Next Article in Journal
Lavender Breeding for Winter Hardiness in a Temperate Climate
Previous Article in Journal
Plant Probiotic Potential of Native Rhizobia to Enhance Growth and Sugar Content in Agave tequilana Weber var. Blue
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 11
Issue 2
10.3390/horticulturae11020138
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Analysis of the ABCB Family and Its Expression in Adventitious Root Development of Paeonia ostii

by
Wenqian Shang
1,2,†,
Can Cui
1,†,
Xi Liu
1,
Weihao Meng
1,
Yongjie Qiu
1,
Yuke Sun
1,
Yuxiao Shen
1,
Weichao Liu
1,
Zheng Wang
1,
Songlin He
1,
Yinglong Song
1,3,* and
Liyun Shi
1,*
1
College of Landscape Architecture and Art, Henan Agricultural University, Zhengzhou 450002, China
2
Shanghai Key Laboratory of Plant Functional Genomics and Resources, Shanghai Chenshan Botanical Garden, Shanghai 201602, China
3
Postdoctoral Innovation Practice Base, Henan Institute of Science and Technology, Xinxiang 453003, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Horticulturae 2025, 11(2), 138; https://doi.org/10.3390/horticulturae11020138
Submission received: 12 December 2024 / Revised: 26 January 2025 / Accepted: 27 January 2025 / Published: 28 January 2025
(This article belongs to the Section Genetics, Genomics, Breeding, and Biotechnology (G2B2))
Browse Figures
Versions Notes

Abstract

:
Tree peony (Paeonia ostii T. Hong et J. X. Zhang) is an important medicinal and ornamental plant. It would be useful to propagate this plant in tissue culture, but it is difficult to induce root formation. Auxin plays a pivotal role in adventitious root formation, and ABCB transporter proteins are involved in auxin transport. To elucidate the function of the ABCB transporter family in P. ostii, we identified members of the ABCB gene family in the P. ostii genome and analyzed the functional characteristics of the putative proteins. In total, 29 ABCB genes were identified in P.ostii, distributed on five chromosomes. In a phylogenetic analysis, the PoABCBs were grouped into four subfamilies, with the largest being Subfamily I, characterized by their MDR structure. PoABCB genes in the same subfamily exhibited similar intron/exon arrangements and motif composition. The promoters of PoABCBs contained cis-acting elements associated with the photoresponse and hormone signaling. qRT-PCR analyses showed that, after treatment of tissue-cultured P. ostii seedlings with auxin, five PoABCB gene family members (PoABCB6, PoABCB10, PoABCB11, PoABCB12, and PoABCB16) were significantly upregulated during adventitious root development. These genes may play roles in the auxin response and adventitious root development of P. ostii in vitro.

1. Introduction

Tree peony (Paeonia ostii T. Hong et J. X. Zhang), a member of the genus Paeonomia, is a perennial deciduous shrub that is valued as both an ornamental and medicinal plant. It holds significant historical and cultural importance in China, although it is now distributed around the world. The shrub’s long reproductive cycle and low propagation rate have consistently posed significant challenges to its cultivation and commercial use [1]. Tissue culture techniques are widely used in propagation, and in accelerating breeding and shortening the growth cycle. Thus, they represent a critical step toward the industrialization of tree peony. However, it is very difficult to induce adventitious roots to form from tree peony materials, and this is one of the main problems restricting tissue culture of this species.
The main factors influencing adventitious root development include explant type, medium composition, and plant growth regulators, with indole-3-acetic acid (IAA) identified as a central regulator of this process. The concentration, duration of IAA exposure, and its accumulation and maintenance at specific sites significantly impact the formation of adventitious roots in plants [2,3], including tree peony [4]. The synthesis, transport, and signal transduction of IAA influence endogenous IAA levels, thereby affecting the formation of adventitious roots in plants. Intercellular IAA transport is mediated by three families of membrane-binding protein carriers: the ABCB subfamily within the ABC transporter family, the PIN family, and the AUX/LAX family. Members of the PIN and ABCB families are mainly efflux proteins, whereas members of the AUX/LAX family are influx proteins [5,6]. Among these, the ABCB family plays a pivotal role in auxin transport [7,8,9,10].
The ABC transporter family is one of the largest known protein families. These proteins are termed adenosine triphosphate-binding cassette (ABC) transporters because their structure contains ATP-binding domains and they transport substances using the energy released from ATP hydrolysis. The ABC transporter family is more extensive in plants than in other organisms. To date, 130 ABC transporters have been identified in Arabidopsis thaliana [11] and 125 in rice [12], spanning eight subfamilies (ABCA, B, C, D, E, F, G, and I). A. thaliana contains 28 members of the ABCB subfamily. Members of the ABC family consist of two key domains: a highly hydrophobic transmembrane domain (TMD) and a peripheral ATP-binding domain, also referred to as a nucleotide-binding fold (NBF) [13]. Based on structural characteristics, these eight subfamilies can be grouped into three categories: whole-molecule transporters (MDRs), semi-molecule transporters, and soluble transporters [14]. Previous studies have shown that ABC transporters contribute to plant growth and development by facilitating the transport of plant hormones, particularly during physiological processes such as phototropism, geotropism, organogenesis, and heavy metal transport [15,16,17,18].
Members of the ABCB subfamily are either MDRs containing two NBDs and two TMDs, or semi-molecule transporters (ATMs, TAPs) composed of a single NBD and TMD. This subfamily plays a vital role in indole-3-acetic acid (IAA) transport. In A. thaliana, AtABCB21 regulates auxin levels in cotyledons, leaves, and periroots [19]. AtABCB28 and AtABCB29 synergistically export IAA from the chloroplast envelope to the cytosol, regulating stomatal dynamics and significantly enhancing water-use efficiency and the survival rate under salt and drought stress [20]. AtABCB19 promotes IAA accumulation in the hypocotyl, thereby stimulating the formation of adventitious roots [21].
The ABCB family genes in the tree peony genome have not been characterized in detail, and no previous studies have explored their role in adventitious root formation. Therefore, based on the P. ostii genome [22], we identified members of the ABCB transporter family in P. ostii through a genome-wide analysis, and systematically analyzed their gene structure, evolutionary relationships, and promoter cis-acting elements. The physicochemical properties of the putative proteins were analyzed. In addition, the transcriptional profiles of PoABCBs during the formation of adventitious organs under IAA treatment were determined. The results of this study provide a theoretical foundation for further systematic studies on the role of the ABCB transporter family in auxin transport and in adventitious root development.

2. Materials and Methods

2.1. PoABCB Gene Identification and Physicochemical Properties of the Putative Proteins

A total of 28 genes encoding putative ABCB transporters were retrieved from the A. thaliana TAIR database (https://www.arabidopsis.org/, accessed on 15 October 2024). The conserved structural domains of ABC transporters, namely PF00005 and PF00064, were selected from the Pfam database (http://pfam-legacy.xfam.org, accessed on 15 October 2024) for analysis [23,24]. Homologous proteins encoded by genes in the P. ostii genome [22] were screened using TBtools-ll (v2.149) software to identify candidate ABCB transporter-encoding genes. Pfam, NCBI batch CDD (https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi, accessed on 15 October 2024) and MEME (https://meme-suite.org/meme/, accessed on 15 October 2024) were used to verify the genes identified by the above three methods. Genes with e value >1E-16, short sequences, and incomplete structures were excluded. A total of 29 PoABCB family genes were finally obtained [25]. The relative molecular weights and isoelectric points of the putative ABCB transporters were analyzed using ExPASy ProtParam (https://web.expasy.org/protparam/, accessed on 18 October 2024) [26]. TMHMM (https://services.healthtech.dtu.dk/services/TMHMM-2.0/, accessed on 18 October 2024) was used to predict transmembrane regions in the putative protein sequences. WoLF PSORT (https://wolfpsort.hgc.jp/, accessed on 18 October 2024) was used to predict subcellular localization and to perform statistical evaluation [27].

2.2. Phylogenetic Analysis

MEGA11 software [28] was used to conduct ClustalW analysis on the sequences of the identified ABCB transporter family members. The phylogenetic trees of the ABCB transporter family members from peony and A. thaliana were constructed using the neighbor-joining (NJ) method with the bootstrap value set to 1000. In addition, PoABCB proteins were classified according to the previously published grouping method [29,30]. The phylogenetic tree was visualized and refined using the online tool ITOL (https://itol.embl.de/, accessed on 20 October 2024) [31].

2.3. Analysis of Conserved Motif and Gene Structure

The ABCB transporter sequences of tree peony were submitted to the MEME website for conserved motif prediction, with the number of motifs set to eight. The results were analyzed using NCBI batch CDD and integrated with the peony genome GFF file using TBtools for visualization.

2.4. Cis-Acting Element Analysis

TBtools was used in conjunction with the screened tree peony ABCB family genes to extract the promoter sequence (2000 bp upstream of the ATG start codon) of each gene. The extracted promoter sequences were submitted to the PlantCARE database (https://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 25 October 2024) for analysis [32]. TBtools was also employed to visualize and predict various regulatory elements, such as hormone regulatory elements and those related to growth, development, or stress responses. The cis-acting elements within this family were categorized based on their functional attributes, drawing upon relevant literature [33,34].

2.5. Chromosome Localization and Collinearity Analysis

Based on the genomic information for tree peony, the chromosomal locations of 29 PoABCB transporters were extracted and screened. TBtools was employed to visualize the chromosomal locations of the PoABCB transporter gene family, analyze their distribution, and rename the genes based on their order along the chromosomes [35]. Genome data and gene structure files (GFF3 format) for A. thaliana and Vitis vinifera were obtained from Ensembl Plants (https://plants.ensembl.org/index.html, accessed on 10 October 2024)). The collinearity analysis was performed using TBtools.

2.6. Analysis of Transcript Profiles of the PoABCB Gene Family During Adventitious Root Induction

Scale buds of P. ostii were collected from the Luoning tree peony planting base in Luoyang City, China. Healthy and full-scale buds of the same size were collected from P. ostii as explants. The explants were sterilized (disinfection methods: immersion in alcohol for 30 s, sterile water for 2 min, then 0.1% NaClO for 8 min, a total of three times) and transferred to an induction medium with the following composition: Murishige and Skoog medium (MS) + woody plant medium (WPM) (Ca2+) + 6-benzylaminopurine (6-BA) 0.5 mg/L + indole-3-butyric acid (IBA) 0.5 mg/L + polyvinyl pyrrolidone (PVP) 1 g/L + sucrose 30 g/L + agar 7 g/L (pH = 5.85), and cultured for 30 d. Following the induction stage, explants were transferred to a proliferation medium with the following composition: MS + WPM (Ca2+) + 6-BA 2 mg/L + 1-naphthaleneacetic acid (NAA) 0.2 mg/L + ascorbic acid 50 mg/L + LH 0.5 g/L + PVP 1 g/L + sucrose 30 g/L + agar 7 g/L (pH = 5.85). After two rounds of proliferation culture, uniformly grown test-tube seedlings were selected as experimental materials.
Our research has demonstrated that the critical period for adventitious root induction in peony test tube seedlings is between 3 and 5 d and exogenous application of indole-3-acetic acid (IAA) promotes the formation of root primordia [36]. Therefore, 4 mg/L of IAA was added to the WPM basal medium to induce rooting. The stem base of the test tube seedlings was sampled at 0, 3, 5, and 10 d, with the 0 d sample serving as the control. This experiment was conducted with three biological replicates. The culture conditions were maintained at a temperature of 23 °C ± 1 °C, a light intensity of 36 μmol·m−2·s−1, and a photoperiod of 12 h·d−1. Stem base samples were collected at 0, 3, 5, and 10 d, frozen in liquid nitrogen, and stored at −80 °C until analysis. The samples were ground in liquid nitrogen and then RNA was extracted using an RNA extraction kit (Beijing Huatuanyang Biotechnology Co., Ltd., Beijing, China). Reverse transcription was performed with the Evo M-MLV reverse transcription kit (Accurate Biotechnology Co., Ltd., Hunan, China). Using P. ostii Tubulin as the internal reference gene (primer sequence shown in Annex 1), qRT-PCR was conducted using a SYBR Green Premix Pro TaqHS qPCR Kit II (Rox Plus) (Accurate Biotechnology Ltd.) to determine the transcript levels of PoABCBs (primer sequences shown in Appendix A Table A1). These analyses were conducted with three biological repeats and three technical repeats. The relative transcript levels of the genes were calculated using the 2–∆∆Ct method [37]. GraphPad Prism 8 (8. 0. 2)software was used for analysis and mapping, and one-way ANOVA was used to analyze and compare the relative transcript levels of tree peony ABCB family genes between the treatment group (4 mg/L IAA, at 3 d, 5 d, 10 d) and the control group (0 d).

3. Results

3.1. Identification of PoABCBs and Physicochemical Properties of the Putative Proteins

A total of 29 ABCB transporter family genes were identified from the P. otii genome. Their putative protein sequences exhibited significant variability, with amino acid lengths ranging from 622 amino acids (aa) (PoABCB12) to 1402 aa (PoABCB27). Eight genes encoded polypeptides with fewer than 1000 aa, while the remaining 21 genes encoded polypeptides of approximately 1200–1500 aa. The relative molecular weight ranged from 67,221.6 to 148,998.75, with an average of 123,326.2479. The isoelectric points ranged from 5.89 to 9.55, with an average of 8.08. The subcellular localization predictions indicated that PoABCB15 predominantly localized in the nucleus; PoABCB2 and PoABCB7 were located in chloroplasts, thylakoid cavities, or the plasma membrane, and the majority of other PoABCB family members were primarily located in the plasma membrane (Table 1). All PoABCB proteins were predicted to contain transmembrane domains, with the number of domains varying from 2 to 12 depending on the gene. Specifically, the PoABCB transporter family contained seven proteins with five or fewer transmembrane domains, and 22 proteins with 5 to 12 transmembrane domains. Among them, PoABCB7 had at least two transmembrane domains, PoABCB2 and PoABCB24 had three, and PoABCB1, PoABCB18, and PoABCB27 had the maximum of twelve (Figure 1).

3.2. PoABCB Phylogenetic Analysis

To further explore the evolutionary relationships, a phylogenetic tree was constructed using sequences of ABCB transporters from A. thaliana and tree peony. This analysis divided the ABCB transporters into four groups. Group I contained twenty-three MDR-type PoABCB transporters, Group II included four TAP-type transporters, Group III consisted of one ATM protein, and Group IV contained one LLP protein. Members of Group IV had a single ABC transporter domain and one transmembrane domain. Aside from PoABCB3, PoABCB8, PoABCB24, and PoABCB26 in Group II, PoABCB2 in Group III, and PoABCB7 in Group IV, all other PoABCB genes in tree peony were classified into Group I (Figure 2).

3.3. Analysis of PoABCB Gene Structure and Conserved Motifs

By integrating phylogenetic trees conserved domains, and conserved motif data, the gene structure and evolutionary relationships among members of the PoABCB gene family were further elucidated (Figure 3). The number of introns in the PoABCB gene family in tree peony ranged from 6 to 22. Among these, the number of introns in Groups I and II are relatively small, ranging from 6 to 13, whereas Groups III and IV have a larger and longer range, from 15 to 22. Notably, PoABCB8 had the highest number of introns of 22. The conserved motifs of PoABCB family proteins were analyzed, and the results revealed eight classes (Motif 1 to Motif 8). There were 10 motifs in members of Group I. Except PoABCB12 and PoABCB23, the other members of Group I had two copies of Motif 2, Motif 5, Motif 6 and Motif 8. These four motifs appeared most frequently in all genes. Genes in Groups II–IV had different conserved motifs, with only five or six types of conserved motifs per gene and each one present as a single copy.

3.4. PoABCB Cis-Acting Element Analysis

The 2000 bp promoter region upstream of the ATG start site was obtained for all the PoABCB genes. Analyses of these sequences identified 50 functional cis-acting elements, primarily linked to plant growth, hormone responses, and stress adaptation. The numbers of cis-acting elements with particular functional classifications are shown in figure (Figure 4). Among the cis-acting elements related to plant growth and development, 24 light-responsive elements (e.g., ACE, G-box, GT1-motif, Sp1) were identified, accounting for approximately 50% of the total (Figure 5). Cis-acting elements associated with hormones ranked second, encompassing (10 elements), including auxin response elements (e.g., TGA-element, AuxRR-core), methyl jasmonate response elements (e.g., TGACG-motif, CGTCA-motif), abscisic acid response elements (ABREs), gibberellin response elements (e.g., P-box, TATC-box, GARE-motif), and salicylic acid response element (TCA-element). Among the hormone-related cis-acting elements in the PoABCB family, the most abundant responsive elements were observed for abscisic acid with 24 identified and methyl jasmonate with 20 identified. IAA response elements were the third most abundant group, with 18 identified; PoABCB3 and PoABCB6 each contained 3, PoABCB10 contained 2, and the remaining genes each contained 1. Additional cis-acting elements included TC-rich repeats, low temperature response (LTR) elements, and MYB binding site (MBS) elements that participate in the binding of the drought-induced MYB transcription factor.

3.5. Locations of PoABCBs on Chromosomes

The locations of the 29 ABCB transporters genes on the chromosomes of the tree peony genome were determined. Genes encoding members of the ABCB protein family were distributed across all five chromosomes. The genes were named PoABCB1 to PoABCB29 according to their chromosomal location (Figure 6). Five genes (PoABCB1–PoABCB5) were located on chromosome 1, four genes (PoABCB6–PoABCB9) on chromosome 2, nine genes (PoABCB10–PoABCB18) on chromosome 3, seven genes (PoABCB19–PoABCB25) on chromosome 4, and four genes (PoABCB26–PoABCB29) on chromosome 5. The genes were generally evenly distributed across the five chromosomes.

3.6. PoABCB Collinearity Analysis

Collinearity analyses were conducted between the genomes of P. ostii, A. thaliana, and V. vinifera. The results showed that compared with A. thaliana, in P. ostia, five homologous PoABCB transporter genes were located on chromosomes 1, 2, 3, and 5, with two located on chromosome 3. Eighteen homologous genes were identified between the tree peony and grape genomes, distributed across five chromosomes in tree peony, with the largest number (five) located on chromosome 4 (Figure 7).
The homologous gene pairs between A. thaliana and tree peony are as follows: AT1G70610.1-PoABCB3, AT2G36910.1-PoABCB6, AT3G62150.2-PoABCB10, AT3G55320.1-PoABCB27 and AT4G01820.1-PoABCB10. The homologous gene pairs between grape and tree peony were as follows: Vitvi13g00252_t001-PoABCB27, Vitvi14g01858_t001-PoABCB22, Vitvi14g01859_t001-PoABCB23, Vitvi14g01696_t001-PoABCB24, Vitvi14g01928_t001-PoABCB19, Vitvi16g00936_t003-PoABCB26, Vitvi17g00485_t001-PoABCB8, Vitvi18g01148_t001-PoABCB9, Vitvi19g00429_t001-PoABCB25, Vitvi01g04143_t001-PoABCB4, Vitvi01g00650_t001-PoABCB3, Vitvi01g00863_t001-PoABCB22, Vitvi02g00726_t001-PoABCB1, Vitvi05g00261_t001-PoABCB16, Vitvi06g00831_t001-PoABCB2, Vitvi07g00534_t001-PoABCB10, Vitvi08g01448_t001-PoABCB7 and Vitvi10g00702_t001-PoABCB29.

3.7. Analysis of PoABCB Transcript Profiles at the Stem Base During Root Induction

A total of 29 ABCB family genes were identified in the P. ostii genome, and their relative transcript levels in the stem base of tree peony seedlings were analyzed during adventitious root formation under IAA treatment. The relative transcript levels of most genes in the PoABCB family of tree peony did not change significantly under this treatment (Figure 8a). However, those of PoABCB6, PoABCB10, PoABCB11, and PoABCB12 were significantly increased compared with their respective levels at 0d, reaching peak transcript abundance at 3 d, followed by a decreased level at days 5 and 10. The transcript level of PoABCB16 peaked at 3 d, decreased at 5 d, and then exhibited an increasing trend at 10 d (Figure 8b). These results suggest that these genes are closely associated with the formation of adventitious roots of tree peony plantlets in vitro.

4. Discussion

Adventitious root formation can be roughly divided into three stages: the induction phase, initiation phase, and extension phase [38,39]. Studies have shown that endogenous auxin is the key hormone in the process of adventitious root formation, and that exogenous auxin IAA regulates the formation of adventitious roots in all three stages of formation [40]. Studies on the adventitious root development pathway of cuttings from another woody plant, walnut, revealed that no significant histological changes occurred during the induction period (0–3 d). Cell division in the cambium was initiated between 3 and 6 d, coinciding with a significant increase in endogenous IAA levels during the early stage of adventitious root formation [41]. Our previous studies have shown that the critical period of adventitious root induction in tree peony seedlings in vitro is 3–5 d, and IAA accumulates at the sites of adventitious root formation and plays a key role in their induction [36]. ABCB transporters are an important subfamily of plant ABC transporters that are primarily involved in auxin synthesis and transport [42]. These ABCB transporters play a crucial role in diverse cellular processes in plants [43,44,45], so it is likely that they play roles in the formation of adventitious roots in tree peony.
In this study, 29 PoABCB transporter genes were identified from the genome of tree peony. Their number was comparable to the 28 identified in A. thaliana, 27 in rice, 31 in maize, and 30 in grape but was significantly lower than the 47 found in flax [46,47]. This suggests that, overall, the replication and loss of genes among different species exhibit a tendency towards stability [48]. However, evolutionary processes and functional adaptations may introduce certain variations. Our analyses indicate that the putative proteins in the PoABCB transporter family have a range of amino acid sequence lengths, isoelectric points, and relative molecular weight, with an average molecular weight of 123,326.25 Da. The average isoelectric point of 8.08 is comparable to that of ABCB family transporters in other species. Variations in amino acid sequence length and putative protein structure reflect evolutionary divergence within the PoABCB gene family. However, the retention and replication of genes across different species generally adhere to comparable evolutionary constraints [49].
Chromosome localization and phylogenetic analyses revealed that the PoABCB transporter gene family is distributed across five chromosomes in tree peony. Collinearity analysis revealed higher collinearity between the tree peony and grape genomes than between the tree peony and A. thaliana genomes. These differences may result from interspecific variations influencing genome structure and organization. Gene structural diversity, particularly the distribution of introns and exons, can provide insights into the phylogenetic relationships within gene families. Our analyses show that the number of introns in PoABCB family genes ranges from 6 to 22, and the intron/exon structures are similar within each subfamily. The phylogenetic and conserved motif analyses classified PoABCB proteins into four distinct classes, with the majority being MDR-type PoABCB transporters. Previous studies have demonstrated that the MDR-type PoABCB transporters are responsible for transporting a range of substrates, including lipoproteins, fungicides, peptides, cell surface components, and auxins [50,51,52]. This suggests that the PoABCB transporter family may be crucial for auxin transport.
Multiple cis-acting elements in gene promoter regions are associated with tissue-specific gene expression and responses to various environmental signals [53]. Analyses of the 2000 bp PoABCB promoter regions revealed cis-acting elements that respond to light, hormones, low temperature and defense mechanisms, as well as drought and heat stress. These findings suggest that PoABCB transporters may play a role in mediating these physiological changes. Eighteen PoABCB genes contained cis-acting elements related to auxin, suggesting their potential involvement in auxin response. PoABCB3, PoABCB6, and PoABCB10 genes contain the highest number of auxin-related cis-acting elements, with PoABCB3 and PoABCB6 each containing three, and PoABCB10 containing two.
Phylogenetic analysis with A. thaliana revealed that PoABCB6 shares high homology with AtABCB1, while PoABCB10, PoABCB11, PoABCB12, and PoABCB16 are highly homologous to AtABCB4 and AtABCB21. Previous studies have shown that AtABCB19 and AtABCB1 have similar functions, particularly in exporting auxin into cells to promote hypocotyl elongation and establish auxin polarity transport [54,55,56]. AtABCB4 and AtABCB21 function in roots and leaves, and are involved in bidirectional auxin transport regulated by the auxin concentration: auxin is imported when it is present at low concentrations, and exported when it is present at high concentrations [57].
Tissue-specific expression analysis of PoABCB genes in the basal stem under IAA treatment provided insight into their transcriptional profiles at the tree peony plantlets stem base. We found that PoABCB6, PoABCB10, PoABCB11, PoABCB12, and PoABCB16, which exhibit high homology with A. thaliana AtABCB1, AtABCB4, and AtABCB21 and show relatively high expression levels during the process of adventitious root formation, showed significant increases in their relative expression levels over time under IAA treatment, compared to their respective levels in the 0 d control. We speculate that the upregulation of these genes by IAA treatment (4 mg/L) enhances the transport function of ABCB transporters and contributes to the development of adventitious roots of tree peony plantlets. Additionally, we observed similarities in gene transcript profiles within this subfamily, indicating potential functional redundancy and synergistic regulation among these genes. Auxin transport and polar transport are closely linked to the development of adventitious roots in plants [58,59]. Our results highlight the auxin-responsive expression of PoABCB6, PoABCB10, PoABCB11, PoABCB12, and PoABCB16 from the ABCB family in tree peony plantlets during adventitious root formation. This information will be useful for establishing strategies to improve the formation of adventitious roots in tree peony plantlets, which is essential for a successful tissue culture propagation system.

5. Conclusions

In this study, a total of 29 PoABCB transporters were identified from the tree peony genome family, named according to their positions on the chromosomes. The physicochemical properties of the putative proteins encoded by these genes were analyzed. The PoABCB transporters were categorized into four subfamilies, and the conserved domains and conserved motifs were found to be similar within each PoABCB gene subfamily. When in vitro tree peony plantlets were treated with IAA, the transcript levels of PoABCB6, PoABCB10, PoABCB11, PoABCB12, and PoABCB16 were significantly correlated with the development of adventitious roots. Thus, these genes may play a crucial role in regulating adventitious root development by participating in auxin (IAA)-mediated signaling. These findings provide valuable insights into the roles of the PoABCB gene family in the IAA response and in the development of adventitious roots of tissue-cultured tree peony. However, their specific mechanisms of action require further investigation.

Author Contributions

Study conception and design: S.H. and L.S.; data collection: C.C., W.S., X.L., W.M. and Y.S. (Yuxiao Shen); analysis and interpretation of results: C.C., Y.Q., Y.S. (Yuke Sun) and W.L.; draft manuscript preparation: W.S., C.C. and Z.W.; funding acquisition, W.S. and Y.S. (Yinglong Song). All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the Natural Science Foundation of China (Grant No. 32472788), The project was supported by Open Fund of Shanghai Key Laboratory of Plant Functional Genomics and Resources (Grant No. PFGR202403), the Natural Science Foundation of Henan (Grant No. 232102110200) and the Henan Province Key Scientific Research Projects of Colleges and Universities (Grant No. 24A220003, 25A220002).

Data Availability Statement

Data supporting the reported results will be available and provided upon request.

Conflicts of Interest

The authors declare no conflicts of interest.

Appendix A

Table A1. qRT-RCP Primer sequence (5′-3′).
Table A1. qRT-RCP Primer sequence (5′-3′).
qRT-RCP Primer NamePrimer Sequence (5′-3′)
Tubulin-FTGAGCACCAAAGAAGTGGACGAAC
Tubulin-RCACACGCCTGAACATCTCCTGAA
PoABCB1-FAAAACAAAGAAGAGAAGAAA
PoABCB1-RATAAAGAAGACTGGAACTGA
PoABCB2-FTCAAGTAAGGATGTAACCCC
PoABCB2-RTATCTTCCAACCATAAGTAT
PoABCB3-FATTTGGAGATTAAGTGGTTG
PoABCB3-RTGATAAGATGAAGTTGTGAG
PoABCB4-FGAGGTGGGGATTACTTCAAA
PoABCB4-RGGAGTCTGTGGAGTCTGGGC
PoABCB5-FGGAGATTCAGAAAAAAAACC
PoABCB5-RGCAACCTAAAGATCCCAGTG
PoABCB6-FAACATCACCTCCTTCAACAA
PoABCB6-RCCATCAAAACATAATCTAAC
PoABCB7-FGCGTTATCTCTGTCTACTCG
PoABCB7-RCTCCCAACACTAAACCCTCA
PoABCB8-FTGGAGGGAGAAAGAGAAACG
PoABCB8-RAGAATGCCAGAAGTGGATGC
PoABCB9-FGGACCAACCATCAAACTCAA
PoABCB9-RACCAATCCAAGATAAACCAA
PoABCB10-FAAGGGGGCAGAGGAGAAAAC
PoABCB10-RAGCACCTACTGAACCGACAA
PoABCB11-FTGCTCTGGCTGTATGGTATG
PoABCB11-RTGGTGTCCTGTTGATGGTCT
PoABCB12-FCTCATATAAATACGCAGGCA
PoABCB12-RAATCCATTCCCAATAGCACC
PoABCB13-FGGATGGTCACAGGAGAGAGA
PoABCB13-RCCACAAGAAGAGGAATAGAG
PoABCB14-FCGAGGAAAGATGATAGAAAG
PoABCB14-RGACAGATAATGAATCGGAGC
PoABCB15-FCTATTCATTCTGGAAAGACT
PoABCB15-RGACCCATCTGCTGCCTCAAC
PoABCB16-FGGGTGAGAAGGTTGGAAAGT
PoABCB16-RAGGGAAGATAGCATGACGAG
PoABCB17-FGTTCTGTTACCTCTTATGGG
PoABCB17-RGCTACTTGACTTGCTTCCTC
PoABCB18-FTCTTGATACCGAATCTGAAC
PoABCB18-RGACTCCATTTTTAACCACTG
PoABCB19-FGTGGACAGTATTGCAGTAGT
PoABCB19-RTGTGTGATGGTGTTGTAGCT
PoABCB20-FGTTCGCCTCCAACAAACAAA
PoABCB20-RATCCCTAACACCTTCACCGC
PoABCB21-FGAAGTGTTGTTATTGGACGA
PoABCB21-RGGCTAAGAGAGACGAGTGGT
PoABCB22-FGGAGCAGAAAACTACCACGA
PoABCB22-RATACAGCACCACAGGCATAG
PoABCB23-FTAGCGTAGTTGTGGCACATA
PoABCB23-RGCAGGTGTCCTTTGGAGTTT
PoABCB24-FATTATCCTCAATACCGCCCT
PoABCB24-RGTCTACCCTGAATCCCTCCA
PoABCB25-FACAGTGCCATTCAATCGGTT
PoABCB25-RGTTCTTCCTGCTTCTATCTT
PoABCB26-FTTTCAATCCCAACCACTGTC
PoABCB26-RTCTTCGGAGGAGCAAACCAG
PoABCB27-FGAAGGAAACAGAGGATACAG
PoABCB27-RGATAACATAAGCAAGGAGAG
PoABCB28-FGTTCCCCTCATTCTTCTCAT
PoABCB28-RCCCGTTCCAACTCCCTTTAT
PoABCB29-FGTAAGTGGGGAAGATAGTTA
PoABCB29-RAGCAGAAGTCCAAATAGAGG

References

  1. Wen, S.S.; Chen, L.; Tian, R.N. Micropropagation of tree peony (Paeonia sect. Moutan): A review. Plant Cell Tissue Organ Cult. 2020, 141, 1–14. [Google Scholar] [CrossRef]
  2. Almeida, M.R.D.; Bastiani, D.D.; Gaeta, M.L.; Mariath, J.E.D.A.; Costa, F.D.; Retallick, J.; Nolan, L.; Tai, H.H.; Strömvik, M.V.; Fett-Neto, A.G. Comparative transcriptional analysis provides new insights into the molecular basis of adventitious rooting recalcitrance in Eucalyptus. Plant Sci. 2015, 239, 155–165. [Google Scholar] [CrossRef] [PubMed]
  3. Costa, C.T.D.; Gaeta, M.L.; Mariath, J.E.D.A.; Offringa, R.; Fett-Neto, A.G. Comparative adventitious root development in pre-etiolated and flooded Arabidopsis hypocotyls exposed to different auxins. Plant Physiol. Biochem. 2018, 127, 161–168. [Google Scholar] [CrossRef]
  4. Liu, R.; Xue, Y.Q.; Ci, H.T.; Gao, J.; Wang, S.L.; Zhang, X.X. Establishment of highly efficient plant regeneration of Paeonia ostii ‘Fengdan’ through optimization of callus, adventitious shoot, and rooting induction. Hortic. Plant J. 2022, 8, 777–786. [Google Scholar] [CrossRef]
  5. Carraro, N.; Tisdale-Orr, T.E.; Clouse, R.M.; Knöller, A.S.; Spicer, R. Diversification and expression of the PIN, AUX/LAX, and ABCB families of putative auxin transporters in Populus. Front. Plant Sci. 2012, 3, 17. [Google Scholar] [CrossRef]
  6. Mellor, N.L.; Voß, U.; Ware, A.; Janes, G.; Barrack, D.; Bishopp, A.; Bennett, M.J.; Geisler, M.; Wells, D.M.; Band, L.R. Systems approaches reveal that ABCB and PIN proteins mediate co-dependent auxin efflux. Plant Cell 2022, 34, 2309–2327. [Google Scholar] [CrossRef]
  7. Kaneda, M.; Schuetz, M.; Lin, B.S.P.; Chanis, C.; Hamberger, B.; Western, T.L.; Ehlting, J.; Samuels, A.L. ABC transporters coordinately expressed during lignification of Arabidopsis stems include a set of ABCBs associated with auxin transport. J. Exp. Bot. 2011, 62, 2063–2077. [Google Scholar] [CrossRef]
  8. Wu, G.S.; Cameron, J.N.; Ljung, K.; Spalding, E.P. A role for ABCB19-mediated polar auxin transport in seedling photomorphogenesis mediated by cryptochrome 1 and phytochrome B. Plant J. 2010, 62, 179–191. [Google Scholar] [CrossRef]
  9. Hilleary, R. The sum is greater than the parts: Co-dependent auxin efflux is mediated by ABCBs and PINs. Plant Cell 2022, 34, 2114–2115. [Google Scholar] [CrossRef]
  10. Chen, J.; Hu, Y.J.; Hao, P.C.; Tsering, T.; Xia, J.; Zhang, Y.Q.; Roth, O.; Njo, M.F.; Sterck, L.; Hu, Y.; et al. ABCB-mediated shootward auxin transport feeds into the root clock. EMBO Rep. 2023, 24, e56271. [Google Scholar] [CrossRef]
  11. Jasinski, M.; Ducos, E.; Martinoia, E.; Boutry, M. The ATP-binding cassette transporters: Structure, function, and gene family comparison between rice and Arabidopsis. Plant Physiol. 2003, 131, 1169–1177. [Google Scholar] [CrossRef] [PubMed]
  12. Nguyen, V.N.T.; Moon, S.; Jung, K.-H. Genome-wide expression analysis of rice ABC transporter family across spatio-temporal samples and in response to abiotic stresses. J. Plant Physiol. 2014, 171, 1276–1288. [Google Scholar] [CrossRef] [PubMed]
  13. Theodoulou, F.L. Plant ABC transporters. Biochim. Biophys. Acta. 2000, 1465, 79–103. [Google Scholar] [CrossRef] [PubMed]
  14. Sánchez-Fernández, R.; Davies, T.G.; Coleman, J.O.; Rea, P.A. The Arabidopsis thaliana ABC protein superfamily, a complete inventory. J. Biol. Chem. 2001, 276, 30231–30244. [Google Scholar] [CrossRef]
  15. Kamimoto, Y.; Terasaka, K.; Hamamoto, M.; Takanashi, K.; Fukuda, S.; Shitan, N.; Sugiyama, A.; Suzuki, H.; Shibata, D.; Wang, B.; et al. Arabidopsis ABCB21 is a facultative auxin importer/exporter regulated by cytoplasmic auxin concentration. Plant Cell Physiol. 2012, 53, 2090–2100. [Google Scholar] [CrossRef] [PubMed]
  16. Hwang, J.-U.; Song, W.-Y.; Hong, D.; Ko, D.; Yamaoka, Y.; Jang, S.; Yim, S.; Lee, E.; Khare, D.; Kim, K.; et al. Plant ABC Transporters Enable Many Unique Aspects of a Terrestrial Plant’s Lifestyle. Mol. Plant 2016, 9, 338–355. [Google Scholar] [CrossRef]
  17. Dahuja, A.; Kumar, R.R.; Sakhare, A.; Watts, A.; Singh, B.; Goswami, S.; Sachdev, A.; Praveen, S. Role of ATP-binding cassette transporters in maintaining plant homeostasis under abiotic and biotic stresses. Physiol. Plant. 2021, 171, 785–801. [Google Scholar] [CrossRef]
  18. Geisler, M.M. Embracing substrate multispecificity in plant ABC transporters. Mol. Plant 2024, 17, 990–992. [Google Scholar] [CrossRef]
  19. Jenness, M.K.; Carraro, N.; Pritchard, C.A.; Murphy, A.S. Corrigendum: The Arabidopsis ATP-BINDING CASSETTE Transporter ABCB21 Regulates Auxin Levels in Cotyledons, the Root Pericycle, and Leaves. Front. Plant Sci. 2020, 11, 351. [Google Scholar] [CrossRef]
  20. Tamizhselvan, P.; Madhavan, S.; Constan-Aguilar, C.; Elrefaay, E.R.; Liu, J.; Pěnčík, A.; Novák, O.; Cairó, A.; Hrtyan, M.; Geisler, M.; et al. Chloroplast Auxin Efflux Mediated by ABCB28 and ABCB29 Fine-Tunes Salt and Drought Stress Responses in Arabidopsis. Plants 2023, 13, 7. [Google Scholar] [CrossRef]
  21. Sukumar, P.; Maloney, G.S.; Muday, G.K. Localized induction of the ATP-binding cassette B19 auxin transporter enhances adventitious root formation in Arabidopsis. Plant Physiol. 2013, 162, 1392–1405. [Google Scholar] [CrossRef] [PubMed]
  22. Yuan, J.H.; Jiang, S.J.; Jian, J.B.; Liu, M.Y.; Yue, Z.; Xu, J.B.; Li, J.; Xu, C.Y.; Lin, L.H.; Jing, Y.; et al. Genomic basis of the giga-chromosomes and giga-genome of tree peony Paeonia ostii. Nat. Commun. 2022, 13, 7328. [Google Scholar] [CrossRef] [PubMed]
  23. Su, A.; Ge, S.Y.; Zhou, B.Y.; Wang, Z.Y.; Zhou, L.P.; Zhang, Z.W.; Yan, X.Y.; Wang, Y.; Li, D.L.; Zhang, H.; et al. Analysis of the Tomato mTERF Gene Family and Study of the Stress Resistance Function of SLmTERF-13. Plants 2023, 12, 2862. [Google Scholar] [CrossRef]
  24. Zhang, D.D.; Yu, Z.F.; Zeng, B.; Liu, X.Y. Genome-wide analysis of the ABC gene family in almond and functional predictions during flower development, freezing stress, and salt stress. BMC Plant Biol. 2024, 24, 12. [Google Scholar] [CrossRef]
  25. Zhao, M.M.; Liu, Z.W.; Gan, J.T.; Yang, C.; Lu, A.; Han, Q.Q.; Yang, H.T.; Xu, Y.H.; Sun, G.L.; Wu, D.C. Identification and expression analysis of XIP gene family members in rice. Genetica 2024, 152, 83–100. [Google Scholar] [CrossRef]
  26. Zhang, S.; Hu, X.W.; Dong, J.J.; Du, M.X.; Song, J.Q.; Xu, S.Y.; Zhao, C.J. Identification, evolution, and expression analysis of OsBSK gene family in Oryza sativa Japonica. BMC Plant Biol. 2022, 22, 565. [Google Scholar] [CrossRef]
  27. Han, S.; Jiao, Z.Y.; Niu, M.X.; Yu, X.; Huang, M.B.; Liu, C.; Wang, H.L.; Zhou, Y.Y.; Mao, W.; Wang, X.F.; et al. Genome-Wide Comprehensive Analysis of the GASA Gene Family in Populus. Int. J. Mol. Sci. 2021, 22, 12336. [Google Scholar] [CrossRef]
  28. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  29. Que, F.; Zhu, Y.Q.; Liu, Q.N.; Wei, Q.; Ramakrishnan, M. Genome-Wide Identification, Expansion, Evolution, and Expression Analysis Reveals ABCB Genes Important for Secondary Cell Wall Development in Moso Bamboo (Phyllostachys edulis). Agronomy 2023, 13, 1828. [Google Scholar] [CrossRef]
  30. Ma, J.J.; Han, M.Y. Genomewide analysis of ABCBs with a focus on ABCB1 and ABCB19 in Malus domestica. J. Genet. 2016, 95, 141–149. [Google Scholar] [CrossRef]
  31. Tang, R.N.; Zhu, Y.J.; Yang, S.M.; Wang, F.; Chen, G.Z.; Chen, J.L.; Zhao, K.; Liu, Z.J.; Peng, D.H. Genome-Wide Identification and Analysis of WRKY Gene Family in Melastoma dodecandrum. Int. J. Mol. Sci. 2023, 24, 14904. [Google Scholar] [CrossRef] [PubMed]
  32. Xue, G.X.; Hu, L.F.; Zhu, L.M.; Chen, Y.; Qiu, C.; Fan, R.F.; Ma, X.X.; Cao, Z.J.; Chen, J.H.; Shi, J.S.; et al. Genome-Wide Identification and Expression Analysis of CCO Gene Family in Liriodendron chinense. Plants 2023, 12, 1975. [Google Scholar] [CrossRef]
  33. Chen, X.L.; Mo, F.L.; Shen, C.Y.; Meng, L.J.; Zou, Y.X.; Xue, X.P.; Cheng, M.Z.; Meng, F.Y.; Qi, H.N.; Wang, A.X. Genome-wide identification and expression analysis of the SlNAC gene family in tomato based on a high-quality genome. Hortic. Environ. Biotechnol. 2022, 63, 887–901. [Google Scholar] [CrossRef]
  34. Akram, J.; Siddique, R.; Shafiq, M.; Tabassum, B.; Manzoor, M.T.; Javed, M.A.; Anwar, S.; Nisa, B.U.; Saleem, M.H.; Javed, B.; et al. Genome-wide identification of CCO gene family in cucumber (Cucumis sativus) and its comparative analysis with A. thaliana. BMC Plant Biol. 2023, 23, 640. [Google Scholar] [CrossRef]
  35. Elsanosi, H.A.; Zhang, J.H.; Mostafa, S.; Geng, X.Y.; Zhou, G.S.; Awdelseid, A.H.M.; Song, L. Genome-wide identification, structural and gene expression analysis of BTB gene family in soybean. BMC Plant Biol. 2024, 24, 663. [Google Scholar] [CrossRef]
  36. Shang, W.Q.; Wang, Z.; He, S.L.; He, D.; Dong, N.L.; Guo, Y. Changes of endogenous IAA and related activities during rooting of Paeonia suffruticosa in vitro. J. Northwest Univ. (Nat. Sci. Ed.) 2021, 49, 129–136. [Google Scholar] [CrossRef]
  37. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  38. Itoh, J.; Nonomura, K.; Ikeda, K.; Yamaki, S.; Inukai, Y.; Yamagishi, H.; Kitano, H.; Nagato, Y. Rice plant development: From zygote to spikelet. Plant Cell Physiol. 2005, 46, 23–47. [Google Scholar] [CrossRef]
  39. Guan, L.; Murphy, A.S.; Peer, W.A.; Gan, L.J.; Li, Y.; Cheng, Z.M. Physiological and Molecular Regulation of Adventitious Root Formation. Crit. Rev. Plant Sci. 2015, 34, 506–521. [Google Scholar] [CrossRef]
  40. Frick, E.M.; Strader, L.C. Roles for IBA-derived auxin in plant development. J. Exp. Bot. 2018, 69, 169–177. [Google Scholar] [CrossRef]
  41. Song, X.B.; Huang, R.M.; Liu, H.; Zhang, J.; Chang, Y.Y.; Pei, D. Transcriptome profiling of indole-3-butyric acid–induced adventitious root formation in softwood cuttings of walnut. Hortic. Plant J. 2024, 10, 1336–1348. [Google Scholar] [CrossRef]
  42. Yang, C.H.; Wang, D.D.; Zhang, C.; Ye, M.H.; Kong, N.N.; Ma, H.L.; Chen, Q. Comprehensive Analysis and Expression Profiling of PIN, AUX/LAX, and ABCB Auxin Transporter Gene Families in Solanum tuberosum under Phytohormone Stimuli and Abiotic Stresses. Biology 2021, 10, 127. [Google Scholar] [CrossRef] [PubMed]
  43. Jenness, M.K.; Tayengwa, R.; Murphy, A.S. An ATP-binding cassette transporter, ABCB19, regulates leaf position and morphology during phototropin1-mediated blue light responses. Plant Physiol. 2020, 184, 1601–1612. [Google Scholar] [CrossRef]
  44. Nguyen, V.N.T.; Usman, B.; Kim, E.J.; Shim, S.H.; Jeon, J.S.; Jung, K.H. An ATP-binding cassette transporter, OsABCB24, is involved in female gametophyte development and early seed growth in rice. Physiol. Plant. 2024, 176, e14354. [Google Scholar] [CrossRef]
  45. Liu, W.X.; Feng, X.; Cao, F.B.; Wu, D.Z.; Zhang, G.P.; Vincze, E.; Wang, Y.Z.; Chen, Z.-H.; Wu, F.B. An ATP binding cassette transporter HvABCB25 confers aluminum detoxification in wild barley. J. Hazard. Mater. 2021, 401, 123371. [Google Scholar] [CrossRef]
  46. Khan, N.; You, F.M.; Datla, R.; Ravichandran, S.; Jia, B.; Cloutier, S. Genome-wide identification of ATP binding cassette (ABC) transporter and heavy metal associated (HMA) gene families in flax (Linum usitatissimum L.). BMC Genom. 2020, 21, 722. [Google Scholar] [CrossRef] [PubMed]
  47. Pang, K.Y.; Li, Y.J.; Liu, M.H.; Meng, Z.D.; Yu, Y.L. Inventory and general analysis of the ATP-binding cassette (ABC) gene superfamily in maize (Zea mays L.). Gene 2013, 526, 411–428. [Google Scholar] [CrossRef]
  48. Chen, J.; Hou, S.J.; Zhang, Q.Q.; Meng, J.Q.; Zhang, Y.Y.; Du, J.H.; Wang, C.; Liang, D.; Guo, Y.Q. Genome-Wide Identification and Analysis of the WRKY Gene Family in Asparagus officinalis. Genes 2023, 14, 1704. [Google Scholar] [CrossRef]
  49. Airoldi, C.A.; Davies, B. Gene Duplication and the Evolution of Plant MADS-box Transcription Factors. J. Genet. Genom. 2012, 39, 157–165. [Google Scholar] [CrossRef]
  50. Moons, A. Transcriptional profiling of the PDR gene family in rice roots in response to plant growth regulators, redox perturbations and weak organic acid stresses. Planta 2008, 229, 53–71. [Google Scholar] [CrossRef]
  51. Aslam, M.; Fakher, B.; Jakada, B.H.; Zhao, L.h.; Cao, S.J.; Cheng, Y.; Qin, Y. Genome-Wide Identification and Expression Profiling of CBL-CIPK Gene Family in Pineapple (Ananas comosus) and the Role of AcCBL1 in Abiotic and Biotic Stress Response. Biomolecules 2019, 9, 293. [Google Scholar] [CrossRef] [PubMed]
  52. Kim, D.Y.; Bovet, L.; Kushnir, S.; Noh, E.W.; Martinoia, E.; Lee, Y. AtATM3 is involved in heavy metal resistance in Arabidopsis. Plant Physiol. 2006, 140, 922–932. [Google Scholar] [CrossRef] [PubMed]
  53. Shen, C.; Li, X. Genome-wide identification and expression pattern profiling of the ATP-binding cassette gene family in tea plant (Camellia sinensis). Plant Physiol. Biochem. 2023, 202, 107930. [Google Scholar] [CrossRef]
  54. Tran, L.S.P.; Nakashima, K.; Sakuma, Y.; Osakabe, Y.; Qin, F.; Simpson, S.D.; Maruyama, K.; Fujita, Y.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Co-expression of the stress-inducible zinc finger homeodomain ZFHD1 and NAC transcription factors enhances expression of the ERD1 gene in Arabidopsis: ZFHD and NAC in drought stress response. Plant J. 2006, 49, 46–63. [Google Scholar] [CrossRef]
  55. Noh, B.; Murphy, A.S.; Spalding, E.P. Multidrug resistance–like genes of Arabidopsis required for auxin transport and auxin-mediated development. Plant Cell 2001, 13, 2441–2454. [Google Scholar] [CrossRef]
  56. Cho, M.; Henry, E.M.; Lewis, D.R.; Wu, G.; Muday, G.K.; Spalding, E.P. Block of ATP-binding cassette B19 ion channel activity by 5-nitro-2-(3-phenylpropylamino)-benzoic acid impairs polar auxin transport and root gravitropism. Plant Physiol. 2014, 166, 2091–2099. [Google Scholar] [CrossRef]
  57. Geisler, M.; Kolukisaoglu, H.U.; Bouchard, R.; Billion, K.; Berger, J.; Saal, B.; Frangne, N.; Koncz-Kalman, Z.; Koncz, C.; Dudler, R.; et al. TWISTED DWARF1, a unique plasma membrane-anchored immunophilin-like protein, interacts with Arabidopsis multidrug resistance-like transporters AtPGP1 and AtPGP19. Mol. Biol. Cell 2003, 14, 4238–4249. [Google Scholar] [CrossRef]
  58. Ganesan, M.; Kanimozhi, G.; Pradhapsingh, B.; Khan, H.A.; Alhomida, A.S.; Ekhzaimy, A.; Brindha, G.R.; Prasad, N.R. Phytochemicals reverse P-glycoprotein mediated multidrug resistance via signal transduction pathways. Biomed. Pharmacother. 2021, 139, 111632. [Google Scholar] [CrossRef]
  59. Geisler, M.; Dreyer, I. An auxin homeostat allows plant cells to establish and control defined transmembrane auxin gradients. New Phytol. 2024, 244, 1422–1436. [Google Scholar] [CrossRef]
Horticulturae 11 00138 g001
Figure 1. Transmembrane domains in members of the PoABCB family. Blue line represents interior; orange line represents exterior; purple line represents transmembrane region.
Figure 1. Transmembrane domains in members of the PoABCB family. Blue line represents interior; orange line represents exterior; purple line represents transmembrane region.
Horticulturae 11 00138 g001
Horticulturae 11 00138 g002
Figure 2. Phylogenetic tree of PoABCBs and AtABCBs. Red triangle indicates P. ostii; green star indicates A. thaliana. Different colors distinguish different subfamilies; purple, green, blue and pink indicate first, second, third, and fourth subgroups, respectively.
Figure 2. Phylogenetic tree of PoABCBs and AtABCBs. Red triangle indicates P. ostii; green star indicates A. thaliana. Different colors distinguish different subfamilies; purple, green, blue and pink indicate first, second, third, and fourth subgroups, respectively.
Horticulturae 11 00138 g002
Horticulturae 11 00138 g003
Figure 3. Conserved structure of PoABCB protein family. (a) Phylogenetic tree of PoABCB proteins, where different colors distinguish different subfamilies; purple, green, blue and pink indicate first, second, third, and fourth subgroups, respectively. (b) Motif pattern of PoABCB proteins, where the eight different colored rectangles represent the eight motifs, as shown in the upper right legend. (c) Homeodomains of PoABCB proteins, where the four colors represent the four homeodomains, as shown in the upper right legend. (d) Intron and exon structure of PoABCB genes, where green indicates UTR and yellow indicates CDS.
Figure 3. Conserved structure of PoABCB protein family. (a) Phylogenetic tree of PoABCB proteins, where different colors distinguish different subfamilies; purple, green, blue and pink indicate first, second, third, and fourth subgroups, respectively. (b) Motif pattern of PoABCB proteins, where the eight different colored rectangles represent the eight motifs, as shown in the upper right legend. (c) Homeodomains of PoABCB proteins, where the four colors represent the four homeodomains, as shown in the upper right legend. (d) Intron and exon structure of PoABCB genes, where green indicates UTR and yellow indicates CDS.
Horticulturae 11 00138 g003
Horticulturae 11 00138 g004
Figure 4. PoABCBs cis-acting elements and visualization of cis-acting elements in gene promoter regions.
Figure 4. PoABCBs cis-acting elements and visualization of cis-acting elements in gene promoter regions.
Horticulturae 11 00138 g004
Horticulturae 11 00138 g005
Figure 5. PoABCB cis-acting elements and numbers of different types of cis-acting elements. Differently colored horizontal lines separate types of cis-acting elements, where the dark purple line represents phytohormone, the blue line represents development, the light purple line represents stress and the gray line represents light. The numbers in the boxes represent the number of cis-acting elements.
Figure 5. PoABCB cis-acting elements and numbers of different types of cis-acting elements. Differently colored horizontal lines separate types of cis-acting elements, where the dark purple line represents phytohormone, the blue line represents development, the light purple line represents stress and the gray line represents light. The numbers in the boxes represent the number of cis-acting elements.
Horticulturae 11 00138 g005
Horticulturae 11 00138 g006
Figure 6. Chromosomal location of PoABCB genes. Depth of color in different parts of the chromosomes represents the gene density, with a gradient from blue to red indicating increasing gene density from low to high. Left axis denotes chromosome length.
Figure 6. Chromosomal location of PoABCB genes. Depth of color in different parts of the chromosomes represents the gene density, with a gradient from blue to red indicating increasing gene density from low to high. Left axis denotes chromosome length.
Horticulturae 11 00138 g006
Horticulturae 11 00138 g007
Figure 7. PoABCB collinearity analysis. Po, P. ostii; Vv, V. vinifera; At, A. thaliana. Blue lines indicate segmental duplicate gene pairs.
Figure 7. PoABCB collinearity analysis. Po, P. ostii; Vv, V. vinifera; At, A. thaliana. Blue lines indicate segmental duplicate gene pairs.
Horticulturae 11 00138 g007
Horticulturae 11 00138 g008
Figure 8. Transcript profiles of PoABCBs. (a) Relative transcript levels of PoABCBs; the transcription levels are represented in the legend at the top right, with a gradient from purple to red indicating increasing transcription levels from low to high. (b) Relative transcript levels of PoABCB6, PoABCB10, PoABCB11, PoABCB12 and PoABCB16. Plant materials were in vitro peony seedlings treated with 4 mg/L indole-3-acetic acid (IAA), and stem-base samples were collected at 0, 3, 5, and 10 d. Three replicates of each material were analyzed. Different colors represent relative transcript levels on different days. Asterisks indicate significance of differences between groups (one-way ANOVA).*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001.
Figure 8. Transcript profiles of PoABCBs. (a) Relative transcript levels of PoABCBs; the transcription levels are represented in the legend at the top right, with a gradient from purple to red indicating increasing transcription levels from low to high. (b) Relative transcript levels of PoABCB6, PoABCB10, PoABCB11, PoABCB12 and PoABCB16. Plant materials were in vitro peony seedlings treated with 4 mg/L indole-3-acetic acid (IAA), and stem-base samples were collected at 0, 3, 5, and 10 d. Three replicates of each material were analyzed. Different colors represent relative transcript levels on different days. Asterisks indicate significance of differences between groups (one-way ANOVA).*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001.
Horticulturae 11 00138 g008
Table 1. Physiological and biochemical characteristics of PoABCBs.
Table 1. Physiological and biochemical characteristics of PoABCBs.
Gene NameGene IDChromosome LocationNumber of Amino AcidsMolecular WeightpIPrediction of Subcellular Location
PoABCB1Pos.gene78377.mRNA-1Chr011304142,714.078.86plas: 13, vacu: 1
PoABCB2Pos.gene41311.mRNA-1Chr0177986,457.519.55chlo: 6, plas: 5, mito: 1, E.R.: 1, pero: 1
PoABCB3Pos.gene47973.mRNA-1Chr0170178,309.748.9plas: 10, chlo: 2, vacu: 1, E.R.: 1
PoABCB4Pos.gene39088.mRNA-1Chr011253136,897.239.16plas: 10, vacu: 2, cyto: 1, mito: 1
PoABCB5Pos.gene45213.mRNA-1Chr011243136,380.358.25plas: 13, vacu: 1
PoABCB6Pos.gene46182.mRNA-1Chr021364148,998.756.94plas: 13, vacu: 1
PoABCB7Pos.gene9826.mRNA-1Chr0265172,203.188.81chlo: 6, plas: 6, mito: 1, pero: 1
PoABCB8Pos.gene30683.mRNA-1Chr0278685,732.39.3plas: 11, E.R.: 2, chlo: 1
PoABCB9Pos.gene58376.mRNA-1Chr021245135,635.156.55plas: 13, vacu: 1
PoABCB10Pos.gene19693.mRNA-1Chr031308141,504.598.55plas: 7, vacu: 3, golg: 3, E.R.: 1
PoABCB11Pos.gene19692.mRNA-1Chr031290138,874.618.59plas: 8, golg: 3, vacu: 2, E.R.: 1
PoABCB12Pos.gene29825.mRNA-1Chr0362267,221.68.03plas: 8, vacu: 2, E.R.: 2, golg: 2
PoABCB13Pos.gene75380.mRNA-1Chr031282137,992.727.88plas: 7, vacu: 3, golg: 3, E.R.: 1
PoABCB14Pos.gene53906.mRNA-1Chr031323143,505.318.69plas: 13, E.R.: 1
PoABCB15Pos.gene49335.mRNA-1Chr031256135,594.196.67nucl: 12, extr: 2
PoABCB16Pos.gene17081.mRNA-1Chr031249135,727.458.04plas: 12, E.R.: 2
PoABCB17Pos.gene17082.mRNA-1Chr031326142,776.55.94plas: 13, vacu: 1
PoABCB18Pos.gene64555.mRNA-1Chr031266136,858.575.89plas: 13, vacu: 1
PoABCB19Pos.gene37878.mRNA-1Chr041296141,493.818.56plas: 13, vacu: 1
PoABCB20Pos.gene50382.mRNA-1Chr041296142,049.588.82plas: 5, E.R.: 5, chlo: 2, vacu: 1, pero: 1
PoABCB21Pos.gene70255.mRNA-1Chr041223133,110.28.42plas: 9, E.R.: 3, chlo: 1, mito: 1
PoABCB22Pos.gene83054.mRNA-1Chr041249136,140.87.99plas: 9, E.R.: 3, chlo: 1, vacu: 1
PoABCB23Pos.gene42756.mRNA-1Chr0490198,715.295.95plas: 13, vacu: 1
PoABCB24Pos.gene49791.mRNA-1Chr0464772,220.688.01plas: 11, mito: 1, E.R.: 1, pero: 1
PoABCB25Pos.gene39446.mRNA-1Chr041259137,893.489.27plas: 13, chlo: 1
PoABCB26Pos.gene45557.mRNA-1Chr0570677,346.099.2plas: 7, chlo: 4, mito: 1, E.R.: 1, pero: 1
PoABCB27Pos.gene77030.mRNA-1Chr051402155,5165.95plas: 12, nucl: 1, vacu: 1
PoABCB28Pos.gene61627.mRNA-1Chr051280140,874.218.65plas: 14
PoABCB29Pos.gene70371.mRNA-1Chr051267137,717.238.94plas: 13, vacu: 1
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shang, W.; Cui, C.; Liu, X.; Meng, W.; Qiu, Y.; Sun, Y.; Shen, Y.; Liu, W.; Wang, Z.; He, S.; et al. Genome-Wide Analysis of the ABCB Family and Its Expression in Adventitious Root Development of Paeonia ostii. Horticulturae 2025, 11, 138. https://doi.org/10.3390/horticulturae11020138

AMA Style

Shang W, Cui C, Liu X, Meng W, Qiu Y, Sun Y, Shen Y, Liu W, Wang Z, He S, et al. Genome-Wide Analysis of the ABCB Family and Its Expression in Adventitious Root Development of Paeonia ostii. Horticulturae. 2025; 11(2):138. https://doi.org/10.3390/horticulturae11020138

Chicago/Turabian Style

Shang, Wenqian, Can Cui, Xi Liu, Weihao Meng, Yongjie Qiu, Yuke Sun, Yuxiao Shen, Weichao Liu, Zheng Wang, Songlin He, and et al. 2025. "Genome-Wide Analysis of the ABCB Family and Its Expression in Adventitious Root Development of Paeonia ostii" Horticulturae 11, no. 2: 138. https://doi.org/10.3390/horticulturae11020138

APA Style

Shang, W., Cui, C., Liu, X., Meng, W., Qiu, Y., Sun, Y., Shen, Y., Liu, W., Wang, Z., He, S., Song, Y., & Shi, L. (2025). Genome-Wide Analysis of the ABCB Family and Its Expression in Adventitious Root Development of Paeonia ostii. Horticulturae, 11(2), 138. https://doi.org/10.3390/horticulturae11020138

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop