Next Article in Journal
Impact of CO2 Enrichment on Growth, Yield and Fruit Quality of F1 Hybrid Strawberry Grown under Controlled Greenhouse Condition
Previous Article in Journal
Genetic Characteristics and Volatile Organic Compounds of Leaves and Fruit Edible Parts of Citrus depressa Hayata from Different Geographic Origins
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 10
Issue 9
10.3390/horticulturae10090940
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Screening 60Co-γ Irradiated Camellia oleifera Lines for Anthracnose-Resistant

by
Jiancai Shen
1,†,
Chengfeng Xun
2,3,†,
Xiaofan Ma
1,†,
Ying Zhang
2,3,
Zhen Zhang
2,3,
Zhilong He
2,3,
Yimin He
1,
Dayu Yang
1,
Hanggui Lai
1,*,
Rui Wang
2,3,* and
Yongzhong Chen
2,3,*
1
School of Tropical Agriculture and Forestry, Hainan University, Haikou 570228, China
2
Research Institute of Oil Tea Camellia, Hunan Academy of Forestry, Changsha 410004, China
3
National Engineering Research Center for Oil-Tea Camellia, State Key Laboratory of Utilization of Woody Oil Resource, Hunan Academy of Forestry, Changsha 410116, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Horticulturae 2024, 10(9), 940; https://doi.org/10.3390/horticulturae10090940
Submission received: 7 August 2024 / Revised: 28 August 2024 / Accepted: 30 August 2024 / Published: 2 September 2024
(This article belongs to the Section Plant Pathology and Disease Management (PPDM))
Browse Figures
Versions Notes

Abstract

:
Camellia oleifera C. Abel is a woody oil crop with multiple purposes. This study aims to investigate the mutagenic effects of 60Co-γ radiation on C. oleifera seedlings and to screen anthracnose-resistant mutants. Two C. oleifera varieties were investigated: ‘Xianglin 1’ (XL1) and ‘Xianglin 210’ (XL210). Seeds were irradiated with 0 Gy, 30 Gy, 50 Gy, and 80 Gy of 60Co-γ, and after one year of planting, the mutagenic lines were studied, and disease-resistant mutants were screened. Results showed that as the radiation intensity was increased, the emergence percentage of both C. oleifera XL210 and XL1 was significantly decreased. Radiation significantly changed the SOD and POD activities in both varieties. Furthermore, 80 Gy irradiated lines showed reduced anthracnose resistance in both varieties. However, 50 Gy irradiated lines showed enhanced disease resistance in XL210 while reducing it in XL1. The 30 Gy irradiated lines did not affect the disease resistance of either variety. Colletotrichum gloeosporioides infection tests were conducted on 94 mutant C. oleifera seedlings, resulting in 8 highly resistant mutants (A3, A8, A10, A19, A21, A32, A35, B17) and 3 susceptible mutants (A4, B15, B27) in XL210 and XL1. Differences in SOD and POD activities led to variations in disease resistance among different mutants. Additionally, the expression levels of CoSOD1, CoPOD, CoIDD4, and CoWKRY78 were varied among the different mutants. This study delivers the screening of disease-resistant mutants in C. oleifera through mutagenic breeding, providing material for the development of new C. oleifera varieties and serving as a resource for further research in mutagenic breeding.

1. Introduction

Camellia oleifera C. Abel is a significant woody oil plant with notable economic, ecological, and social value [1]. The primary goal of C. oleifera breeding has always been to develop high-yield, stable, and high-quality varieties. Traditional breeding methods for C. oleifera, including natural selection and hybrid breeding, are time-consuming due to the plant’s long juvenile period [2]. Therefore, new breeding technologies are urgently needed. Mutation breeding technology can generate extensive phenotypic variation and genetic diversity in a short period through simple operations, facilitating the selection of new varieties from a richer gene pool [3]. Since the 20th century, classic radiation-induced mutation breeding methods have primarily used X-rays and γ-rays to develop new varieties. These methods accumulate radiation energy in plant DNA, directly or indirectly inducing genomic mutations, thereby accelerating the production of beneficial traits [4]. In 1928, Muller demonstrated that X-ray exposure causes gene mutations in Drosophila melanogaster. Subsequently [5], Stadler and others published the first papers on radiation-induced mutations in Zea mays and Hordeum vulgare [6,7]. Since then, radiation-induced mutation has been widely applied in the creation of new crop varieties and genetic resources.
Currently, radiation-induced mutation technology is widely used in crop improvement to enhance yield, disease resistance, stress tolerance, and quality [8]. Radiation-induced mutagenesis offers several advantages [9]. First, it increases mutation frequency, generating a variety of mutants and enriching germplasm resources. According to the International Atomic Energy Agency, over 3400 new crop varieties have been developed through radiation mutagenesis, including cereals, flowers, legumes, and fruits. Second, it enhances plant stress resistance [10,11] and improves quality [12,13]. Third, it breaks gene linkage, facilitating genetic recombination. Radiation can cause chromosome breaks, leading to various structural mutations, thereby increasing opportunities for genetic recombination [14]. Fourth, it retains the original desirable traits while improving specific unfavorable characteristics [15,16].
60Co-γ radiation is the most used mutagen. Current research on 60Co-γ radiation mutagenesis in C. oleifera mainly focuses on optimizing mutagenic conditions [17]. By treating C. oleifera seeds with different doses of 60Co-γ radiation, the effects on seed germination, plant growth, and mutation frequency are analyzed to explore optimal radiation conditions and evaluate mutant traits [18,19,20]. However, screening and identifying plants after mutagenic treatment is a crucial step in C. oleifera mutagenic breeding technology. This determines whether beneficial mutant individuals can be discovered and used as germplasm for new variety development. Currently, there are no reports on the screening and identification of C. oleifera mutagenic breeding.
C. oleifera anthracnose, caused by Colletotrichum fungi, is one of the main diseases affecting C. oleifera, causing significant economic losses to the industry [21]. C. oleifera anthracnose typically outbreaks in warm and humid environments, especially during hot and rainy seasons, which provide ideal conditions for the pathogen’s reproduction and spread [22]. The most common symptoms of the disease include brown spots on the leaves, which gradually enlarge and cause leaf drops. In severe cases, it can affect fruit development, leading to deformed or prematurely falling fruit, which directly impacts the yield and quality of C. oleifera [23]. Efforts have long been made to develop highly disease-resistant C. oleifera varieties. This study investigated the mutagenic effects of 60Co-γ radiation on C. oleifera and conducted C. gloeosporioides infection tests on 96 irradiated seedlings. Through phenotypic screening, physiological and biochemical analyses, and verification of related gene expression, highly disease-resistant mutants were obtained. This research reports the evaluation of disease resistance and the screening of resistant mutants in mutagenized C. oleifera, providing materials for developing disease-resistant varieties and serving as a reference for future mutagenic breeding research in C. oleifera.

2. Materials and Methods

2.1. Experimental Materials and Design

This study used seeds of the common C. oleifera varieties ‘Xianglin 1’ (XL1) and ‘Xianglin 210’ (XL210) as experimental materials, treating them with 0 Gy, 30 Gy, 50 Gy, and 80 Gy doses of 60Co-γ radiation, 500 C. oleifera seeds per group. The experiment was conducted in a Venlo-type glass greenhouse located at the Tianjiling Experimental Forestry Farm of the Hunan Academy of Forestry (113°01′ E, 28°06′ N). In October 2022, C. oleifera seeds were subjected to radiation treatment and sown directly into cultivation pots with a diameter of 10 cm and a height of 20 cm. The cultivation soil was a mixture of red soil from southern China and peat soil in a 3:1 volume ratio. Watering was done regularly, along with pest and disease management. One year later, in October 2023, the germination percentage and growth parameters were recorded, and the relative germination percentage and relative mortality rate were calculated. A total of 675 mutant C. oleifera materials were obtained.
G e r m i n a t i o n   p e r c e n t a g e = N u m b e r   o f   g e r m i n a t e d   s e e d s   w i t h i n   2   y e a r s T o t a l   n u m b e r   o f   s e e d s × 100 %
R e l a t i v e   g e r m i n a t i o n   p e r c e n t a g e = G e r m i n a t i o n   p e r c e n t a g e   o f   t h e   e x p e r i m e n t a l   g r o u p G e r m i n a t i o n   p e r c e n t a g e   o f   t h e   c o n t r o l   g r o u p × 100 %
R e l a t i v e   m o r t a l i t y   p e r c e n t a g e = 1 − R e l a t i v e   g e r m i n a t i o n   p e r c e n t a g e
Disease Resistance Study in C. oleifera: Disinfect C. oleifera leaves with 75% ethanol for 30 s, rinse three times with sterile water, and air-dry naturally. Next, use a sterile needle to puncture both sides of the leaves and apply 10 μL of 1% glucose solution to the wounds [24]. Using a hole punch, extract 5 mm fungal discs from the edge of activated C. gloeosporioides colonies and inoculate them onto the wounds on the leaves. The inoculated leaves are then incubated in a lighted, constant temperature chamber at 28 °C and 90% relative humidity. For each group, 10 plants were randomly selected, each undergoing four treatments, resulting in 40 repetitions. The lesion diameter was measured 7 days post-inoculation.
Screening for Resistant Plants: We randomly selected 94 C. oleifera mutants under different radiation gradients in all mutant populations for further screening of mutant plants with differential disease resistance. For each plant, three leaves were chosen, with four inoculation points per leaf, totaling 12 biological replicates. Seven days post-inoculation, plants with lesion diameters less than 3.5 mm were marked as disease-resistant germplasm, while those with lesion diameters greater than 7.0 mm were marked as susceptible germplasm, followed by subsequent studies.

2.2. Measurement of Physiological and Biochemical Indicators

After 120 h post-inoculation, immediately place the C. oleifera leaves into liquid nitrogen. Use kits to measure the activities of superoxide dismutase (SOD) (SOD-WST-8 assay kit, RXWB0477) and peroxidase (POD) (POD kit, RXWB0111), and the contents of malondialdehyde (MDA) (MDA content kit, RXWB0005) and total flavonoids (TF) (Flavonoid kit, RXWB0343) in the leaves. The kits were purchased from Ruixinbio, Quanzhou, China. The activities of SOD and POD, as well as MDA content, were measured according to the manufacturer’s instructions. Briefly, 200 mg of Camellia oleifera leaves were collected and mixed with 1 mL of extraction buffer, then ground into a homogenate at 4 °C and centrifuged for 10 min. The supernatant was collected, and the absorbance at the corresponding wavelengths was measured using a microplate reader to calculate SOD and POD activities and MDA content. For TF content, 100 mg of leaf samples were weighed, mixed with 1.5 mL of anhydrous ethanol, and ground. The mixture was shaken at 60 °C for 2 h and then centrifuged at 25 °C for 10 min. The supernatant was collected, and the absorbance at 510 nm was measured. Each radiation group, control group, and mutant screening was conducted with three biological replicates.

2.3. RNA Extraction and Real-Time Quantitative PCR Analysis

Total RNA was extracted from C. oleifera leaves and reverse-transcribed into cDNA following Yang’s method [1]. In brief, 120 h after inoculation with C. gloeosporioides, the infected leaves were collected and ground into fine powder in liquid nitrogen. Total RNA was extracted from the tea oil leaves using the RNAprep Pure Plant Plus Kit (TIANGEN, Beijing, China). The cDNA was diluted 5-fold and used as a template for quantitative real-time PCR (qRT-PCR). The reference gene used was CoGAPDH, which has been shown to be stable under similar conditions in previous studies [25] and is reliably expressed in C. oleifera. The qRT-PCR reagents used were ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China). Specific primers were designed using Primer Premier 5 software (version 5.0; Premier Biosoft, Palo Alto, CA, USA) [1], referencing the CoWRKY78 primers from Li et al. [26] (Table 1). The 2−∆∆Ct method was used to calculate the relative gene expression levels. Three biological replicates were set up for RNA extraction, and three technical replicates were set up for real-time quantitative PCR analysis.

2.4. Statistical Analysis Methods

Data collection and preliminary processing in this study were performed using Microsoft Excel (version 16.0.17928.20114; Microsoft Corporation, Redmond, WA, USA). Statistical analysis of the experimental data was conducted using IBM SPSS Statistics 27(version 27.0.1.0.0; IBM Corporation, Armonk, NY, USA). To compare the significant differences in radiation effects at different doses, analysis of variance (ANOVA) was performed, followed by Duncan’s multiple range test. Expression levels of key genes in different mutants were analyzed using one-way ANOVA. Differences between mutants and the wild type were evaluated using Tukey’s Honest Significant Difference (HSD) test. A p-value of less than 0.05 was considered statistically significant. GraphPad Prism software (version 9.1.0; GraphPad Software, San Diego, CA, USA)was used for plotting.

3. Results

3.1. Effects of Different Doses of 60Co-γ Radiation on C. oleifera

3.1.1. Effects of Different Radiation Doses on the Germination Percentage of C. oleifera

Table 2 shows the relative germination percentages and relative mortality rates of two C. oleifera varieties under different radiation doses. The results indicate that as radiation dose increases, the relative germination percentages of both varieties decrease, while relative mortality rates increase. At 30 Gy radiation, the relative germination percentage of XL210 was 75.78%, while XL1’s was only 30.80%. When the radiation intensity increased to 50 Gy, XL210 experienced a significant decrease in relative germination percentage, whereas XL1 showed only a slight reduction. At the highest radiation dose (80 Gy), the relative germination percentages of XL210 and XL1 were 1.28% and 2.53%, respectively.

3.1.2. Effects of Different Radiation Doses on the Physiological and Biochemical Indicators of C. oleifera

We assessed the effects of various radiation doses on physiological markers in order to learn more about the mutagenic effects of 60Co-γ radiation on C. oleifera and to find possible disease-resistant mutants (Figure 1). The results showed that radiation significantly affected the SOD and POD activities in both XL210 and XL1. In XL210, SOD (Figure 1A) and POD (Figure 1B) activities increased under 50 Gy and 80 Gy radiation. In XL1, SOD (Figure 1E) and POD (Figure 1F) activities increased under 50 Gy but decreased under 80 Gy radiation. Additionally, all radiation treatments significantly increased MDA content in XL210 (Figure 1C), with increases ranging from 14.03% to 25.77%. The TF content in XL210 (Figure 1D) increased 1.36-fold and 2.07-fold under 50 Gy and 80 Gy radiation, respectively. However, radiation did not significantly alter MDA (Figure 1G) and TF (Figure 1H) content in XL1.

3.1.3. Effects of Different Radiation Doses on the Anthracnose Resistance of C. oleifera

C. oleifera’s resistance to anthracnose was significantly impacted by 60Co-γ radiation (Figure 2). The two types’ responses to 50 Gy and 80 Gy treatments differed in terms of disease resistance. As shown in Figure 2A, the 50 Gy radiation strengthened XL210’s disease resistance and decreased lesion diameter by 7.05%, while the 80 Gy radiation weakened it and increased lesion diameter by 9.57%. The disease resistance of XL1 was compromised by radiation doses of 50 Gy and 80 Gy, as shown by the increase in lesion sizes of 14.61% and 17.01%, respectively (Figure 2B). By contrast, neither variety’s ability to withstand disease was significantly impacted by the 30 Gy radiation.

3.2. Screening of C. oleifera Mutant Seedlings with Differing Anthracnose Resistance

3.2.1. Through Phenotypic Screening

94 mutagenized seedlings that were chosen were subjected to phenotypic measures (Table S1). Radiation increased the number of leaves on “XL210”, but had no discernible effect on plant height or ground diameter. In addition, 80 Gy of radiation significantly decreased the plant height and number of leaves of ‘XL1’, and radiation did not significantly affect the ground diameter of ‘XL1’.
To precisely identify mutants with varying disease resistance, additional infection experiments were performed on 94 mutant seedlings (Table S2). By listing mutants with lesion dimensions less than 3.5 mm and higher than 7.0 mm, we were able to distinguish resistant mutants from susceptible ones (Figure 3).
Among them, in XL210, A3, A8, A10, A19, A21, A32, and A35 were resistant mutants, while A29 was a susceptible mutant. In XL1, B17 was a resistant mutant, while B15 and B27 were susceptible mutants (Table 3).

3.2.2. Physiological and Biochemical Changes in Mutants with Differing Disease Resistance before and after Inoculation

To further understand the differences in disease resistance among various mutants from a physiological and biochemical perspective, we measured the changes in physiological and biochemical indicators before and after inoculation in mutants with differing disease resistance (Figure 4). The results showed that, compared to WT, the SOD (Figure 4A) and POD (Figure 4B) activities of A8, A10, A21, A32, and B17 significantly increased 7 days after C. gloeosporioides inoculation, with fold increases ranging from 0.11 to 3.53. In contrast, the SOD and POD activities of A4, B15, and B27 were lower than those of WT, with smaller increases.

3.3. q-PCR Analysis of Gene Expression in Mutants with Differing Disease Susceptibility after C. gloeosporioides Inoculation

To further understand the disease resistance responses of different mutant germplasms, we analyzed the expression levels of several genes related to C. oleifera disease resistance, including ROS scavenging-related genes (CoSOD1, CoPOD) (Figure 5) and plant stress-related transcription factor genes (CoIDD4, CoWRKY78) (Figure 6).

3.3.1. Effects on Genes Related to ROS Scavenging

The results showed that, after C. gloeosporioides inoculation, the expression changes of CoSOD1 and CoPOD genes were very similar among some disease-resistant mutant germplasms (Figure 5). Compared to their corresponding WT, the disease-resistant mutants A8, A10, A21, A32, and B17 showed significant upregulation of CoSOD1 expression (Figure 5A), with increases ranging from 32.10% to 82.69%, while the susceptible mutants A4, B15, and B27 exhibited downregulation of CoSOD1 expression by 14.00% to 53.43%. The CoPOD gene expression in resistant germplasms was also higher than in the WT (Figure 5B), with A8 showing the highest CoPOD expression (1.59-fold). In contrast, the susceptible mutants A4, B15, and B27 had slightly reduced CoPOD expression.

3.3.2. Effects on Disease-Resistance-Related Transcription Factor Genes

Different resistant mutants showed significant differences in the expression levels of CoIDD4 and CoWRKY78 after C. gloeosporioides inoculation (Figure 6). The disease-resistant mutants A21, A32, and B17 had significantly lower expression levels of CoIDD4 (Figure 6A) and CoWRKY78 (Figure 6B) compared to the WT, while the susceptible mutants A4, B15, and B27 had significantly higher expression levels of CoIDD4 and CoWRKY78 compared to the WT.

3.4. Correlation Analysis

To further understand the relationship between disease resistance, antioxidant enzyme activity, and gene expression in the mutants, a heatmap was created to display the correlation levels between various indicators (Figure 7). The results showed that the lesion diameter of infected C. oleifera leaves was not significantly correlated with SOD activity but was significantly negatively correlated with POD activity (−0.95) and the relative expression levels of CoSOD1 (−0.93) and CoPOD (−0.90). It was also significantly positively correlated with the relative expression levels of CoIDD4 (0.83) and CoWRKY78 (0.83). Additionally, POD activity was significantly positively correlated with the relative expression level of CoPOD, with a correlation coefficient of 0.90.

4. Discussion

4.1. Mutagenic Effects of 60Co-γ Radiation on C. oleifera

Mutation breeding is a powerful tool for plant improvement, but due to its non-directional nature, researchers often need to study the mutagenic effects of different methods on the materials used [27]. Sun et al. [17] studied the effects of 60Co-γ radiation on the photosynthetic characteristics of the ‘Ganwu’ C. oleifera series, finding that radiation treatment enhanced the net photosynthetic rate. Li et al. [18] discovered that exposure to 30 Gy of 60Co-γ radiation significantly increased the oil content in both the seeds and fresh fruits of C. oleifera ‘Cenruan’. Yi et al.’s [19] research indicated a significant positive correlation between the mortality rate of Camellia semiserrata and radiation dose, with radiation also inhibiting the growth in plant height and ground diameter of the oil tea plant. In contrast, Zeng et al. [20] found that 10 Gy and 20 Gy of 60Co-γ radiation promoted the growth of ground diameter in C. oleifera ‘Cenruan 2’. In addition, previous studies have shown that different radiation doses and varietal characteristics can affect the germination percentage of C. oleifera seeds [20,28]. In this study, radiation significantly reduced the germination percentages of both C. oleifera varieties, and the germination percentage decreased continuously with increasing radiation dose, consistent with the findings of Yi et al. [19]. At medium-low doses (30 Gy, 50 Gy), the seeds exhibited some radiation tolerance, while at high doses, most seeds died, with relative mortality exceeding 97%. XL210 had a higher relative germination percentage than XL1 under 30 Gy, indicating greater tolerance to low-dose radiation. However, under medium-high doses, XL1 had a higher relative germination percentage. These results suggest that XL210 has stronger tolerance to lower (30 Gy) doses, while XL1 is more tolerant to higher doses. This study builds on previous work by expanding the range of radiation doses and C. oleifera varieties studied, providing valuable insights for further understanding the mutagenic effects in C. oleifera.
Radiation can activate the cell repair system [29]. Due to irradiation, various compensatory and regulatory mechanisms in the organism keep enzyme activity at a certain level, such as maintaining cellular ROS homeostasis by increasing the activity of related antioxidant enzymes [30]. In this study, medium-high doses (50 Gy, 80 Gy) of radiation significantly affected the SOD and POD activities in both varieties. Under medium-high doses, XL210 showed higher SOD, POD activities, and MDA content, indicating oxidative damage and activation of the cell repair mechanism, enhancing the activity of ROS-scavenging enzymes. In contrast, XL1 showed lower antioxidant enzyme levels and higher MDA content under 80 Gy, suggesting that high doses might damage XL1’s repair system. These results suggest that XL1’s cell repair mechanism may be more sensitive to high-dose radiation. Currently, research on the physiological and biochemical effects of 60Co-γ radiation on C. oleifera is limited. This study examined four physiological and biochemical parameters in oil tea following radiation, which holds significance for advancing research on radiation-induced mutagenesis in C. oleifera.
Many studies have shown that mutation breeding is an effective method to enhance plant stress resistance [31]. Ghani et al. [32] found that 5 Gy γ-ray radiation increased the resistance of Gerbera jamesonii cv. ‘Harley’ to powdery mildew. Jeong et al. [33] used 200 Gy γ-ray radiation to enhance pear fruit resistance to Penicillium expansum and reduce disease incidence. In this study, 60Co-γ radiation altered the anthracnose resistance of C. oleifera. The 80 Gy dose reduced the disease resistance of both varieties, possibly due to radiation-induced damage. The effect of 50 Gy radiation varied between varieties; XL210 showed enhanced disease resistance, while XL1 did not. These results suggest that high doses of radiation can have teratogenic effects on Camellia disease resistance, and 50 Gy is a suitable dose for enhancing anthracnose resistance in XL210. Building on previous studies of mutagenic effects, this research further explores the impact of radiation on the disease resistance of C. oleifera, offering valuable insights for enhancing disease resistance in C. oleifera through 60Co-γ radiation. In summary, different radiation intensities had mutagenic effects on the germination percentage, physiological and biochemical levels, and anthracnose resistance of the two C. oleifera varieties.

4.2. Screening for Disease-Resistant Germplasms in C. oleifera

In China, almost all C. oleifera planting areas are affected by anthracnose, leading to reduced yields [34]. Researchers are dedicated to breeding anthracnose-resistant C. oleifera varieties [35,36], but traditional breeding methods are often inefficient in developing new varieties. Mutation breeding can introduce new genes and traits into plants [37], allowing the selection of beneficial individuals by screening for target genes and traits. Directed screening by applying stress factors to mutant populations is a common and effective method. After stress treatment, superior mutants are selected by observing different phenotypic responses. Dalvi et al. [38] screened for smut disease-resistant mutants in Saccharum spp. hybrids through stress treatment. Tiryaki et al. [39] obtained drought-tolerant mutants in Medicago sativa L. by simulating drought conditions. In this study, we used C. gloeosporioides to infect the leaves of 94 mutant C. oleifera plants and screened mutants with differing disease resistance based on lesion size, identifying 7 highly resistant mutants and 1 susceptible mutant in XL210 and 1 highly resistant mutant and 1 susceptible mutant in XL1. This provides material for breeding Camellia varieties with strong anthracnose resistance.
When plants face pathogen invasion, the production of ROS is an important immune mechanism [40], but excessive ROS accumulation can cause oxidative stress and damage cells [41,42]. Enzymes related to the ROS scavenging system, such as SOD and POD, are crucial for maintaining cellular ROS homeostasis [43]. Studies have shown that the activity of SOD and POD and the expression of related genes reflect a plant’s disease resistance [44]. In this study, after C. gloeosporioides inoculation, the SOD and POD activities and their increase in resistant germplasms were higher than in WT, while the related enzyme activities in susceptible germplasms were lower and their increase was smaller. Further gene expression profiling and correlation analysis confirmed these findings. These results indicate that the stronger response of the antioxidant system in resistant germplasms, possibly due to mutations, enhanced their disease resistance, while the antioxidant system in susceptible germplasms might have been damaged, leading to reduced disease resistance.

4.3. Gene Expression in Mutants with Differing Disease Resistance

In the immune response of plants to pathogens, plants perceive pathogen-associated molecular patterns (PAMPs) through pattern recognition receptors (PRRs) [45,46,47,48], triggering calcium ion influx and kinase cascades to initiate defense responses, including the production of reactive oxygen species (ROS) [49]. ROS, such as superoxide anion (O2−) and hydrogen peroxide (H2O2), have dual roles in plant defense, directly killing pathogens and acting as signaling molecules to induce the expression of defense genes [50]. However, excessive ROS can cause oxidative damage to the plants themselves, so plants use enzyme systems such as SOD and POD to remove excess ROS and maintain redox balance within the cells [51]. Studies have shown that SOD isozyme activity is higher in stress-resistant mutants of Medicago sativa L. under stress conditions [39]. Additionally, the overexpression of related antioxidant enzyme genes in some plants enhances their signaling responses during stress and increases their resistance to various stress conditions [52]. In this study, some resistant mutants showed significantly higher SOD, POD activities, and CoSOD1, CoPOD gene expression levels than WT after pathogen infection, while susceptible mutants had lower enzyme activities and related gene expression levels. These results indicate that the differential expression of CoSOD1 and CoPOD in Camellia mutants with different resistance levels influences disease resistance at the physiological level.
The differential expression of CoSOD1 and CoPOD in mutants suggests potential mutations in upstream regulatory factors in the mutants [53], which may directly or indirectly regulate the expression of SOD and POD genes by affecting the concentration or activity of signaling molecules. Furthermore, the signaling pathways activated after pathogen perception are highly intertwined, with cross-regulation between different pathways [54], and mutations may affect key nodes, thereby activating multiple downstream pathways and enhancing SOD and POD expression. Feedback regulation mechanisms may also be amplified or altered by mutations, leading to higher ROS levels and further enhancing antioxidant enzyme expression.
IDD4 and WRKY78 belong to the INDETERMINATE DOMAIN (IDD) and WRKY gene families, respectively, playing crucial roles in plant immune responses. IDD4 is regulated by the MAPK cascade [55], with MPK6 altering IDD4’s DNA-binding ability and transcriptional activity through phosphorylation, thus affecting the expression of downstream genes [56]. WRKY78’s regulatory network involves pathogen recognition receptors (PRRs), which recognize PAMPs and activate the MAPK cascade, thereby regulating WRKY78 expression and activity [57]. Additionally, calcium signaling pathways and hormone signals (such as jasmonic acid and salicylic acid) also play important roles in regulating WRKY78 expression [58,59]. Studies have shown that silencing AtIDD4 enhances Arabidopsis thaliana resistance to fungi [60], while overexpression of CoWRKY78 reduces Nicotiana tabacum antioxidant enzyme activity, leading to decreased disease resistance, as in the results observed in some mutants in this study. In the resistant mutants screened in this study, A21, A32, and B17 had lower CoIDD4 and CoWRKY78 expression levels compared to WT, showing stronger antioxidant capacity and disease resistance after C. gloeosporioides inoculation. In contrast, the susceptible mutants A4, B15, and B27 exhibited higher CoIDD4 and CoWRKY78 expression levels and lower SOD and POD activities, leading to reduced disease resistance. These results suggest that the differential expression of CoIDD4 and CoWRKY78 genes in different mutants affects their disease resistance, with these transcription factors’ expression levels being one of the reasons for the mutants’ varied resistance. The differential expression may be due to mutations in genes related to upstream signaling pathways, affecting these transcription factors’ expression in the mutants, thereby altering the defense system and changing disease resistance.
In addition to potential mutations in genes related to upstream regulatory networks, the genes themselves may mutate, leading to increased expression levels. Mutations in promoter regions can introduce new enhancer elements or disrupt existing silencer elements, enhancing gene transcription activity [61]. Studies have shown that the presence of enhancer elements in the AtIDD4 promoter significantly increases gene expression levels in A. thaliana [56]. Mutations in promoter regions can also alter transcription factor binding sites, allowing more transcription factors to bind, thereby increasing gene transcription levels. For example, mutations in the promoter region of the OsWRKY45 gene in Oryza sativa significantly increased its expression, enhancing plant disease resistance [62]. Additionally, some mutations may alter the secondary structure of mRNA, making it more stable or more easily translated, thus increasing gene expression levels [63]. In this study, some mutants exhibited different gene expression patterns compared to WT after anthracnose inoculation, suggesting that mutations in these disease resistance-related genes led to changes in their expression levels, resulting in different disease resistance phenotypes. In summary, the differential gene expression observed in the resistant and susceptible mutants we screened suggests potential mutations in upstream regulatory network genes or the genes themselves, leading to variations in gene expression levels among different mutants. By analyzing gene expression profiles and the regulatory processes associated with these genes, potential mutation sites in the mutants were identified, providing valuable insights for elucidating the mechanisms of mutation breeding.

4.4. Limitations and Future Prospects

The resistant C. oleifera germplasms preliminary screened in this study need further observation and verification through field cultivation. Gene expression analysis suggests that relevant point mutations may have enhanced disease resistance. Future research should include multi-omics and resequencing studies to understand the mechanistic changes in disease resistance induced by radiation more comprehensively.

5. Conclusions

This study preliminary investigated the mutagenic effects of different doses of 60Co-γ radiation on C. oleifera. The findings demonstrated that 60Co-γ radiation significantly altered C. oleifera’s relative germination rate and relative mortality rate, physiological and biochemical markers, and resistance to anthracnose. Three sensitive mutations and eight resistant mutants were found by additional screening. Stronger disease resistance was seen in resistant mutants with higher SOD and POD activities, whereas susceptible mutants with lower SOD and POD activities showed less disease resistance. POD activity and the CoPOD gene expression in C. oleifera showed a strong positive connection following C. gloeosporioides inoculation. Furthermore, different mutants expressed linked genes differently from one another.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae10090940/s1. Table S1: Effects of different doses of 60Co-γ radiation on the growth indicators of C. oleifera; Table S2: Lesion diameters of 96 mutant C. oleifera plants 7 days after C. gloeosporioides inoculation.

Author Contributions

Conceptualization, J.S., C.X. and X.M.; methodology, J.S., C.X. and X.M.; software, Y.Z., Y.H. and D.Y.; validation, Y.H. and D.Y.; formal analysis, J.S., C.X. and X.M.; investigation, J.S., C.X., X.M., Y.Z., Z.Z. and Z.H.; data curation, J.S., C.X. and X.M.; writing—original draft preparation, J.S., C.X. and X.M.; writing—review and editing, H.L., R.W. and Y.C.; visualization, J.S., C.X. and X.M.; supervision, Y.Z., Z.Z. and Z.H.; project administration, H.L., R.W. and Y.C.; resources, Y.Z., Z.Z. and Z.H.; funding acquisition, H.L., R.W. and Y.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the R&D Plan for Key Areas in Hunan Province (2023NK2005), and Hunan Technology of Forestry Science Innovation Project (XLKY202206), National Key R&D Program of China (2023YFD2200702). The funding agencies are the Hunan Provincial Department of Science and Technology, the Hunan Provincial Forestry Bureau, and the Ministry of Science and Technology of China.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Yang, D.; Chen, Y.; Wang, R.; He, Y.; Ma, X.; Shen, J.; He, Z.; Lai, H. Effects of Exogenous Abscisic Acid on the Physiological and Biochemical Responses of Camellia oleifera Seedlings under Drought Stress. Plants 2024, 13, 225. [Google Scholar] [CrossRef]
  2. Zheng, J.; Su, H.; Pu, S.; Chen, H.; EI-Kassaby, Y.A.; Yang, Z.; Feng, J. High-yield hybrid breeding of Camellia oleifolia based on ISSR molecular markers. BMC Plant Biol. 2024, 24, 517. [Google Scholar] [CrossRef]
  3. Choi, H.-I.; Han, S.M.; Jo, Y.D.; Hong, M.J.; Kim, S.H.; Kim, J.-B. Effects of Acute and Chronic Gamma Irradiation on the Cell Biology and Physiology of Rice Plants. Plants 2021, 10, 439. [Google Scholar] [CrossRef]
  4. Li, Y.; Chen, L.; Zhan, X.; Liu, L.; Feng, F.; Guo, Z.; Wang, D.; Chen, H. Biological effects of gamma-ray radiation on tulip (Tulipa gesneriana L.). PeerJ 2022, 10, e12792. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  5. Muller, H. The Measurement of Gene Mutation Rate in Drosophila, Its High Variability, and Its Dependence upon Temperature. Genetics 1928, 13, 279–357. [Google Scholar] [CrossRef] [PubMed]
  6. Stadler, L. Genetic Effects of X-rays in Maize. Proc. Natl. Acad. Sci. USA 1928, 14, 69–75. [Google Scholar] [CrossRef] [PubMed]
  7. Stadler, L.J. Mutations in barley induced by X-rays and radium. Science 1928, 68, 186–187. [Google Scholar] [CrossRef]
  8. Hazra, S.; Gorai, S.; Roy, S.; Bose, S.; Hazra, P.; Chattopadhyay, A.; Ali, M.; Jambhulkar, S.; Maji, A. Isolation of yellow vein mosaic virus (YVMV)-resistant mutants of okra (Abelmoschus esculentus L.) through applied mutagenesis. Plant Breed. 2023, 143, 232–245. [Google Scholar] [CrossRef]
  9. Riviello-Flores, M.d.l.L.; Cadena-Iñiguez, J.; Ruiz-Posadas, L.d.M.; Arévalo-Galarza, M.d.L.; Castillo-Juárez, I.; Soto Hernández, M.; Castillo-Martínez, C.R. Use of Gamma Radiation for the Genetic Improvement of Underutilized Plant Varieties. Plants 2022, 11, 1161. [Google Scholar] [CrossRef] [PubMed]
  10. Pérez-Jiménez, M.; Pérez-Tornero, O. Mutants of Citrus macrophylla rootstock obtained by gamma radiation improve salt resistance through toxic ion exclusion. Plant Physiol. Biochem. 2020, 155, 494–501. [Google Scholar] [CrossRef]
  11. Truc, N.T.; Uthairatanakij, A.; Srilaong, V.; Laohakunjit, N.; Jitareerat, P. Effect of electron beam radiation on disease resistance and quality of harvested mangoes. Radiat. Phys. Chem. 2021, 180, 109289. [Google Scholar] [CrossRef]
  12. Sellapillai, L.; Dhanarajan, A.; Raina, A.; Ganesan, A. Gamma ray induced positive alterations in morphogenetic and yield attributing traits of finger millet (Eleusine coracana (L.) Gaertn.) in M2 generation. Plant Sci. Today 2022, 9, 939–949. [Google Scholar] [CrossRef]
  13. Yoon, Y.; Ameer, K.; Song, B.; Kim, J.; Park, H.; Lee, K.; Eun, J.; Park, J. Effects of X-ray irradiation on the postharvest quality characteristics of ‘Maehyang’ strawberry (Fragaria × ananassa). Food Chem. 2020, 325, 126817. [Google Scholar] [CrossRef] [PubMed]
  14. Ragini, R.; Murukan, N.; Sekhon, N.K.; Chugh, C.; Agarwal, P.; Yadav, P.; Mallick, N.; Jha, S.K.; Iquebal, M.A.; Tandon, G.; et al. Breaking the association between gametocidal gene(s) and leaf rust resistance gene (LrS2427) in Triticum aestivum-Aegilops speltoides derivative by gamma irradiation. Mol. Breed. 2024, 44, 54. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  15. Huang, J.; Wen, S.; Zhang, Y.; Zhong, Q.; Yang, L.; Chen, L. Abnormal megagametogenesis results in seedless-ness of a polyembryonic ‘Meiguicheng’ orange (Citrus sinensis) mutant created with gamma-rays. Sci. Hortic. 2017, 217, 73–83. [Google Scholar] [CrossRef]
  16. Mariana, B.D.; Arisah, H.; Yenni, Y.; Selvawajayanti, M. Seedless fruit pummelo induced by gamma ray irradiation: Fruit morphological characters and stability evaluation. Biodiversitas 2018, 19, 626–631. [Google Scholar] [CrossRef]
  17. Sun, Y.; Sun, H.; Li, J.; Lei, X. The photosynthetic characteristics of Camellia oleifera by Co60-γ irradiation treatment. South China For. Sci. 2017, 45, 1–3+15. [Google Scholar]
  18. Li, B.; Cha, Q.; Huang, Y. Effect of 60Co-y Radiation Treatments on Economic Indicators of Camellia oleifera. Guangdong For. Sci. Technol. 2015, 31, 12–16. [Google Scholar]
  19. Yi, L.; Li, W.; Cui, Z.; Xi, R. Effects of 60Co-γ ray irradiation on the seed germination and seedling growth of Camellia semiserrata. J. South China Agric. Univ. 2014, 35, 93–97. [Google Scholar]
  20. Zeng, L.; Huang, Y.; Ye, X.; Lin, W.; Li, L. The Effect of 60Co-γ Radiation on the Growth of Camellia oleifera Seedlings. Subtrop. Plant Sci. 2012, 41, 42–44. [Google Scholar]
  21. Sun, W.; Lei, T.; Yuan, H.; Chen, S. First Report of Anthracnose Caused by Colletotrichum kahawae and Colletotrichum horri on Tea-oil Tree in China. Plant Dis. 2022, 107, 1944. [Google Scholar] [CrossRef] [PubMed]
  22. Chen, X.; Chen, X.; Tan, Q.; Mo, X.; Liu, J.; Zhou, G. Recent progress on harm, pathogen classification, control and pathogenic molecular mechanism of anthracnose of oil-tea. Front. Microbiol. 2022, 13, 918339. [Google Scholar] [CrossRef] [PubMed]
  23. Wang, Y.; Chen, J.; Xu, X.; Cheng, J.; Zheng, L.; Huang, J.; Li, D. Identification and Characterization of Colletotrichum Species Associated with Anthracnose Disease of Camellia oleifera in China. Plant Dis. 2020, 104, 474–482. [Google Scholar] [CrossRef] [PubMed]
  24. Yang, C.; Wu, P.; Cao, Y.; Yang, B.; Liu, L.; Chen, J.; Zhuo, R.; Yao, X. Overexpression of dihydroflavonol 4-reductase (CoDFR) boosts flavonoid production involved in the anthracnose resistance. Front. Plant Sci. 2022, 13, 1038467. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  25. Yang, C.; Wu, P.; Yao, X.; Sheng, Y.; Zhang, C.; Lin, P.; Wang, K. Integrated Transcriptome and Metabolome Analysis Reveals Key Metabolites Involved in Camellia oleifera Defense against Anthracnose. Int. J. Mol. Sci. 2022, 23, 536. [Google Scholar] [CrossRef]
  26. Li, J.; Xiong, C.; Ruan, D.; Du, W.; Li, H.; Ruan, C. Identification of Camellia oleifera WRKY transcription factor genes and functional characterization of CoWRKY78. Front. Plant Sci. 2023, 14, 1110366. [Google Scholar] [CrossRef]
  27. Haspolat, G. Variations in Flower Color of Mutant Chrysanthemums. Horticulturae 2024, 10, 385. [Google Scholar] [CrossRef]
  28. Nie, L.; Cha, Q.; Huang, Y.; Chen, S. Effects of 60 Co-γ Irradiation on Seed Germination and Seedling Growth of Camellia drupifera. For. Environ. Sci. 2019, 48, 7–10. [Google Scholar]
  29. Wang, B.; Ye, T.; Li, C.; Li, X.; Chen, L.; Wang, G. Cell damage repair mechanism in a desert green algae Chlorella sp. against UV-B radiation. Ecotoxicol. Env. Saf. 2022, 242, 113916. [Google Scholar] [CrossRef] [PubMed]
  30. Morcillo, F.; Serret, J.; Beckers, A.; Collin, M.; Tisné, S.; George, S.; Poveda, R.; Louise, C.; Tranbarger, T.J. A Non-Shedding Fruit Elaeis oleifera Palm Reveals Perturbations to Hormone Signaling, ROS Homeostasis, and Hemicellulose Metabolism. Genes 2021, 12, 1724. [Google Scholar] [CrossRef]
  31. Zulkifli, N.A.; Izhar, K.M.A.A.; Lau, H.Y.; Azizi, M.M.F. Advances in Irradiation Technology for Plant Disease Resistance: A Review. Agric. Rev. 2024, 45, 25–34. [Google Scholar] [CrossRef]
  32. Ghani, M.; Sharma, S.K. Induction of powdery mildew resistance in gerbera (Gerbera jamesonii) through gamma irradiation. Physiol. Mol. Biol. Plants 2019, 25, 159–166. [Google Scholar] [CrossRef] [PubMed]
  33. Jeong, R.-D.; Jeong, M.-A.; Park, M.-R. Gamma irradiation-induced disease resistance of pear (Pyrus pyrifolia “Niitaka”) against Penicillium expansum. J. Phytopathol. 2017, 165, 626–633. [Google Scholar] [CrossRef]
  34. Chen, X.; He, Y.; Wang, Z.; Niu, A.; Xue, Y.; Zhou, D.; Zhou, G.; Liu, J. Research progress and management strategies of fungal diseases in Camellia oleifera. Front. Microbiol. 2023, 14, 1215024. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  35. Zhu, H.; He, C. Identification and Characterization of Colletotrichum Species Causing Tea-Oil Camellia (Camellia oleifera C. Abel) Anthracnose in Hainan, China. Forests 2023, 14, 1030. [Google Scholar] [CrossRef]
  36. Bin, L.; Qiu, W.; Chao-Hui, Z.; Zhao-Yang, H.; Hai, Y.; Jun, L.; Yan-de, L. Research on anthracnose grade of Camellia oleifera based on the combined LIBS and THz technology. Plant Methods 2022, 18, 52. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  37. Ye, J.; Zhang, Q.; Cheng, P.; Wang, Y.; Zou, J.; Lin, S.; Li, M.; Jia, M.; Chen, Y.; Jia, X.; et al. Aviation Mutagenesis Alters the Content of Volatile Compounds in Dahongpao (Camellia sinensis) Leaves and Improves Tea Quality. Foods 2024, 13, 946. [Google Scholar] [CrossRef]
  38. Dalvi, S.G.; Tawar, P.N.; Suprasanna, P.; Dixit, G.B.; Prasad, D.T. EMS-Based In Vitro Mutagenesis and Mutant Screening for Smut Resistance with Agronomic Traits in Sugarcane. Sugar Tech. 2021, 23, 854–864. [Google Scholar] [CrossRef]
  39. Tiryaki, I.; Sari, U.; Cetin, S.; Acar, O. Improved drought tolerance of EMS mutagenized Alfalfa (Medicago sativa L.) mutants by in vitro screening at germination stage. Sci. Rep. 2022, 12, 12693. [Google Scholar] [CrossRef]
  40. Yuan, M.; Jiang, Z.; Bi, G.; Nomura, K.; Liu, M.; Wang, Y.; Cai, B.; Zhou, J.; He, S.; Xin, X. Pattern-recognition receptors are required for NLR-mediated plant immunity. Nature 2021, 592, 105–109. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  41. Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef] [PubMed]
  42. Jarin, A.S.; Islam, M.M.; Rahat, A.; Ahmed, S.; Ghosh, P.; Murata, Y. Drought Stress Tolerance in Rice: Physiological and Biochemical Insights. Int. J. Plant Biol. 2024, 15, 692–718. [Google Scholar] [CrossRef]
  43. Huang, Q.; Li, F.; Meng, F. Functional Characterization of the Transcription Factor Gene CgHox7 in Colletotrichum gloeosporioides, Which Is Responsible for Poplar Anthracnose. J. Fungi 2024, 10, 505. [Google Scholar] [CrossRef]
  44. Jiang, S.; Li, Z.; Yuan, H.; Jin, J.; Xiao, C.; Cui, Y. Quantification Assessment of Winter Wheat Sensitivity under Different Drought Scenarios during Growth. Water 2024, 16, 2048. [Google Scholar] [CrossRef]
  45. Zipfel, C.; Oldroyd, G.E. Plant signalling in symbiosis and immunity. Nature 2017, 543, 328–336. [Google Scholar] [CrossRef] [PubMed]
  46. Tian, W.; Hou, C.; Ren, Z.; Wang, C.; Zhao, F.; Dahlbeck, D.; Hu, S.; Zhang, L.; Niu, Q.; Li, L.; et al. A calmodulin-gated calcium channel links pathogen patterns to plant immunity. Nature 2019, 572, 131–135. [Google Scholar] [CrossRef] [PubMed]
  47. Lacombe, S.; Rougon-Cardoso, A.; Sherwood, E.; Peeters, N.; Dahlbeck, D.; van Esse, H.P.; Smoker, M.; Rallapalli, G.; Thomma, B.P.; Staskawicz, B.; et al. Interfamily transfer of a plant pattern-recognition receptor confers broad-spectrum bacterial resistance. Nat. Biotechnol. 2010, 28, 365–369. [Google Scholar] [CrossRef] [PubMed]
  48. Chinchilla, D.; Zipfel, C.; Robatzek, S.; Kemmerling, B.; Nürnberger, T.; Jones, J.D.; Felix, G.; Boller, T. A flagellin-induced complex of the receptor FLS2 and BAK1 initiates plant defence. Nature 2007, 448, 497–500. [Google Scholar] [CrossRef] [PubMed]
  49. Torres, M.A.; Jones, J.D.; Dangl, J.L. Reactive oxygen species signaling in response to pathogens. Plant Physiol. 2006, 141, 373–378. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  50. Mittler, R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 2002, 7, 405–410. [Google Scholar] [CrossRef] [PubMed]
  51. Wu, G.; Shortt, B.J.; Lawrence, E.B.; Levine, E.B.; Fitzsimmons, K.C.; Shah, D.M. Disease resistance conferred by expression of a gene encoding H2O2-generating glucose oxidase in transgenic potato plants. Plant Cell 1995, 7, 1357–1368. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  52. Ghorbel, M.; Olayen, W.; Brini, F. Roles of enzymatic antioxidants in stress response and signaling in plants. In Defense-Related Proteins in Plants, 1st ed.; Upadhyay, S.K., Ed.; Academic Press: Cambridge, MA, USA, 2024; pp. 413–468. [Google Scholar] [CrossRef]
  53. Foyer, C.H.; Noctor, G. Redox homeostasis and antioxidant signaling: A metabolic interface between stress perception and physiological responses. Plant Cell 2005, 17, 1866–1875. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  54. Tsuda, K.; Katagiri, F. Comparing signaling mechanisms engaged in pattern-triggered and effector-triggered immunity. Curr. Opin. Plant Biol. 2010, 13, 459–465. [Google Scholar] [CrossRef] [PubMed]
  55. Völz, R.; Kim, S.K.; Mi, J.; Rawat, A.A.; Veluchamy, A.; Mariappan, K.G.; Rayapuram, N.; Daviere, J.M.; Achard, P.; Blilou, I.; et al. INDETERMINATE-DOMAIN 4 (IDD4) coordinates immune responses with plant-growth in Arabidopsis thaliana. PLoS Pathog. 2019, 15, e1007499. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  56. Rawat, A.; Völz, R.; Sheikh, A.; Mariappan, K.G.; Kim, S.K.; Rayapuram, N.; Alwutayd, K.M.; Alidrissi, L.K.; Benhamed, M.; Blilou, I.; et al. Salinity stress-induced phosphorylation of INDETERMINATE-DOMAIN 4 (IDD4) by MPK6 regulates plant growth adaptation in Arabidopsis. Front. Plant Sci. 2023, 14, 1265687. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  57. Taj, G.; Giri, P.; Tasleem, M.; Kumar, A. MAPK Signaling Cascades and Transcriptional Reprogramming in Plant–Pathogen Interactions. In Approaches to Plant Stress and Their Management; Gaur, R., Sharma, P., Eds.; Springer: New, Delhi, India, 2014; pp. 297–316. [Google Scholar] [CrossRef]
  58. Vidhyasekaran, P. Mitogen-Activated Protein Kinase Cascades in Plant Innate Immunity. In PAMP Signals in Plant Innate Immunity. Signaling and Communication in Plants; Springer: Dordrecht, The Netherlands, 2014; pp. 331–374. [Google Scholar] [CrossRef]
  59. Thulasi, K.; Li, X.; Zhang, Y. MAP kinase signalling: Interplays between plant PAMP- and effector-triggered immunity. Cell. Mol. Life Sci. 2018, 75, 2981–2989. [Google Scholar] [CrossRef]
  60. Vï, R.; Kim, S.K.; Mi, J.; Mariappan, K.G.; Siodmak, A.; Al-Babili, S.; Hirt, H. A Chimeric IDD4 Repressor Constitutively Induces Immunity in Arabidopsis via the Modulation of Salicylic Acid and Jasmonic Acid Homeostasis. Plant Cell Physiol. 2019, 60, 1536–1555. [Google Scholar] [CrossRef] [PubMed]
  61. Erokhin, M.; Vassetzky, Y.; Georgiev, P.; Chetverina, D. Eukaryotic enhancers: Common features, regulation, and participation in diseases. Cell Mol. Life Sci. 2015, 72, 2361–2375. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  62. Nostro, A.; Papalia, T. Antimicrobial activity of carvacrol: Current progress and future prospectives. Recent Pat. Anti Infect. Drug Discov. 2012, 7, 28–35. [Google Scholar] [CrossRef] [PubMed]
  63. Schoenfelder, S.; Fraser, P. Long-range enhancer-promoter contacts in gene expression control. Nat. Rev. Genet. 2019, 20, 437–455. [Google Scholar] [CrossRef]
Horticulturae 10 00940 g001
Figure 1. Effects of different doses of 60Co-γ radiation on the physiological and biochemical indicators of XL210 and XL1. (A–D) SOD and POD activities and MDA and TF contents in XL210. (E–H) SOD and POD activities and MDA and TF contents in XL1. Different letters indicate significant differences between the group means. Red represents the ‘XL210’, and blue represents ‘XL1’, with varying shades indicating different radiation doses. Error bars are expressed as mean ± SD.
Figure 1. Effects of different doses of 60Co-γ radiation on the physiological and biochemical indicators of XL210 and XL1. (A–D) SOD and POD activities and MDA and TF contents in XL210. (E–H) SOD and POD activities and MDA and TF contents in XL1. Different letters indicate significant differences between the group means. Red represents the ‘XL210’, and blue represents ‘XL1’, with varying shades indicating different radiation doses. Error bars are expressed as mean ± SD.
Horticulturae 10 00940 g001
Horticulturae 10 00940 g002
Figure 2. Lesion diameters of XL210 (A) and XL1 (B) in different radiation groups 7 days after C. gloeosporioides inoculation. * indicates a significant difference compared to 0 Gy (p < 0.05). Different letters indicate significant differences between the group means. Red represents the ‘XL210’, and blue represents ‘XL1’, with varying shades indicating different radiation doses. Error bars are expressed as mean ± SD.
Figure 2. Lesion diameters of XL210 (A) and XL1 (B) in different radiation groups 7 days after C. gloeosporioides inoculation. * indicates a significant difference compared to 0 Gy (p < 0.05). Different letters indicate significant differences between the group means. Red represents the ‘XL210’, and blue represents ‘XL1’, with varying shades indicating different radiation doses. Error bars are expressed as mean ± SD.
Horticulturae 10 00940 g002
Horticulturae 10 00940 g003
Figure 3. Representative images of XL210 (A) and XL1. (B) plants with differing disease resistance. (C) lesion diameters of individual plants with varying resistance 7 days after C. gloeosporioides inoculation. A0 and B0 represent the wild types (WT) of XL210 and XL1, respectively. Scale bar = 1 cm. (Red represents the ‘XL210’, and blue represents ‘XL1’, with different shades used to distinguish between control, resistant mutants, and susceptible mutants). Error bars are expressed as mean ± SD.
Figure 3. Representative images of XL210 (A) and XL1. (B) plants with differing disease resistance. (C) lesion diameters of individual plants with varying resistance 7 days after C. gloeosporioides inoculation. A0 and B0 represent the wild types (WT) of XL210 and XL1, respectively. Scale bar = 1 cm. (Red represents the ‘XL210’, and blue represents ‘XL1’, with different shades used to distinguish between control, resistant mutants, and susceptible mutants). Error bars are expressed as mean ± SD.
Horticulturae 10 00940 g003
Horticulturae 10 00940 g004
Figure 4. Changes in SOD (A) and POD (B) in different germplasms before and after inoculation and their fold increases (red line). Different letters indicate significant differences between the means before and after inoculation. Error bars are expressed as mean ± SD.
Figure 4. Changes in SOD (A) and POD (B) in different germplasms before and after inoculation and their fold increases (red line). Different letters indicate significant differences between the means before and after inoculation. Error bars are expressed as mean ± SD.
Horticulturae 10 00940 g004
Horticulturae 10 00940 g005
Figure 5. Relative expression levels of CoSOD1 (A) and CoPOD (B) in germplasms with different disease resistance. * indicates a significant difference in relative gene expression between different mutants and the wild type. (Red represents the ‘XL210’, and blue represents ‘XL1’, with different shades used to distinguish between control, resistant mutants, and susceptible mutants). Error bars are expressed as mean ± SD.
Figure 5. Relative expression levels of CoSOD1 (A) and CoPOD (B) in germplasms with different disease resistance. * indicates a significant difference in relative gene expression between different mutants and the wild type. (Red represents the ‘XL210’, and blue represents ‘XL1’, with different shades used to distinguish between control, resistant mutants, and susceptible mutants). Error bars are expressed as mean ± SD.
Horticulturae 10 00940 g005
Horticulturae 10 00940 g006
Figure 6. Relative expression levels of CoIDD4 (A) and CoWRKY78 (B) in germplasms with different disease resistance. * indicates a significant difference in relative gene expression between different mutants and the wild type. (Red represents the ‘XL210’, and blue represents ‘XL1’, with different shades used to distinguish between control, resistant mutants, and susceptible mutants.) Error bars are expressed as mean ± SD.
Figure 6. Relative expression levels of CoIDD4 (A) and CoWRKY78 (B) in germplasms with different disease resistance. * indicates a significant difference in relative gene expression between different mutants and the wild type. (Red represents the ‘XL210’, and blue represents ‘XL1’, with different shades used to distinguish between control, resistant mutants, and susceptible mutants.) Error bars are expressed as mean ± SD.
Horticulturae 10 00940 g006
Horticulturae 10 00940 g007
Figure 7. Correlation coefficient plot showing the relationships between lesion diameter, SOD, and POD activities and the relative expression levels of related genes (CoSOD1, CoPOD, CoIDD4, CoWRKY78) 120 h after C. gloeosporioides inoculation. Gene names represent the relative expression levels. * and ** indicate significant correlations at p < 0.05 and highly significant correlations at p < 0.01, respectively.
Figure 7. Correlation coefficient plot showing the relationships between lesion diameter, SOD, and POD activities and the relative expression levels of related genes (CoSOD1, CoPOD, CoIDD4, CoWRKY78) 120 h after C. gloeosporioides inoculation. Gene names represent the relative expression levels. * and ** indicate significant correlations at p < 0.05 and highly significant correlations at p < 0.01, respectively.
Horticulturae 10 00940 g007
Table 1. Primers used for qRT-PCR.
Table 1. Primers used for qRT-PCR.
GeneForward Primer (5′-3′)Reverse Primer (5′-3′)
CoGAPDHCAGGTCGAGCATCTTTGATTCCCCACCAACTTAACAAAGAAATCATTC
CoSOD1TCAGTGGCACCGTACACTTCTTAAGCCCAGAGACGCTTCC
CoPODTCATACATTCGGACGGGCTGAGTTGTAAAGGCGTGGGGTC
CoIDD4AACACGAAAGCCTCCCACCAGCAGGAGAAGTGGCATTGGC
CoWRKY78GGTCCTACTCAACTTCGGTTCGGTAGTGGTGGTTGGGAAATA
Table 2. Effects of different doses of 60Co-γ radiation on the relative germination percentage and relative mortality rate of XL210 and XL1. Different letters indicate significant differences between the various radiation groups (p < 0.05).
Table 2. Effects of different doses of 60Co-γ radiation on the relative germination percentage and relative mortality rate of XL210 and XL1. Different letters indicate significant differences between the various radiation groups (p < 0.05).
VarietyRadiation Dose (Gy)Relative Emergence Percentage Relative Mortality Percentage
XL2100100% a0 d
3075.78% b24.22% c
509.09% c90.91% b
801.28% d98.72% a
XL10100% a0 c
3030.80% b69.20% b
5029.93% b70.07% b
802.53% c97.47% a
Table 3. Lesion diameters of different germplasms 7 days after C. gloeosporioides inoculation (data presented as mean ± SD). Rindicates resistant varieties, Sindicates susceptible varieties, and * indicates a significant difference compared to the control group (p < 0.05).
Table 3. Lesion diameters of different germplasms 7 days after C. gloeosporioides inoculation (data presented as mean ± SD). Rindicates resistant varieties, Sindicates susceptible varieties, and * indicates a significant difference compared to the control group (p < 0.05).
Sample
(Variety, Dosage)		Diameters of Lesion (mm)Resistance
A0 (XL210, 0 Gy)5.06 ± 0.36/
A3 (XL210, 80 Gy)3.11 ± 0.26 *R
A8 (XL210, 50 Gy)3.15 ± 0.22 *R
A10 (XL210, 50 Gy)2.95 ± 0.35 *R
A19 (XL210, 50 Gy)2.97 ± 0.21 *R
A21 (XL210, 50 Gy)2.95 ± 0.23 *R
A32 (XL210, 30 Gy)2.96 ± 0.16 *R
A35 (XL210, 30 Gy)3.16 ± 0.33 *R
A4 (XL210, 80 Gy)7.07 ± 0.54 *S
B0 (XL1, 0 Gy)4.99 ± 0.32/
B17 (XL1, 50 Gy)3.21 ± 0.35 *R
B15 (XL1, 50 Gy)8.03 ± 1.01 *S
B27 (XL1, 30 Gy)7.84 ± 1.14 *S
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shen, J.; Xun, C.; Ma, X.; Zhang, Y.; Zhang, Z.; He, Z.; He, Y.; Yang, D.; Lai, H.; Wang, R.; et al. Screening 60Co-γ Irradiated Camellia oleifera Lines for Anthracnose-Resistant. Horticulturae 2024, 10, 940. https://doi.org/10.3390/horticulturae10090940

AMA Style

Shen J, Xun C, Ma X, Zhang Y, Zhang Z, He Z, He Y, Yang D, Lai H, Wang R, et al. Screening 60Co-γ Irradiated Camellia oleifera Lines for Anthracnose-Resistant. Horticulturae. 2024; 10(9):940. https://doi.org/10.3390/horticulturae10090940

Chicago/Turabian Style

Shen, Jiancai, Chengfeng Xun, Xiaofan Ma, Ying Zhang, Zhen Zhang, Zhilong He, Yimin He, Dayu Yang, Hanggui Lai, Rui Wang, and et al. 2024. "Screening 60Co-γ Irradiated Camellia oleifera Lines for Anthracnose-Resistant" Horticulturae 10, no. 9: 940. https://doi.org/10.3390/horticulturae10090940

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop