlation between root fungal colonization rate, leaf photosynthetic characteristics, and leaf and root sugars; (f) the correlation between root fungal colonization rate, soil properties, and leaf and root mineral elements. Abbreviations: Nbi, nitrogen balance index; Chl, chlorophyll index; Flav, flavonoid index; EG, easily extractable glomalin-related soil protein; DG, difficultly extractable glomalin-related soil protein; TG, total glomalin-related soil protein; SOC, soil organic carbon.
Figure 7. Heat map of the correlation between variables (n = 8). (a) The correlation between leaf sugars and corresponding CoSWEET expression; (b) the correlation between root sugars and corresponding CoSWEET expression; (c) the correlation between leaf P, K, and Ca and their corresponding transporter gene expression; (d) the correlation between root P, K, and Ca and their corresponding transporter gene expression; (e) the correlation between root fungal colonization rate, leaf photosynthetic characteristics, and leaf and root sugars; (f) the correlation between root fungal colonization rate, soil properties, and leaf and root mineral elements. Abbreviations: Nbi, nitrogen balance index; Chl, chlorophyll index; Flav, flavonoid index; EG, easily extractable glomalin-related soil protein; DG, difficultly extractable glomalin-related soil protein; TG, total glomalin-related soil protein; SOC, soil organic carbon.
Horticulturae 10 00936 g007
Table 1. Specific primer sequences of selected genes in qRT-PCR.
Table 1. Specific primer sequences of selected genes in qRT-PCR.
GenesForward Sequence (5′ → 3′)Reverse Sequence (5′ → 3′)
CoPHT1;1GTTCTTGGCGGAGTCAATTTCCATCCTCATCTTCCTCGTTCTC
CoPHT1;2TCCCTTTGCTTCTTCCGATTTTCCCTTTGCTTCTTCCGATTT
CoPHT1;3GAGTCAGAGCAGCAGAAAGTAGTGTAGTCCCAAGCAAGTGAAG
CoPHT1;4CCGTTACACCGCCCTTATCCTGGGTTCTTCAGCCATCTT
CoPHO1-1AGCAGCCCTTGAAGTCATTAGGAACTTGCCCGCATTGTTTAG
CoPHO1-3GAGCTTTCAGTGGCCTAACAGTCGCCTCACCGAGTTTATC
CoCAX1;1ATCAGCGATGGCTCACCTGTTATCGGAGGAAGTGGGAGAGAGGGAAAT
CoCAX1;2CCGCCGCCAACATCTCTTCTCCGTAATTGGAAGTGAGGGAGCAA
CoHKT1;1TGGGTTACTTGGCTTTGAAGGTTTGCAGACACAGAGGTGAAGAACAA
EF-1αAGACTGTGGCTGTTGGTGTTATCCAAACCCGCACAGTTCA
CoSWEET1aGGTGAAGCCAAGAAACCTCCTCTACTTGCTCGATCGCTTCTCT
CoSWEET1bTTGGAGGAAGAGAAGCTATCTGATGATTTCTTGACATGCGATTGAG
CoSWEET2aGCAGAGAACGCGAAAAAGGTATATCCAACGAAGATCTGTCGATT
CoSWEET2bATGGTTTCTTTGGCTTTGTCCCAGATATGAGTGGCGTGCCGT
CoSWEET7CCAAGCTCCGGTCACTCATTATTAGCACAGGAAGCCAGGG
CoSWEET9aAGGTTCTACCAGAAGTCAAGCTGTGGATTCGCTCGGTTTGATA
CoSWEET9bAAGAGCGTGGAGTACATGCCGCAAATCCCGAGAGACGACA
CoSWEET10TGGAGGAAGAGAAGCTATCTGAATTGAGGCATGACTGGAATGATTTCT
CoSWEET17aATGTTGGGTTTCTTGGGGCAGACAGCTAGAGGTGCTGCAT
CoSWEET17bGCAAGGCCTCGATGACCACTTTGTCGATGCTGTATTGCCG
CoGAPDHGGTGCCAAGAAGGTGGTAATAGTTGTGCAGCTTGCATTAGAG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Fu, W.-L.; Wu, W.-J.; Xiao, Z.-Y.; Wang, F.-L.; Cheng, J.-Y.; Zou, Y.-N.; Hashem, A.; Abd_Allah, E.F.; Wu, Q.-S. Serendipita indica: A Promising Biostimulant for Improving Growth, Nutrient Uptake, and Sugar Accumulation in Camellia oleifera. Horticulturae 2024, 10, 936. https://doi.org/10.3390/horticulturae10090936

AMA Style

Fu W-L, Wu W-J, Xiao Z-Y, Wang F-L, Cheng J-Y, Zou Y-N, Hashem A, Abd_Allah EF, Wu Q-S. Serendipita indica: A Promising Biostimulant for Improving Growth, Nutrient Uptake, and Sugar Accumulation in Camellia oleifera. Horticulturae. 2024; 10(9):936. https://doi.org/10.3390/horticulturae10090936

Chicago/Turabian Style

Fu, Wan-Lin, Wei-Jia Wu, Zhi-Yan Xiao, Fang-Ling Wang, Jun-Yong Cheng, Ying-Ning Zou, Abeer Hashem, Elsayed Fathi Abd_Allah, and Qiang-Sheng Wu. 2024. "Serendipita indica: A Promising Biostimulant for Improving Growth, Nutrient Uptake, and Sugar Accumulation in Camellia oleifera" Horticulturae 10, no. 9: 936. https://doi.org/10.3390/horticulturae10090936

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop