Next Article in Journal
Impact of Elevated Temperature and Solar Radiation on Broccoli (Brassica oleraceae var. italica Plenck) Cultivation
Next Article in Special Issue
Bioreactor-Based Liquid Culture and Production of Konjac Micro-Corm
Previous Article in Journal
Effects of Macronutrients on the Growth, Essential Oil Production, and Quality of Echinophora platyloba (DC.) in Natural Ecosystems
Previous Article in Special Issue
Optimizing Microclonal Propagation of Red Currant Cultivars: The Role of Nutrient Media, Sterilizers, and LED Lighting in Plant Adaptation
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

In Vitro Production of Plantlets and Microrhizomes, Genetic Fidelity Assessment, and Metabolic Profiling of Boesenbergia rotunda (L.) Mansf.

by
Kankamon Thepthong
1 and
Supanath Kanjanawattanawong
1,2,*
1
Department of Horticulture, Faculty of Agriculture, Khon Kaen University, 123 Mittraphap Rd., Nai Mueang, Mueang Khon Kaen District, Khon Kaen 40002, Thailand
2
Plant Breeding Research Center for Sustainable Agriculture, Khon Kaen University, 123 Mittraphap Rd., Nai Mueang, Mueang Khon Kaen District, Khon Kaen 40002, Thailand
*
Author to whom correspondence should be addressed.
Horticulturae 2025, 11(2), 186; https://doi.org/10.3390/horticulturae11020186
Submission received: 24 December 2024 / Revised: 1 February 2025 / Accepted: 4 February 2025 / Published: 8 February 2025
(This article belongs to the Special Issue Tissue Culture and Micropropagation Techniques of Horticultural Crops)

Abstract

:
Fingerroot (Boesenbergia rotunda (L.) Mansf.) is valued for its therapeutic benefits, both in Thailand and internationally. This study optimized in vitro propagation and induced microrhizomes (MRZ) to produce cleaned plantlets to support organic farming using disease-free plantlets, which is crucial for preventing and eradicating diseased plantlets, reducing the use of chemicals, and alternative approaches to enhancing phytochemical diversity. Shoots cultured on ½-strength MS medium with 1 mg L−1 of 6-benzylaminopurine (BAP) showed the highest shoot formation (69%) and shoot multiplication (3.45 ± 0.29 shoots per explant). Plantlets acclimatized in peat moss or a peat moss–coconut coir (1:1) mixture achieved a 100% survival rate. Genetic fidelity was confirmed using SSR markers, showing genetic consistency with the mother plant. The MRZ formation was the highest (98.33%) under white LED light with 30 g L−1 of sucrose. Nuclear magnetic resonance (NMR) analysis in MRZ revealed aspartate, a precursor to pinocembrin and pinostrobin. Additionally, nine unique metabolites not previously identified in fingerroot were detected in the MRZ, suggesting some potential in novel therapeutic applications. These findings support the development of efficient micropropagation methods and highlight MRZ as a source of diverse bioactive compounds, contributing to the medicinal value of B. rotunda in sustainable and large-scale production.

1. Introduction

The fingerroot (Boesenbergia rotunda (L.) Mansf.) belongs to the Zingiberaceae family and is native to Southeast Asia [1]. It is widely cultivated for its medicinal properties and the use of its components in curry paste due to its distinctive aromatic profile. This plant has short rhizomes and thin roots that measure 4–10 cm in length and 1–2 cm in width. The rhizome has light brown skin, yellow flesh, and a distinctive aroma [2]. People use fresh rhizomes and roots for culinary and medicinal purposes in many regions. It can treat colic, oral diseases (dry mouth), stomach pain leucorrhea, diuretics, dysentery, and inflammation [3]. Recent studies have shown that fingerroot contains compounds such as pinostrobin, pinocembrin, panduratin A, and alpinetin, among other compounds that have anti-coronavirus SARS-CoV-2, antiulceration, hepatoprotective, anticancer, antiherpes, anti-inflammatory, and antimicrobial properties [4,5]. However, the cultivation of fingerroot in agricultural systems is often hindered by challenges associated with rhizome rot disease caused by Ralstonia solanacearum bacteria in the propagation stage. Outbreaks are frequently observed during periods of hot weather and intense rainfall. The cultivation of fingerroot cannot be sustained in areas affected by the disease, potentially leading to insufficient production to satisfy market demand. Therefore, the use of clean plantlets from tissue culture can disrupt the transfer of disease to other plantations and reduce the use of pesticides for organic farming systems. According to previous research, the production of disease-free plantlets through tissue culture had not been extensively investigated in fingerroot. Therefore, some closely related plant species within the Zingiberaceae family, such as Kaempferia parviflora [6], Curcuma longa [7], and Etlingera elatior [8], were able to propagate a large number of plants in a short period. Thus, the use of plant tissue culture techniques is very important for the rapid and large-scale production of genetically uniform and cleaned plantlets, as well as for seasonal propagation. Of these, this technique will promote both the quality and quantity of fingerroot production.
There are three main methods of in vitro plant tissue culture: organogenesis, embryogenesis, and lateral budding. Plant growth regulators are key to enhancing shoot and root induction in tissue culture. Cytokinin and auxin are important in stimulating cell division and developing meristem into organs [9]. In the case of the Zingiberaceae family, the use of plant growth regulators such as cytokinins like 6-benzyl amino purine (BAP) and benzyl alanine (BA) and auxins like naphthalene acetic acid (NAA) at different concentrations have been reported.
The highest shoot multiplication of Boesenbergia rotunda was reported on Murashige and Skoog (MS) medium [10], adding 2 mg L−1 of BA and 0.5 mg L−1 of NAA [11]. The somatic embryos of ginger produced shoots and roots on solid MS medium supplemented with 3 mg L−1 of BAP and 0.1 mg L−1 of NAA [12]. The culture of K. parviflora (Zingiberaceae) could increase the shoots on an MS medium supplemented with 1.5 mg L−1 of BAP [6]. However, the response of these plants to tissue culture may also depend on the origin and climate of the mother plant [13].
Moreover, microrhizomes (MRZ), which are small underground stems that store nutrients and secondary metabolites, can be induced via in vitro culture [14] and could represent an alternative approach to in vitro high-quality secondary metabolite production. Of these, sucrose, photoperiod, and cytokinin concentrations may have a role in the induction of MRZ [15]. In addition, culturing under red light and adding high sucrose in the media have been reported to increase MRZ formation in ginger and curcuma [2,16]. Nevertheless, no research has reported on the in vitro MRZ development of fingerroot to increase its size and the production of a wider variety of secondary metabolites.
Several DNA markers effectively detect and evaluate genetic fidelity during mass propagation by tissue culture, regardless of age, tissue origin, physiological conditions, environmental factors, or sample handling during harvest, storage, and processing [17]. Simple sequence repeat (SSRs) markers were used to analyze the transcriptome and genome genetic diversity of the species, as well as the proximity of the genus in B. rotunda [18].
However, nuclear magnetic resonance spectroscopy (NMR) is used to identify substances in medicinal plants based on the 1H NMR technique in metabolomics. It has also been used in the quality control of herbal parts [19,20] and to discover new substances in plants. This technique has the advantage of being non-destructive. It is a reproducible and efficient method for both qualitative and quantitative biological analysis of samples. Sample preparation and analysis can be easily accomplished [7].
Therefore, the purpose of this research was to study the effects of different concentrations of BAP, NAA, and transplanting media for clean plantlet production and to study the effects of sucrose and light spectra on MRZ induction and its metabolite profiles relative to in vitro metabolite production.

2. Materials and Methods

2.1. Plant Material and Surface Sterilization

Fresh rhizomes of B. rotunda were purchased from a local farmer in Nakhon Pathom Province, Thailand. Then, the sprouted buds were washed thoroughly with running tap water and a few drops of dishwashing liquid. After that, the sprouted bud explants were immersed in 70% (v/v) ethanol for 1 min and surface-sterilized in 15% (v/v) Haiter® (a commercial bleach containing 6% sodium hypochlorite) with two drops of Tween® 20, shaking for 10 min, and 10% (v/v) Haiter® solution with two drops of Tween® 20, shaking for 15 min. Finally, the explants were washed 2 times with sterilized distilled water for 1 min. The sterilized rhizome sprouted buds were then aseptically trimmed of the damaged tissue and cultured on ½- strength MS medium supplemented with 1 mg L−1 of BAP for multiple-shoots induction and subcultured every month. The shoots were transferred to culture on MS-free hormone for one month before use in the experiments.

2.2. Effects of Different Concentrations of BAP and NAA on Multiple Shoot Induction

The 4–5 cm height in vitro shoots of B. rotunda were shorn of leaf sheaths and roots, retaining only the base of the shoot (about 1 cm in length). The shoot explants were cultured on ½ strength MS medium supplemented with BAP at concentrations of 1, 3, and 5 mg L−1 with or without 0.1 mg L−1 of NAA. All treatments added 30 g L−1 of sucrose and 7.25 g L−1 of agar, with an adjusted pH of 5.6. The explants were placed in a culture room set at 25 ± 2 °C under a 16 h/day photoperiod for 4 weeks. The 2 × 3 factorial in complete randomized design (CRD) was used for the experiment with 10 replications of 5 plantlets. Data on shoot formation (%), shoot number, shoot length (cm), and leaf number were recorded.

2.3. Effects of Different Planting Materials on Acclimatization and Transplanting

The in vitro shoot of B. rotunda usually generates its roots on hormone-free media [21]. Thus, for the plantlets cultured on ½-strength MS hormone-free medium, about 4–5 cm in height was used for acclimatization and transplanting. The plantlets were removed from the culture bottles, and all the agar at the roots was smooth-rinsed with tap water two times and soaked in 2 L of tap water, adding 3 drops of Betadine® for 15 min. Then, the plantlets were transferred to a nursery tray filled with moistened peat moss, covered with a transparent plastic bag, and stored in shaded condition for 4 weeks. Afterwards, the plantlets were transferred to plastic pots (11 cm height × 15.2 cm diameter) for planting. Treatment materials included peat moss, peat moss mixed with coconut coir (1:1 ratio), and peat moss mixed with coconut coir (1:2 ratio). The plantlets were then observed for 8 weeks. CRD was used for the experimental design, with 10 replications and 5 plantlets each. Data on survival percentage, plant height (cm), and number of leaves were recorded. The total chlorophyll of the mature leaves (the second leaves from the top) was measured (Konica Minolta® SPAD 502 Plus Chlorophyll Meter, Konica Minolta, Inc., Langenhagen, Germany). Additionally, the pH and EC values of pooled media within each treatment were investigated (Eutech® Waterproof Phtestr 30 pH Meter, Eutech Instruments Pte Ltd., Singapore and HM Digital® COM-100 EC Meter HM Digital, Inc., Carson, CA, USA). The planting materials were mixed with distilled water (1:5) by taking 2 g of 10 replications of each treatment, mixed with 100 mL of distilled water, stirred, and then the pH and EC meters were immersed for measuring.

2.4. Genetic Fidelity Assessment

Five young leaf samples of B. rotunda obtained from both field-condition-growing (the same origin as the explants) and acclimatized plants were examined. Genetic stability analysis was undertaken using 4 SSR primers (BrotSSR001933, BrotSSR002769, ContiSSR062098, and ContiSSR019224) [18]. DNA extraction of the fresh young leaves (0.1 g) was performed using the CTAB method of Doyle and Doyle [22]. After that, 100 µL of 1× TE buffer solution (10 mM Tris-HCL, pH 8.0; 1 mM EDTA, pH 8.0) was added and mixed to dissolve the DNA pellet. The quality and quantity of genomic DNA were analyzed via microvolume spectrophotometers (SP05, DeNovix®) and gel electrophoresis (PowerPacTM Basic Power Supply, BIO-RAD Inc., Hercules, CA, USA) and then kept at −20 °C for further PCR amplification.
PCR amplification of four SSR primer pairs was selected from Taheri et al. [18]. The marker can detect genetic differences in B. rotunda. For PCR amplification, 20 µL of a PCR reaction mixture containing 10 µL 2× PCR master (Invitrogen, Waltham, MA, USA), 2 µL of 10 µM forward primer, 2 µL of 10 µM reverse primer (Macrogen, Seoul, Republic of Korea), and 5 µL of DNA template were prepared. PCR amplification was performed in a thermal cycler (TProfessional basic gradient, Biometra, Göttingen, Germany) under the following conditions: pre-denaturation at 95 °C for 3 min; followed by 40 cycles of denaturation at 94 °C for 1 min, annealing at 56 °C for 1 min, and extension at 72 °C for 30 s; a final extension at 72 °C for 10 min; and a hold at 4 °C. A total of 5 µL of each PCR product was analyzed via gel electrophoresis (PowerPacTM Basic Power Supply, BIO-RAD Inc.) with 100 bp + 1.5 Kb DNA ladder (Invitrogen, USA) on a 2% agarose gel (Agarose A, Bio Basic) in 1× TBE buffer. The gel was then stained with 2 µL of red safe (iNtRON BIOTECNOLOGY, Seoul, Republic of Korea) and visualized using a UV transilluminator documented in Gel Doc (BIO-PRINT, VILBER Inc., Eberhardzell, Germany). The amplified DNA fragments were scored as present or absent in each micropropagated plant compared to their mother plants.

2.5. Effects of LED Lights and Different Sucrose Concentrations on MRZ Induction

Shoots of the fingerroot of about 3–4 cm in length were used. All the leaves and roots were removed from the shoots to keep the basal shoot at about 1 cm before being cultured on ½-strength MS medium supplemented with 1 mg L−1 of BAP and 7.25 g L−1 of agar at a pH at 5.6. The different concentrations of sucrose at 30, 60, and 90 g L−1 were compared under white and red light-emitting diodes (LEDs) (EVE Lighting Co., Ltd., Bangkok, Thailand) for 16 h/day of photoperiod at 25 ± 2 °C room temperature for 12 weeks. The spectra data of the white and red lights are listed in Table 1. Each treatment was replicated ten times, with five plants per replication. The experimental design of a 2 × 3 factorial in a CRD was used. Data on the percentage of MRZ formation, MRZ diameter (cm), MRZ fresh and dry weight per replication (g), number of shoots, and shoot length (cm) were recorded. The metabolite profile of the MRZ was analyzed via nuclear magnetic resonance (NMR) spectroscopy using the 1H NMR technique.

2.6. Analysis of Metabolic Profile in MRZ via Nuclear Magnetic Resonance (NMR) Spectroscopy Using the 1H NMR Technique

The fingerroot MRZ samples cultured under white light from the previous experiment were used for analysis. The MRZ was washed thoroughly and dried in a 50 °C hot-air oven for 24 h to obtain 5 g for NMR analysis. Following the protocol of Promraksa et al. [23] with some modification, according to the dried fingerroot, MRZ was powdered and soaked in 100 mL of methyl alcohol and extracted at room temperature for 2 days by shaking for 5 min every 12 h. The soaked solvent was decanted, after which methanol was added, and the mixture was soaked again. This process was repeated until the solution became very light in color. The resulting mixture was then filtered to obtain a clear extract, and the methanol was evaporated using a rotary evaporator at 55 °C until a sticky rubber-like residue was obtained The residue obtained was dissolved in water and extracted by making a partition of MeOH extract with CHCl3/H2O using a flash column. The separated substances were analyzed using the 1H NMR technique [24]. The crude extract (50 mg) was dissolved in 800 µL deuterated NMR solvents, including TMS (tetramethylsilane) as an internal reference, sonicated for 5 min, and filtered through a 0.20 μm filter (Corning, NY, USA). A 600 µL sample was transferred with a pipette and placed in a 5 mm NMR tube. The 1H NMR experiments were performed using a Bruker Avance III HD 400 MHz NMR spectrometer with a 5 mm BBFO probe at 25 °C using solvent CD3OD. A Carr−Purcell−Meiboom−Gill (CPMG) pulse sequence [RD−90°−(ꞇ−180°−ꞇ) n−acquisition] was applied to samples at 310 K (2ꞇn = 76.8 ms) to improve the visualization of signals generated from low-molecular-weight metabolites. A total of 64 scans were recorded into 72 k data points with a spectral width of 20 ppm [25]. The results of the metabolite profile were analyzed by Chenomx NMR Suite 9.0.

2.7. Statistical Analysis

Data are shown in figures as means ± standard errors (SE). The data were subjected to analysis of variance (ANOVA) using the Statistix 10 (1985–2013 Analytical Software), and means were analyzed using least significant difference (LSD) at p < 0.05.

3. Results and Discussion

3.1. Effects of Different Concentrations of BAP and NAA on Multiple Shoot Induction

The media supplemented with 1 and 5 mg L1 of BAP resulted in the maximum number of shoots (3.45 ± 0.29 and 2.91 ± 0.44 shoots per explant, respectively), which is significantly different from the other treatments. However, the maximum shoot formation rate of 69% was recorded in media enriched with 1 mg L1 of BAP with more green and healthy shoots. According to BAP, it is a cytokinin that stimulates cell division and shoot formation in explants [24]. Cytokinin works by activating the genes that control the cell cycle and cell differentiation and by modulating the levels of other hormones, such as auxin [26]. Other studies have shown that BAP can enhance shoot induction and proliferation in K. parviflora and fingerroot at different concentrations [6,14]. Moreover, cytokinin alone or combined with auxin can induce shoot development by giving a high cytokinin-to-auxin ratio, leading to cell differentiation into stems, buds, shoots, and leaves [27,28]. The control treatment produced the highest shoot length of 4.07 ± 0.42 cm and the highest number of leaves at 1.42 ± 0.17 leaves per explant, similar to adding 1 mg L1 of BAP. In addition, the control treatment and adding 1 mg L1 of BAP also provided the highest number of roots per explant (Figure 1 and Table 2). However, the maximum root numbers per explant were also observed on the hormone-free medium and without auxin addition. Inducing shoots and roots simultaneously is a common feature of plants belonging to sterile conditions that were reported in the micropropagation of some of the Zingiberaceae family [21].

3.2. Effects of Different Planting Materials on Acclimatization

In vitro culturing creates special conditions that affect the morphology, anatomy, and physiology of plantlets, making them unable to survive after the transfer, resulting in a high mortality rate after the transfer of plants to glasshouse or field conditions [29]. Ex vitro plantlets need acclimatization to cope with environmental stress and abnormalities [30]. Different planting media were tested for plantlets’ survival rate during transplantation from in vitro to greenhouse conditions. After transplanting for 8 weeks, all planting materials revealed a 100% survival rate of the plantlet. Peat moss was the most effective planting substrate for fingerroot height, with a mean of 14.21 ± 1.23 cm. However, there was no significant difference in the number of leaves and chlorophyll contents among the three treatments (Table 3). Our results agree with Abbas et al. [31], who found that only peat moss was an appropriate acclimatization medium for ginger, with a survival percentage of 100%. Moreover, the mixing of peat moss with other substrates also provides a high survival rate; Zhang et al. [32] successfully acclimatized Curcuma kwangsiensis plantlets in a peat moss–coconut chaff–perlite mixture in a ratio of 1:1:1. Laipaitong et al. [33] transferred Black Galingale plantlets in a soil–peat moss–coconut peat perlite mixture in a ratio 1:1:1, with a survival percentage of 100%. This was similar to our results which indicated that plantlets planted in a peat moss–coconut coir dust mixture at a 1:1 or 1:2 ratio had the same survival percentage. However, planting in peat moss alone revealed the highest plant height (14.21 cm) because peat moss is an ideal substrate for many tropical plants. It provides a rich source of organic matter that enhances soil quality and fertility [15]. However, the plantlets had light green leaves when planted in the same media for more than 8 weeks after transferring, which is a symptom of nitrogen deficiency [11]. Therefore, additional fertilizer is recommended to be applied within 8 weeks after the transplanting of healthy plantlets. Almost all the media have pH values ranging from 5.8 to 6.1, approaching the ideal range (5.2–6.5), as suggested by other reports [34,35]. The EC values of the media ranged from 0.26 to 0.38 dS cm1 (Table 4), which is lower than the optimal range of 1.6–2.4 dS cm1 [36]. This indicated that the nutrient levels are inadequate for long-term plant growth (Figure 2).

3.3. Genetic Stability Assessment

Genetic stability was assessed to test whether the plants obtained via tissue culture propagation were genetically identical to the parent plants grown in field conditions and to ensure that this method did not cause mutations. The findings on genetic fidelity in Boesenbergia rotunda, assessed through SSRs (simple sequence repeats) markers in both mother plants and acclimatized plants, offer valuable insights into the genetic stability of micropropagated fingerroot plants. The SSR-based PCR analysis revealed no observable polymorphism in DNA banding patterns across all four primers between mother plants and acclimatized plants. The PCR product sizes of four primers were related to the previous report, including BrotSSR001933 (184 bp), BrotSSR002769 (155 bp), ContiSSR062098 (220 bp), and ContiSSR019224 (268 bp) (Table 5), suggesting that micropropagated plants maintain genetic fidelity with their mother plants [37,38]. This genetic consistency supports the reliability of micropropagation techniques in preserving the genetic integrity of propagated plants, a factor critical for large-scale propagation efforts (Table 5 and Figure 3). Of these, it can be confirmed that micropropagated plants maintain genetics with their mother plant. Rout et al. [39] reported that no polymorphisms or changes in the amplified DNA of ginger were detected after amplification via PCR in in vitro plants.
Micropropagation has been established as a reliable method for preserving genetic stability, largely due to the use of meristem culture, which reduces the likelihood of somaclonal variation, a common source of genetic alterations during cell division and differentiation under in vitro conditions [40]. The inherent structural organization of meristems, which are composed of undifferentiated, rapidly dividing cells, plays a crucial role in maintaining genomic stability [41]. In this study, the monomorphic DNA amplification products observed in both the mother plants and acclimatized plants of B. rotunda confirm that the SSR markers did not detect any polymorphisms. This result underscores the genetic uniformity of in vitro-propagated plants, reinforcing the fact that meristem culture is effective in producing genetically stable clones [37,42].
The confirmed genetic stability of micropropagated B. rotunda plants has significant implications for large-scale propagation. Ensuring genetic fidelity is crucial for the commercial cultivation of medicinal plants, as genetic variation could lead to inconsistencies in bioactive compound profiles, which, in turn, may affect the therapeutic efficacy and safety of plant-derived products [41]. For medicinal plants like B. rotunda, which are valued for their specific phytochemical profiles, maintaining genetic uniformity across propagated plants ensures that the phytochemical composition remains consistent, supporting the reliable production of high-quality herbal materials.
In addition, the genetic fidelity of micropropagated plants facilitates the large-scale cultivation of B. rotunda for conservation purposes. Wild populations of medicinal plants are often overharvested, leading to genetic erosion and loss of biodiversity. By employing in vitro propagation with verified genetic stability, conservation programs can sustainably cultivate B. rotunda without depleting natural populations [43]. Of these, this research output could be extended to the government plant propagation sector, public companies, and farmers to be concerned and utilize the advantages of clean plantlets. Consequently, employing clean plantlets via this approach can impede the transmission of rhizome rot disease to other plantations and diminish the need for pesticides in organic farming systems.

3.4. Effect of LED Lights and Different Sucrose Concentrations on MRZ Induction

Because of the light spectra, light intensity and sucrose concentration affect plant growth and development [44]. Moreover, culturing under red light and adding high sucrose to the media have been reported to increase MRZ or micro tuber formation in ginger and curcuma [2,16] and to affect the measurement of plants’ anatomical, physiological, and morphological parameters [8]. To increase the number of MRZ during in vitro propagation, MRZ induction cultured under different LED lights and sucrose concentrations in in vitro conditions were investigated. The experiment demonstrated that culturing under white light was more effective in inducing MRZ development (76.11%) than red light (53.3%). Considering the spectral data from Table 1, white light has a light intensity of PPFD (21.0714 µmol m−2 s−1) and YPFD (18.0146 µmol m−2 s−1), greater than red light (5.3338 µmol m−2 s−1 and 5.1308 µmol m−2 s−1, respectively). Slimmon et al. [45] reported that a high light intensity of 106 µmol m−2 s−1 can increase the induction of microtube formation in potatoes due to the high light intensity causing the transport of the plant’s synthesized food to accumulate, thus increasing food storage (sink), which results in a smaller head (micro tuber) and increased weight. In the Zingiberaceae family, MRZ induction has been performed using white light with different light intensities. An et al. [46] cultured ginger tissue under white light with a light intensity of 35 µmol m−2 s−1 for MRZ induction, which was different from Singh et al. [47], who used a light intensity of 25 µmol m−2 s−1, and Islam et al. [48] cultured turmeric tissue under white light with a light intensity of 50 µmol m−2 s−1. On the other hand, red light has been reported to promote MRZ or micro tuber formation in ginger (Zingiber officinale) and curcuma (Curcuma alismatifolia) [2,16]. Moreover, white light also contains a broad spectrum, including green and blue light, which benefits plant growth and development. Green supplemental lighting may provide advantages, as green light can penetrate the plant canopy more effectively and potentially enhance plant development by boosting photosynthesis in the lower-canopy leaves [49]. In addition, the photosynthetically active radiation decrease is registered primarily by the cryptochrome blue light receptors [50]. However, different plant species have different morphological and physiological responses to light spectrum and intensity [51]. It can be concluded that white light and higher light intensity positively affect fingerroot MRZ induction. Of these, the white LED light tube is cheaper and does not cause eye irritation. Moreover, culturing under white and red light made no difference to MRZ size, fresh weight, or dry weight (Table 6). It was also found that cultures grown under white light had a significantly higher number of shoots per explant and shoot length than red light. (Figure 4 and Table 6). Of these, it was found that the R/Fr ratio of white light (19.135) was lower than that of red light (4791.1), which may be related to plant elongation. The R/Fr ratio affects the activity of phytochromes, which is a plant photoreceptor involved in elongation [52]. Hisamatsu et al. [53] reported that a high R/FR ratio inhibits the expression of the GA20-oxidase gene, one of the key enzymes in the synthesis of GA1 that may occur by the action of phytochrome B, which reduces the elongation of Arabidopsis. Similarly, Lund et al. [5] found that a high R/FR ratio reduces the height of chrysanthemum stems.
Whenever various amounts of sucrose were tested, it was shown that the addition of 30 g L−1 sucrose resulted in a higher MRZ formation (82.50%) compared to the addition of 60 and 90 g L−1 sucrose. This result is supported by Nayak and Nail [54], who reported that adding sucrose of 30–60 g L−1 can induce MRZ formation in turmeric, but the concentration of more than 60–90 g L−1 reduced MRZ formation. However, the addition of 60 and 90 g L−1 sucrose provided a fresh weight of MRZ higher than the addition of 30 g L−1 sucrose (Figure 5). As reported, adding high sucrose resulted in high MRZ fresh weight values, such as at 60 g L−1 in black galangal and turmeric [55] and 90 g L−1 in ginger var. Bentong [56]. The high concentration of sucrose is considered the first metabolic signaling molecule and provides the source of carbon and energy that influences in vitro storage organ formation [56]. García et al. [57] noted that elevated sucrose concentrations augmented the expression of the protein phosphatase type 2A gene in potatoes (StPP2Ac2b), which was associated with the overexpression of the gibberellin 2-oxidase gene (StGA2ox1), thus promoting tuberization in potatoes. GA 2-oxidases (GA2ox) are catabolic enzymes that deactivate bioactive gibberellic acid (GA) [58]. A decrease in bioactive GA levels in the region of storage organ formation alters the cell division plane, prompting that region to expand and develop storage organs [59]. Furthermore, the experiment revealed that the addition of 90 g L−1 sucrose resulted in a decrease in MRZ formation, shoot induction, and shoot length. This can be attributed to the elevated osmotic pressure in the culture medium caused by the high concentration of sucrose, which exceeds that of the plant cells. Therefore, plants cannot absorb water and nutrients; then, they become stressed, and this reduces plant growth [60]. As a result, the presence of MRZ leads to a reduction in the quantity of leaves, photosynthesis, and biomass accumulation [61]. Additionally, an influence of the interaction between light quality and sucrose concentration on MRZ induction was found such that through culturing under white light, together with the addition of 30 g L−1 of sucrose, MRZ formation was possible (up to 98.33%) (Table 6).

3.5. Metabolite Profile Analysis in MRZ Using the 1H NMR Technique

The distinct metabolite profiles identified between a field-conditions rhizome and in vitro MRZ suggested significant biochemical shifts induced by environmental factors and cultivation methods [62]. To investigate the possibility of the main metabolites in the fingerroot rhizome found in MRZ, and to explore a possible novel metabolite finding, NMR is employed as a tool. NMR data were generated based on the metabolites in the Chenomx database, which were identified in the spectral region of δ 0.6–8.0 ppm.
The field-conditions rhizome was found to contain a broader array of metabolites, including essential amino acids such as alanine, leucine, and valine, as well as organic acids like fumarate and maleate, which are absent in MRZ, or else potentially present in minimal quantities [63]. These substances play crucial roles in stabilizing protein structures, enhancing metabolic processes, and improving the growth and quality of plants [64]. Field-conditions rhizomes contain 23 unique metabolites, including phenylalanine and gallate, which play roles in plant defence and antioxidant activity, potentially enhancing the plant’s resistance to pathogens and environmental stressors [65,66].
The MRZ amino acid profile shows the presence of aspartate and saccharopine, which are metabolites associated with the stress response and lysine degradation, respectively [63]. Aspartate’s role as a precursor in nitrogen metabolism may support cellular resilience under in vitro stress, such as limited osmotic changes or nutrient variations, a factor less prevalent in field-grown plants, where environmental conditions naturally modulate these pathways [67]. In contrast, field rhizomes, exposed to fluctuating soil nutrient levels and potential drought, show metabolites like mannitol, an osmoprotectant that aids in drought tolerance, and methyl guanidine, a compound likely resulting from microbial interaction in the rhizosphere [68].
The differences observed between the field rhizome and MRZ of B. rotunda highlight potential implications for therapeutic applications. Gallate and phenylalanine, found only in field rhizomes, have documented anti-inflammatory and antimicrobial properties, suggesting that field cultivation may yield extracts with enhanced therapeutic effects [65,66]. The presence of phenolic compounds such as gallate in field rhizomes suggests an adaptation to biotic and abiotic stresses prevalent in soil environments, which is consistent with findings from studies on field grown medicinal plants [67]. The absence of gallate in the MRZ supports the hypothesis that specific environmental factors may be necessary to stimulate phenolic biosynthesis in B. rotunda [69] (Figure 6 and Supplementary Materials Table S1). On the other hand, MRZ samples produced in a controlled in vitro setting, which typically involves minimal external stresses, contain compounds like ascorbate, which are crucial in oxidative stress mitigation within laboratory conditions [62]. Meanwhile, compounds like ascorbate, found in MRZ, could be beneficial for tissue culture protocols by reducing oxidative stress, potentially improving the in vitro growth and health of the plant [70]. These findings support the idea that a more nuanced approach to cultivation could optimize the production of specific secondary metabolites that enhance the pharmacological potential of fingerroot.
However, phenylalanine is a precursor to the production of flavonoids, which leads to the formation of important secondary metabolites such as panduratin A, pinocembrin, and pinostrobin [71]. It is found in the rhizomes, followed by the roots and leaves of fingerroot, respectively, because it contains a large amount of 4-coumarate-CoA ligase (4CL) enzymes, which are the catalysts for production and lead to the production of secondary metabolites [72]. Although phenylalanine was not found in the MRZ extracted from tissue culture, but choline, glutamate, lysine, ornithine, valerate, valine, 3-hydroxybutyrate, 3-methyl-2-oxovalerate, ascorbate, aspartate, ethanol, hydroxy acetone, O-phosphocholine, saccharopine, and xylitol were found, which are key metabolic intermediates. These compounds are crucial for growth and development and are involved in vital metabolic pathways, including respiration and photosynthesis [73]. Moreover, this research found nine metabolites in MRZ from tissue culture that have never been found in fingerroot rhizome before, leading to a new substance utilization identification (Figure 7).
Conversely, the MRZ demonstrated a more limited profile but included metabolites not detected in field samples. The nine metabolites uniquely identified in the MRZ of B. rotunda (3-hydroxyisobutyrate, 3-hydroxybutyrate, 3-methyl-2-oxovalerate, ascorbate, aspartate, ethanol, hydroxyacetone, o-phosphocholine, and saccharopine) suggest that the MRZ’s in vitro environment promotes a distinctive metabolic profile. These compounds likely play unique roles in cellular processes, with potential implications for the therapeutic efficacy of B. rotunda extracts (Table 7) via an alternative production source approach.
Finally, the unique profiles of field rhizomes and MRZ demonstrate the importance of the cultivation environment in influencing secondary metabolite synthesis in B. rotunda. Field rhizomes appear to benefit from natural environmental stressors that induce a broader range of therapeutically beneficial metabolites. The in vitro setting, while controlled, may require optimization, such as via induced stress treatments, to stimulate the desired secondary metabolite pathways. Further studies should explore how modified in vitro conditions can bridge this gap, enhancing the medicinal value of MRZ through targeted metabolic manipulation and biological activity tests.

4. Conclusions

This study showed that adding only 1 mg L−1 of BAP is suitable for multiple-shoot induction in the clean plantlets production of fingerroot. This approach helps to avoid the root rot disease, which a commonly incurred and distributed through the general propagation method, and to maintain genetic stability with respect to the mother plant. However, the upscale production or bioreactor system could be investigated for further commercial production and transferred to commercial laboratories and farmers. The alternative approach for fingerroot metabolite production was investigated, namely, in vitro microrhizome (MRZ) induction. The MRZ was induced from a shoot explant on ½-strength MS medium supplemented with 1 mg L−1 of BAP and 30 g L−1 of sucrose and cultured under white LED light. The NMR analysis revealed that MRZ had the ability to generate the specific sorts of substances known as the metabolites profile. They have similarities and differences with the rhizomes acquired from field conditions, which creates a chance for the development of further research on biotic and abiotic elicitors to stimulate and increase the quality and quantity of metabolites for medicinal purposes in the future.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/horticulturae11020186/s1, Table S1: List of metabolites, chemical shift in the fingerroot field rhizome and MRZ in vitro conditions.

Author Contributions

Conceptualization, S.K.; methodology, S.K. and K.T.; software, K.T.; validation, S.K.; formal analysis, S.K. and K.T.; investigation, K.T.; resources, S.K.; data curation, S.K. and K.T.; writing—original draft preparation, K.T.; writing—review and editing, S.K.; visualization, S.K.; supervision, S.K.; project administration, S.K.; funding acquisition, S.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research was partially supported by the Agricultural Research Development Agency (ARDA) (public organization).

Data Availability Statement

Data are contained within the article.

Acknowledgments

The author would like to thank the Center of Excellence on Agricultural Biotechnology (AG-BIO/MHESI), the Plant Breeding Research Center for Sustainable Agriculture of Khon Kaen University, and the Graduate School of Khon Kaen University for their valuable support.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Hooker, J.D.; Hooker, J.D. The Flora of British India; L. Reeve: London, UK, 1875. [Google Scholar] [CrossRef]
  2. Chidburee, A. Effects of Day Length and Red Light on Growth of Curcuma alismatifolia Gagnep. Rhizome. Ph.D. Thesis, Chiang Mai University, Chiang Mai, Thailand, 2008. [Google Scholar]
  3. Thaingburanatham, W. Dictionary of Thai Medicinal Plants, 2nd ed.; Suriyaban Publisher: Bangkok, Thailand, 1993. [Google Scholar]
  4. Abdelwahab, S.I.; Mohan, S.; Abdulla, M.A.; Sukari, M.A.; Abdul, A.B.; Taha, M.M.E.; Syam, S.; Ahmad, S.; Lee, K.H. The Methanolic Extract of Boesenbergia rotunda (L.) Mansf. and Its Major Compound Pinostrobin Induces Anti-Ulcerogenic Property in Vivo: Possible Involvement of Indirect Antioxidant Action. J. Ethnopharmacol. 2011, 137, 963–970. [Google Scholar] [CrossRef]
  5. Lund, J.B.; Blom, T.J.; Aaslyng, J.M. End-of-Day Lighting with Different Red/Far-Red Ratios Using Light-Emitting Diodes Affects Plant Growth of Chrysanthemum × Morifolium ramat. ‘Coral Charm’. Hortscience 2007, 42, 1609–1611. [Google Scholar] [CrossRef]
  6. Khairudin, N.A.; Haid, Z.; Hakiman, M. In Vitro Shoot and Root Induction of Kaempferia Parviflora (Zingiberaceae) Rhizome Using 6-Benzylaminopurine. J. Trop. Plant Physiol. 2020, 12, 10. [Google Scholar] [CrossRef]
  7. Jahangir, M.; Atta-ur-Rehman, M.; Abdel Farid, I.B.; Verpoorte, R.; Khan, I.; Peng, J. NMR-Based Metabolomics for Geographical Discrimination of Adhatoda vasica Leaves. Plants 2023, 12, 453. [Google Scholar] [CrossRef]
  8. Yu, W.; Liu, Y.; Song, L.; Jacobs, D.F.; Du, X.; Ying, Y.; Shao, Q.; Wu, J. Effect of Differential Light Quality on Morphology, Photosynthesis, and Antioxidant Enzyme Activity in Camptotheca acuminata Seedlings. J. Plant Growth Regul. 2017, 36, 148–160. [Google Scholar] [CrossRef]
  9. Peeters, A.J.M.; Gerards, W.; Barendse, G.W.M.; Wullems, G.J. In Vitro Flower Bud Formation in Tobacco: Interaction of Hormones. Plant Physiol. 1991, 97, 402–408. [Google Scholar] [CrossRef] [PubMed]
  10. Murashige, T.; Skoog, F. A Revised Medium for Rapid Growth and Bio Assays with Tobacco Tissue Cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef]
  11. Yusuf, N.A.; Suffian Annuar, M.M.; Khalid, N. Rapid Micropropagation of Boesenbergia rotunda (L.) Mansf. Kulturpfl. (a Valuable Medicinal Plant) from Shoot Bud Explants. Afr. J. Biotechnol. 2011, 10, 1194–1199. [Google Scholar] [CrossRef]
  12. Guo, Y.; Zhang, Z. Establishment and Plant Regeneration of Somatic Embryogenic Cell Suspension Cultures of the Zingiber officinale Rosc. Sci. Hortic. 2005, 107, 90–96. [Google Scholar] [CrossRef]
  13. Pierik, R.L.M. In Vitro Culture of Higher Plants; Springer: Dordrecht, The Netherlands, 1997. [Google Scholar] [CrossRef]
  14. Labrooy, C.; Lee Abdullah, T.; Stanslas, J. Influence of N6-Benzyladenine and Sucrose on In Vitro Direct Regeneration and Microrhizome Induction of Kaempferia parviflora Wall. Ex Baker, An Important Ethnomedicinal Herb of Asia Authors. Trop. Life Sci. Res. 2020, 31, 123–139. [Google Scholar] [CrossRef] [PubMed]
  15. Zheng, Y.; Liu, Y.; Ma, M.; Xu, K. Increasing in Vitro Microrhizome Production of Ginger (Zingiber officinale Roscoe). Acta Physiol. Plant. 2008, 30, 513–519. [Google Scholar] [CrossRef]
  16. Jaimakaew, C.; Thumdee, S.; Sotthikul, C. Effects of Light Source and Sucrose on in Vitro Microrhizome Formation of Ginger. Agricultural Sci.J. 2018, 49, 110–114. [Google Scholar]
  17. Abdel-Mawgood, A.L. DNA Based Techniques for Studying Genetic Diversity, Genetic Diversity in Microorganisms; Caliskan, M., Ed.; InTech: London, UK, 2012; pp. 95–122. Available online: http://www.intechopen.com/books/genetic-diversity-in-microorganisms/dna-based-techniques-for-studying-genetic-diversity (accessed on 14 November 2024).
  18. Taheri, S.; Teo, C.H.; Heslop-Harrison, J.S.; Schwarzacher, T.; Tan, Y.S.; Wee, W.Y.; Khalid, N.; Biswas, M.K.; Mutha, N.V.R.; Mohd-Yusuf, Y.; et al. Genome Assembly and Analysis of the Flavonoid and Phenylpropanoid Biosynthetic Pathways in Fingerroot Ginger (Boesenbergia rotunda). Int. J. Mol. Sci. 2022, 23, 7269. [Google Scholar] [CrossRef]
  19. Bapela, M.J.; Heyman, H.; Senejoux, F.; Meyer, J.J.M. 1H NMR-Based Metabolomics of Antimalarial Plant Species Traditionally Used by Vha-Venda People in Limpopo Province, South Africa and Isolation of Antiplasmodial Compounds. J. Ethnopharmacol. 2019, 228, 148–155. [Google Scholar] [CrossRef]
  20. Lynn, N.H.; Linn, T.Z.; Yanmei, C.; Shimozu, Y.; Taniguchi, S.; Hatano, T. 1H Quantitative NMR Analyses of β-Asarone and Related Compounds for Quality Control of Acorus Rhizome Herbal Drugs in Terms of the Effects of Their Constituents on In Vitro Acetylcholine Esterase Activity. Biosci. Biotechnol. Biochem. 2019, 83, 892–900. [Google Scholar] [CrossRef]
  21. Bharalee, R.; Das, A.; Kalita, M.C. In Vitro Clonal Propagation of Curcuma caesia Roxb and Curcuma zedoaria Rosc from Rhizome Bud Explants. J. Plant Biochem. Biotechnol. 2005, 14, 61–63. [Google Scholar] [CrossRef]
  22. Doyle, J.; Doyle, J.L. A Rapid DNA Isolation Procedure for Small Quantities of Fresh Leaf Tissue. Phytochem. Bull. 1987, 19, 11–15. [Google Scholar]
  23. Promraksa, B.; Phetcharaburanin, J.; Namwat, N.; Techasen, A.; Boonsiri, P.; Loilome, W. Evaluation of anticancer potential of Thai medicinal herb extracts against cholangiocarcinoma cell lines. PLoS ONE 2019, 14, e0216721. [Google Scholar] [CrossRef] [PubMed]
  24. Phetcharaburanin, J.; Deewai, S.; Kulthawatsiri, T.; Moolpia, K.; Suksawat, M.; Promraksa, B.; Klanrit, P.; Namwat, N.; Loilome, W.; Poopasit, K.; et al. 1H NMR Metabolic Phenotyping of Dipterocarpus alatus as a Novel Tool for Age and Growth Determination. PLoS ONE. 2020, 15, e0243432. [Google Scholar] [CrossRef]
  25. Hartmann, H.T.; Kester, D.E.; Davies, F.T.; Geneve, R.L. Hartmann and Kester’s Plant Propagation Principles and Practices, 7th ed.; Pearson Education: Hoboken, NJ, USA, 2002. [Google Scholar]
  26. Skoog, F.; Miller, C. Chemical Regulation of Growth and Organ Formation in Plant Tissues Cultured in Vitro. Symp. Soc. Exp. Biol. 1957, 11, 118–130. [Google Scholar]
  27. Charasamrit, N. Plant Hormones and Bulk Secretions; Sahamit Nokset Printing House: Bangkok, Thailand, 1994. [Google Scholar]
  28. Danial, G.H.; Ibrahim, D.A.; Yousef, A.N.; Elyas, S.B. RAPID PROTOCOL OF Aloe vera In Vitro propagation. Iraqi J. Agric. Sci. 2019, 50, 1377–1382. [Google Scholar] [CrossRef]
  29. Grout, B.W.W.; Aston, M.J. Transplanting of Cauliflower Plants Regenerated from Meristem Culture. I. Water Loss and Water Transfer Related to Changes in Leaf Wax and to Xylem Regeneration. Hortic. Res. 1977, 17, 1–7. [Google Scholar]
  30. Rakesh, S.; Pareek, N.K.; Rathore, R.S. Visual Nutrient Deficiency Symptoms in Plants. Agrospheres e-Newsl. 2021, 2, 42–45. Available online: https://www.researchgate.net (accessed on 16 April 2021).
  31. Abbas, M.S.; Taha, H.S.; Aly, U.I.; El-Shabrawi, H.M.; Gaber, E.S.I. In Vitro Propagation of Ginger (Zingiber officinale Rosco). J. Genet. Eng. Biotechnol. 2011, 9, 165–172. [Google Scholar] [CrossRef]
  32. Zhang, S.; Liu, N.; Sheng, A.; Ma, G.; Wu, G. In Vitro Plant Regeneration from Organogenic Callus of Curcuma kwangsiensis Lindl. (Zingiberaceae). Plant Growth Regul. 2011, 64, 141–145. [Google Scholar] [CrossRef]
  33. Laipaitong, K.; Te-chato, S.; Khawniam, T. Plant Regeneration of Black Galingale Derived from Shoot Culture. Songklanakarin J. Plant Sci. 2018, 5, 13–18. [Google Scholar]
  34. Borsai, O.; Hârta, M.; Szabo, K.; Kelemen, C.D.; Andrecan, F.A.; Codrea, M.M.; Clapa, D. Evaluation of Genetic Fidelity of in Vitro-Propagated Blackberry Plants Using RAPD and SRAP Molecular Markers. Hortic. Sci. 2020, 47, 21–27. [Google Scholar] [CrossRef]
  35. Noguera, P.; Abad, M.; Puchades, R.; Maquieira, A.; Noguera, V. Influence of Particle Size on Physical and Chemical Properties of Coconut Coir Dust as Container Medium. Commun. Soil Sci. Plant Anal. 2003, 34, 593–605. [Google Scholar] [CrossRef]
  36. Shenoy, V.B.; Vasil, I.K. Biochemical and Molecular Analysis of Plants Derived from Embryogenic Tissue Cultures of Napier Grass (Pennisetum purpureum K. Schum). Theor. Appl. Genet. 1992, 83, 947–955. [Google Scholar] [CrossRef] [PubMed]
  37. Ioannidis, K.; Tomprou, I.; Mitsis, V.; Koropouli, P. Genetic Evaluation of In Vitro Micropropagated and Regenerated Plants of Cannabis sativa L. Using SSR Molecular Markers. Plants 2022, 11, 2569. [Google Scholar] [CrossRef]
  38. More, S.S.; Janvale, G.B.; Wagh, S.G.; Kadam, K.D.; Akhare, A.A. Deciphering the Genetic Identity and Fidelity of Banana Genotype Musa acuminata through Molecular Fingerprinting. Asian J. Agric. Hortic. Res. 2023, 10, 59–66. [Google Scholar] [CrossRef]
  39. Rout, G.R.; Das, P.; Goel, S.; Raina, S. Determination of Genetic Stability of Micropropagated Plants of Ginger Using Random Amplified Polymorphic DNA (RAPD) Markers. Bot. Bull. Acad. Sin. Taipei 1998, 39, 23–27. [Google Scholar]
  40. Gupta, N.; Jain, V.; Joseph, M.R.; Devi, S. A Review on Micropropagation Culture Method. Asian J. Pharm. Res. Dev. 2020, 8, 86–93. [Google Scholar] [CrossRef]
  41. Duta-Cornescu, G.; Constantin, N.; Pojoga, D.M.; Nicuta, D.; Simon-Gruita, A. Somaclonal Variation—Advantage or Disadvantage in Micropropagation of the Medicinal Plants. Int. J. Mol. Sci. 2023, 24, 838. [Google Scholar] [CrossRef]
  42. Khatun, M.M.; Tanny, T.; Yesmin, S.; Salimullah, M.; Alam, I. Evaluation of Genetic Fidelity of in Vitro-Propagated Aloe vera Plants Using DNA-Based Markers. Scienceasia 2018, 44, 87–91. [Google Scholar] [CrossRef]
  43. Sherif, N.A.; Senthil Kumar, T.; Rao, M.V. DNA Barcoding and Genetic Fidelity Assessment of Micropropagated Aenhenrya rotundifolia (Blatt.) C.S. Kumar and F.N. Rasm.: A Critically Endangered Jewel Orchid. Physiol. Mol. Biol. Plants 2020, 26, 2391–2405. [Google Scholar] [CrossRef]
  44. Fukuda, N.; Fujita, M.; Ohta, Y.; Sase, S.; Nishimura, S.; Ezura, H. Directional Blue Light Irradiation Triggers Epidermal Cell Elongation of Abaxial Side Resulting in Inhibition of Leaf Epinasty in Geranium under Red Light Condition. Sci. Hortic. 2008, 115, 176–182. [Google Scholar] [CrossRef]
  45. Slimmon, T.; Machado, V.S.; Coffin, R. The Effect of Light Onin Vitro Microtuberization of Potato Cultivars. Am. Potato J. 1989, 66, 843–848. [Google Scholar] [CrossRef]
  46. An, N.H.; Chien, T.T.M.; Nhi, H.T.H.; Nga, N.T.M.; Phuc, T.T.; Thuy, L.T.N.; Van Bao Thanh, T.; Nguyen, P.T.T.; Phuong, T.T.B. The Effects of Sucrose, Silver Nitrate, Plant Growth Regulators, and Ammonium Nitrate on Microrhizome Induction in Perennially-Cultivated Ginger (Zingiber officinale Roscoe) from Hue, Vietnam. Acta Agrobot. 2020, 73, 7329. [Google Scholar] [CrossRef]
  47. Singh, T.D.; Chakpram, L.; Devi, H.S. Induction of in Vitro Microrhizomes Using Silver Nitrate in Zingiber officinale Rosc. Var. Baishey and Nadia. Indian J. Biotechnol. 2014, 13, 256–262. [Google Scholar]
  48. Islam, M.; Kloppstech, K.; Jacobsen, H. Efficient Procedure for In Vitro Microrhizome Induction in Curcuma longa L. (Zingiberaceae)—A Medicinal Plant of Tropical Asia. Plant Tissue Cult. 2004, 14, 123–134. [Google Scholar]
  49. Kim, H.H.; Goins, G.D.; Wheeler, R.M.; Sager, J.C. Green-Light Supplementation for Enhanced Lettuce Growth under Red-and Blue-Light-Emitting Diodes. HortScience 2004, 39, 1617–1622. [Google Scholar] [CrossRef]
  50. Huber, M.; Nieuwendijk, N.M.; Pantazopoulou, C.K.; Pierik, R. Light Signalling Shapes Plant–Plant Interactions in Dense Canopies. Plant Cell Environ. 2021, 44, 1014–1029. [Google Scholar] [CrossRef]
  51. Wang, W.; Galili, G. Transgenic High-Lysine Rice—A Realistic Solution to Malnutrition? J. Exp. Bot. 2016, 67, 4009–4011. [Google Scholar] [CrossRef]
  52. Franklin, K.A.; Whitelam, G.C. Phytochromes and Shade-Avoidance Responses in Plants. Ann. Bot. 2005, 96, 169. [Google Scholar] [CrossRef]
  53. Hisamatsu, T.; King, R.W.; Helliwell, C.A.; Koshioka, M. The Involvement of Gibberellin 20-Oxidase Genes in Phytochrome-Regulated Petiole Elongation of Arabidopsis. Plant Physiol. 2005, 138, 1106–1116. [Google Scholar] [CrossRef] [PubMed]
  54. Nayak, S.; Naik, P.K. Factors Effecting in Vitro Microrhizome Formation and Growth in Curcuma longa L. and Improved Field Performance of Micropropagated Plants. ScienceAsia 2006, 32, 31–37. [Google Scholar] [CrossRef]
  55. Zuraida, A.R.; Fatin, K.; Izzati, L.; Nazreena, O.A.; Omar, N.; Deb, C.R. In Vitro Microrhizome Formation in Kaempferia parviflora. Annu. Res. Rev. Biol. 2015, 5, 460–467. [Google Scholar] [CrossRef]
  56. Zahid, N.A.; Jaafar, H.Z.E.; Hakiman, M. Alterations in Microrhizome Induction, Shoot Multiplication and Rooting of Ginger (Zingiber officinale Roscoe) Var. Bentong with Regards to Sucrose and Plant Growth Regulators Application. Agronomy 2021, 11, 320. [Google Scholar] [CrossRef]
  57. Muñiz García, M.N.; Muro, M.C.; Mazzocchi, L.C.; País, S.M.; Stritzler, M.; Schlesinger, M.; Capiati, D.A. The Protein Phosphatase 2A Catalytic Subunit StPP2Ac2b Acts as a Positive Regulator of Tuberization Induction in Solanum tuberosum L. Plant Mol. Biol. 2017, 93, 227–245. [Google Scholar] [CrossRef] [PubMed]
  58. Yamaguchi, S. Gibberellin Metabolism and Its Regulation. Annu. Rev. Plant Biol. 2008, 59, 225–251. [Google Scholar] [CrossRef]
  59. Roumeliotis, E.; Visser, R.G.F.; Bachem, C.W.B. A Crosstalk of Auxin and GA during Tuber Development. Plant Signal. Behav. 2012, 7, 1360–1363. [Google Scholar] [CrossRef]
  60. David, D.; Ling, E.C.; Jualang Azlan, G. Optimizing Sucrose and BAP Concentrations for in Vitro Microrhizome Induction of Zingiber officinale Rosc. ‘Tambunan’. Malays. Appl. Biol. 2018, 47, 47–52. [Google Scholar]
  61. Yu, S.; Hu, L.; Liu, Y.; Cai, X. In Vitro Microrhizome Production, Genetic Homogeneity Assessment, and Field Performance Evaluation in Ginger. Agronomy 2024, 14, 747. [Google Scholar] [CrossRef]
  62. Yang, Q.; Zhao, D.; Liu, Q. Connections Between Amino Acid Metabolisms in Plants: Lysine as an Example. Front. Plant Sci. 2020, 11, 548590. [Google Scholar] [CrossRef] [PubMed]
  63. Ramaroson, M.L.; Koutouan, C.; Helesbeux, J.J.; Le Clerc, V.; Hamama, L.; Geoffriau, E.; Briard, M. Role of Phenylpropanoids and Flavonoids in Plant Resistance to Pests and Diseases. Molecules 2022, 27, 8371. [Google Scholar] [CrossRef] [PubMed]
  64. Imara, D.A.E.S.; El-Mohammady, M.S.; Hanafy, S.A.; Yousef, R.S. Induction of Resistance and Defense Mechanisms of Geranium Plants Against Root Rot Disease Using Gallic Acid and 3,5-Dinitrobenzoic Acid. Egypt. J. Phytopathol. 2024, 52, 109–150. [Google Scholar] [CrossRef]
  65. Arruda, P.; Neshich, I.P. Nutritional-Rich and Stress-Tolerant Crops by Saccharopine Pathway Manipulation. Food Energy Secur. 2012, 1, 141–147. [Google Scholar] [CrossRef]
  66. Tienaho, J.; Reshamwala, D.; Karonen, M.; Silvan, N.; Korpela, L.; Marjomäki, V.; Sarjala, T. Field-Grown and In Vitro Propagated Round-Leaved Sundew (Drosera rotundifolia L.) Show Differences in Metabolic Profiles and Biological Activities. Molecules 2021, 26, 3581. [Google Scholar] [CrossRef]
  67. Baker, N.R.; Zhalnina, K.; Yuan, M.; Herman, D.; Ceja-Navarro, J.A.; Sasse, J.; Jordan, J.S.; Bowen, B.P.; Wu, L.; Fossum, C.; et al. Nutrient and Moisture Limitations Reveal Keystone Metabolites Linking Rhizosphere Metabolomes and Microbiomes. Proc. Natl. Acad. Sci. USA 2024, 121, e2303439121. [Google Scholar] [CrossRef]
  68. Cohen, S.D.; Kennedy, J.A. Plant Metabolism and the Environment: Implications for Managing Phenolics. Crit. Rev. Food Sci. Nutr. 2010, 50, 620–643. [Google Scholar] [CrossRef]
  69. Asthir, B.; Kaur, G.; Kaur, B. Convergence of Pathways Towards Ascorbate–Glutathione for Stress Mitigation. J. Plant Biol. 2020, 63, 243–257. [Google Scholar] [CrossRef]
  70. Tyburski, J.; Tretyn, A. Ascorbate and Glutathione in Organogenesis, Regeneration and Differentiation in Plant In Vitro Cultures. In Ascorbate-Glutathione Pathway and Stress Tolerance in Plants; Springer: Dordrecht, The Netherlands, 2010; pp. 55–90. [Google Scholar] [CrossRef]
  71. Tan, E.C.; Karsani, S.A.; Foo, G.T.; Wong, S.M.; Abdul Rahman, N.; Khalid, N.; Othman, S.; Yusof, R. Proteomic Analysis of Cell Suspension Cultures of Boesenbergia rotunda Induced by Phenylalanine: Identification of Proteins Involved in Flavonoid and Phenylpropanoid Biosynthesis Pathways. Plant Cell Tissue Organ Cult. 2012, 111, 219–229. [Google Scholar] [CrossRef]
  72. Ata, N.; Yusuf, N.A.; Tan, B.C.; Husaini, A.; Mohd Yusuf, Y.; Majid, N.A.; Khalid, N. Expression Profiles of Flavonoid-Related Gene, 4 Coumarate: Coenzyme A Ligase, and Optimization of Culturing Conditions for the Selected Flavonoid Production in Boesenbergia rotunda. Plant Cell Tissue Organ Cult. 2015, 123, 47–55. [Google Scholar] [CrossRef]
  73. Wang, J.; Lu, W.; Tong, Y.; Yang, Q. Leaf Morphology, Photosynthetic Performance, Chlorophyll Fluorescence, Stomatal Development of Lettuce (Lactuca sativa L.) Exposed to Different Ratios of Red Light to Blue Light. Front. Plant Sci. 2016, 7, 176122. [Google Scholar] [CrossRef]
  74. Mittler, R.; Zandalinas, S.I.; Fichman, Y.; Van Breusegem, F. Reactive Oxygen Species Signalling in Plant Stress Responses. Nat. Rev. Mol. Cell Biol. 2022, 23, 663–679. [Google Scholar] [CrossRef] [PubMed]
  75. Nelson, A.B.; Queathem, E.D.; Puchalska, P.; Crawford, P.A. Metabolic Messengers: Ketone Bodies. Nat. Metab. 2023, 5, 2062–2074. [Google Scholar] [CrossRef] [PubMed]
  76. Holeček, M. Branched-Chain Amino Acids in Health and Disease: Metabolism, Alterations in Blood Plasma, and as Supplements. Nutr. Metab. 2018, 15, 33. [Google Scholar] [CrossRef] [PubMed]
  77. Njus, D.; Kelley, P.M.; Tu, Y.J.; Schlegel, H.B. Ascorbic Acid: The Chemistry Underlying Its Antioxidant Properties. Free Radic. Biol. Med. 2020, 159, 37–43. [Google Scholar] [CrossRef]
  78. Celi, G.E.A.; Gratão, P.L.; Lanza, M.G.D.B.; Reis, A.R. dos. Physiological and Biochemical Roles of Ascorbic Acid on Mitigation of Abiotic Stresses in Plants. Plant Physiol. Biochem. 2023, 202, 107970. [Google Scholar] [CrossRef]
  79. Bhoot, H.R.; Zamwar, U.M.; Chakole, S.; Anjankar, A. Dietary Sources, Bioavailability, and Functions of Ascorbic Acid (Vitamin C) and Its Role in the Common Cold, Tissue Healing, and Iron Metabolism. Cureus 2023, 15, e49308. [Google Scholar] [CrossRef]
  80. Lei, S.; Rossi, S.; Huang, B. Metabolic and Physiological Regulation of Aspartic Acid-Mediated Enhancement of Heat Stress Tolerance in Perennial Ryegrass. Plants 2022, 11, 199. [Google Scholar] [CrossRef] [PubMed]
  81. Lee, D.-Y.; Kim, E.-H. Therapeutic Effects of Amino Acids in Liver Diseases: Current Studies and Future Perspectives. J. Cancer Prev. 2019, 24, 72. [Google Scholar] [CrossRef]
  82. Mohamad, M.H.; Awang, R.; Yunus, W.M.Z.W. A Review of Acetol: Application and Production. Am. J. Appl. Sci. 2011, 8, 1135–1139. [Google Scholar] [CrossRef]
  83. van der Veen, J.N.; Kennelly, J.P.; Wan, S.; Vance, J.E.; Vance, D.E.; Jacobs, R.L. The Critical Role of Phosphatidylcholine and Phosphatidylethanolamine Metabolism in Health and Disease. Biochim. Biophys. Acta Biomembr. 2017, 1859 Pt B, 1558–1572. [Google Scholar] [CrossRef]
  84. Xu, Y.; Fu, X. Reprogramming of Plant Central Metabolism in Response to Abiotic Stresses: A Metabolomics View. Int. J. Mol. Sci. 2022, 23, 5716. [Google Scholar] [CrossRef] [PubMed]
  85. Arruda, P.; Barreto, P. Lysine Catabolism Through the Saccharopine Pathway: Enzymes and Intermediates Involved in Plant Responses to Abiotic and Biotic Stress. Front. Plant Sci. 2020, 11, 535796. [Google Scholar] [CrossRef] [PubMed]
Figure 1. In vitro shoot growth and development of fingerroots after being cultured on ½-strength MS for 4 weeks: (A) control (without hormones); (BD) adding 1, 3, and 5 mg L−1 of BAP, respectively; (EG) adding 1, 3, and 5 mg L−1 of BAP, + 0.1 mg L−1 of NAA, respectively. The white arrow indicates the highest shoot number/explant with more green and healthy shoots (scale bar = 1 cm).
Figure 1. In vitro shoot growth and development of fingerroots after being cultured on ½-strength MS for 4 weeks: (A) control (without hormones); (BD) adding 1, 3, and 5 mg L−1 of BAP, respectively; (EG) adding 1, 3, and 5 mg L−1 of BAP, + 0.1 mg L−1 of NAA, respectively. The white arrow indicates the highest shoot number/explant with more green and healthy shoots (scale bar = 1 cm).
Horticulturae 11 00186 g001
Figure 2. Growth of fingerroot after transplanting: (A) 8 weeks old plants: T1 peat moss, T2 peat moss: coconut coir (1:1), and T3 peat moss: coconut coir (1:2); (B) fingerroot (red arrow), fibrous roots (black arrow), and rhizome (blue arrow) of 16 weeks old plant (scale bar = 3.5 cm in (A) and 3.0 cm in (B)).
Figure 2. Growth of fingerroot after transplanting: (A) 8 weeks old plants: T1 peat moss, T2 peat moss: coconut coir (1:1), and T3 peat moss: coconut coir (1:2); (B) fingerroot (red arrow), fibrous roots (black arrow), and rhizome (blue arrow) of 16 weeks old plant (scale bar = 3.5 cm in (A) and 3.0 cm in (B)).
Horticulturae 11 00186 g002
Figure 3. Gel electrophoresis results of PCR products of four primers: (A) BrotSSR001933; (B) BrotSSR002769; (C) ContiSSR062098; and (D) ContiSSR019224 (M = 100 bp + 1.5 Kb DNA ladder; 1–5 = mother plants; 6–10 = acclimatized plants).
Figure 3. Gel electrophoresis results of PCR products of four primers: (A) BrotSSR001933; (B) BrotSSR002769; (C) ContiSSR062098; and (D) ContiSSR019224 (M = 100 bp + 1.5 Kb DNA ladder; 1–5 = mother plants; 6–10 = acclimatized plants).
Horticulturae 11 00186 g003aHorticulturae 11 00186 g003b
Figure 4. Shoot emergence of fingerroot cultured on ½-strength MS medium supplemented with different concentrations of sucrose and grown under white and red light for 12 weeks (scale bar = 1 cm).
Figure 4. Shoot emergence of fingerroot cultured on ½-strength MS medium supplemented with different concentrations of sucrose and grown under white and red light for 12 weeks (scale bar = 1 cm).
Horticulturae 11 00186 g004
Figure 5. MRZ of fingerroot: (A) MRZ with shoots cultured on medium supplemented with 60 g L−1 of sucrose exposed to white LEDs; (B) different MRZ sizes (scale bar = 0.5 cm).
Figure 5. MRZ of fingerroot: (A) MRZ with shoots cultured on medium supplemented with 60 g L−1 of sucrose exposed to white LEDs; (B) different MRZ sizes (scale bar = 0.5 cm).
Horticulturae 11 00186 g005
Figure 6. 1H NMR median spectrum of fingerroot: (A) field rhizome; (B) MRZ in vitro conditions; and (C) extension of (B).
Figure 6. 1H NMR median spectrum of fingerroot: (A) field rhizome; (B) MRZ in vitro conditions; and (C) extension of (B).
Horticulturae 11 00186 g006aHorticulturae 11 00186 g006b
Figure 7. Graphic of metabolite lists found in the fingerroot field rhizome and MRZ in vitro conditions.
Figure 7. Graphic of metabolite lists found in the fingerroot field rhizome and MRZ in vitro conditions.
Horticulturae 11 00186 g007
Table 1. Summary of spectral data of white and red light LEDs.
Table 1. Summary of spectral data of white and red light LEDs.
MeasurementLight Source
White LEDsRed LEDs
PAR (mW cm−2)0.4756 ± 0.01862 a0.0998 ± 0.0189 b
Average PPFD (µmol m−2 s−1)21.0714 ± 0.8416 a5.3338 ± 0.8428 b
PPFD-Ultraviolet (350–400 nm)
(% UV)
0.003 ± 0.000 a
(1.81%)
0.0002 ± 0.0002 b
(0.01%)
PPFD-Blue (401–500 nm)
(% blue)
5.8908 ± 0.2155 a
(27.96%)
0.004 ± 0.0011 b
(0.07%)
PPFD-G (501–600 nm)
(% green)
10.3586 ± 0.4722 a
(49.16%)
0.046 ± 0.0098 b
(0.86%)
PPFD-R (601–700 nm)
(% red)
4.8222 ± 0.1591 a
(21.07%)
5.2838 ± 0.4045 a
(99.06%)
PPFD-Far-red (701–800 nm)0.2592 ± 0.0181 a0.0012 ± 0.0002 b
Red/Far-red19.135 ± 1.9467 b4791.1 ± 703.0356 a
YPFD (µmol m−2 s−1)18.0146 ± 0.7216 a5.1308 ± 0.3903 b
Number (mean ± SE). Different letters indicate significant differences between groups, as analyzed by LSD (p < 0.05). PAR = photosynthetically active radiation; PPFD = photosynthetic photon flux density; YPFD = yield photon flux density.
Table 2. Effects of BAP with/without NAA at different concentrations on the growth of fingerroot after cultured for 4 weeks.
Table 2. Effects of BAP with/without NAA at different concentrations on the growth of fingerroot after cultured for 4 weeks.
Concentrations
(mg L−1)
Shoots No./
Explant
Shoot
Formation (%)
Shoot Length
(cm)
Leaves No./
Explant
Roots No./
Explant
BAPNAA
--1.92 ± 0.12 cd38 ± 2.40 b4.07 ± 0.42 a1.42 ± 0.17 a4.46 ± 0.53 a
1-3.45 ± 0.29 a69 ± 5.76 a2.21 ± 0.31 c1.12 ± 0.20 ab4.28 ± 0.54 a
3-2.66 ± 0.24 bc43 ± 8.06 b0.93 ± 0.15 e0.62 ± 0.09 cd1.58 ± 0.27 b
5-2.91 ± 0.44 ab51 ± 9.00 b1.00 ± 0.12 e0.68 ± 0.09 cd1.38 ± 0.23 b
10.11.23 ± 0.15 d15 ± 4.38 c1.33 ± 0.19 de0.40 ± 0.12 d1.04 ± 0.37 b
30.11.93 ± 0.24 cd39 ± 4.82 b3.18 ± 0.11 b0.82 ± 0.09 bc1.54 ± 0.24 b
50.11.95 ± 0.25 bcd16 ± 6.62 c2.06 ± 0.25 cd0.63 ± 0.16 cd0.85 ± 0.19 b
LSD (p < 0.05)0.00 (*)0.00 (*)0.00 (*)0.00 (*)0.00 (*)
Number (mean ± SE). Different letters in the same column indicate significant differences (*), as analyzed by LSD (p < 0.05).
Table 3. Effects of planting material on the acclimatization of micropropagated fingerroot plants after 8 weeks of cultivation.
Table 3. Effects of planting material on the acclimatization of micropropagated fingerroot plants after 8 weeks of cultivation.
MaterialsSurvival (%)Mean Plant Height (cm)Number of LeaveChlorophyll
(SPAD Unit)
Peat moss (1)10014.21 ± 1.23 a4.15 ± 0.22 a33.27 ± 2.90 a
Peat moss–coconut coir (1:1)10010.79 ± 0.79 b4.20 ± 0.27 a33.05 ± 1.58 a
Peat moss–coconut coir (1:2)1009.66 ± 1.05 b3.66 ± 0.28 a30.42 ± 1.99 a
LSD (p < 0.05) 0.01 (*)0.28 (ns)0.61 (ns)
Number (mean ± SE). Different letters in the same column indicate significant differences (*), as analyzed by LSD (p < 0.05). ns: non-significant.
Table 4. Data of pH and EC values of planting material before and after planting.
Table 4. Data of pH and EC values of planting material before and after planting.
MaterialspHEC
BeforeAfterBeforeAfter
Peat moss (1)5.075.811.410.38
Peat moss–coco peat (1:1)5.366.090.510.26
Peat moss–coco peat (1:1)5.536.070.430.31
Note: The values were measured from the substrate pool in each treatment.
Table 5. The information and PCR amplification of four SSR primers on fingerroot leaves from mother plants and acclimatized plants via in vitro propagation.
Table 5. The information and PCR amplification of four SSR primers on fingerroot leaves from mother plants and acclimatized plants via in vitro propagation.
Primer IDF (5′–3′)R (5′–3′)PCR Product Size (bp)DNA BandingNo. of Alleles
Mother PlantsAcclimatized Plants
BrotSSR
001933
GTTGATCGGCTGGATCACTTGAAGAGGCTTTGCCTCACTG184, 198++2
BrotSSR
002769
GAAGGTGAAGGAGAAGGGCTCCTCCCCTGTTTCTTCTTCC155, 170++2
ContiSSR
062098
CGTGAGGATGCTAGAGGAGGTCTTCAGCCCTTCGATCACT220++1
ContiSSR
019224
CATCGTCCTCTTCTTCCTCGTGATCCCTCATCGCTCTCTT268++1
Note: The + sign is the formation of a DNA band if there is no DNA band as a mark.
Table 6. Effects of different light qualities and sucrose concentrations on the MRZ induction of fingerroot after being cultured on ½-strength MS supplemented with 1 mg L−1 BAP for 12 weeks.
Table 6. Effects of different light qualities and sucrose concentrations on the MRZ induction of fingerroot after being cultured on ½-strength MS supplemented with 1 mg L−1 BAP for 12 weeks.
DataSucrose (B) (g L−1)Light (A)Mean (B)
WhiteRed
MRZ formation (%)3098.33 ± 1.67 a66.67 ± 2.11 b82.50 ± 4.94 a
6075.00 ± 2.24 b48.33 ± 3.07 cd61.67 ± 4.41 b
9055.00 ± 2.24 c45.00 ± 7.19 d50.00 ± 3.89 c
Mean (A)76.11 ± 4.44 a53.33 ± 3.43 b
LSD (p < 0.05)Light (A)0.00 (*)
Sugar (B)0.00 (*)
A × B0.01 (*)
MRZ diameter (cm)300.589 ± 0.043 c0.812 ± 0.034 ab0.727 ± 0.037 a
600.773 ± 0.067 ab0.647 ± 0.064 bc0.761 ± 0.042 a
900.910 ± 0.120 a0.647 ± 0.051 bc0.800 ± 0.065 a
Mean (A)0.768 ± 0.048 a0.757 ± 0.027 a
LSD (p < 0.05)Light (A)0.839 (ns)
Sugar (B)0.529 (ns)
A × B0.001 (*)
MRZ fresh weight/replication (g)300.168 ± 0.012 b0.163 ± 0.020 b0.199 ± 0.010 b
600.313 ± 0.041 ab0.284 ± 0.104 ab0.362 ± 0.038 a
900.406 ± 0.097 a0.162 ± 0.045 b0.322 ± 0.051 a
Mean (A)0.302 ± 0.033 a0.287 ± 0.029 a
LSD (p < 0.05)Light (A)0.064 (ns)
Sugar (B)0.001 (*)
A × B0.012 (*)
MRZ dry weight/replication
(g)
300.036 ± 0.002 c0.048 ± 0.004 bc82.50 ± 4.94 a
600.086 ± 0.009 ab0.085 ± 0.019 ab61.67 ± 4.41 b
900.116 ± 0.026 a0.058 ± 0.013 bc50.00 ± 3.89 c
Mean (A)0.082 ± 0.009 a0.087 ± 0.007 a
LSD (p < 0.05)Light (A)0.543 (ns)
Sugar (B)0.000 (*)
A × B0.006 (*)
Number of shoots/explant301.89 ± 0.05 a1.42 ± 0.06 bc0.727 ± 0.037 a
602.02 ± 0.08 a1.44 ± 0.31 b0.761 ± 0.042 a
901.06 ± 0.04 c0.00 ± 0.00 d0.800 ± 0.065 a
Mean (A)1.66 ± 0.11 a0.95 ± 0.19 b
LSD (p < 0.05)Light (A)0.00 (*)
Sugar (B)0.00 (*)
A × B0.06 (*)
Shoot length
(cm)
309.91 ± 0.23 a9.47 ± 0.32 a9.69 ± 0.20 a
606.52 ± 0.17 b3.67 ± 0.48 c5.09 ± 0.49 b
901.03 ± 0.13 d0.00 ± 0.00 e0.52 ± 0.17 c
Mean (A)5.82 ± 0.89 a4.38 ± 0.96 b
LSD (p < 0.05)Light (A)0.00 (*)
Sugar (B)0.00 (*)
A × B0.00 (*)
Number (mean ± SE): different letters indicate significant differences (*) between groups analyzed by LSD (p < 0.05). ns: non-significant.
Table 7. Potential roles of important metabolites unique to MRZ.
Table 7. Potential roles of important metabolites unique to MRZ.
MetabolitesFunctions in PlantFunctions and Possibility for Medicinal Applications
3-Hydroxyisobutyrate and
3-hydroxybutyrate
Signaling molecules in response to environmental stresses, such as nutrient limitation or oxidative stress [74].Involved in energy metabolism and neuroprotective and anti-inflammatory effects [75].
3-Methyl-2-oxovalerateInvolved in the catabolism of the essential amino acid isoleucine and linked to metabolic pathways that help plants adjust to biotic stresses [76].Derivatives play roles in muscle maintenance and protein synthesis [76].
AscorbatePowerful antioxidant crucial for detoxifying reactive oxygen species (ROS) [77], a potential enhancement of antioxidant activity in B. rotunda MRZ [78].Recognized for its immune-boosting and skin-protective properties. Has a role in collagen synthesis and wound healing in humans [79].
AspartateAmino acid in nitrogen metabolism and essential for synthesizing other amino acids, such as asparagine, lysine, and methionine, which contribute to various growth and stress responses [80].Supporting liver function and assisting in muscle recovery due to its involvement in protein synthesis and cellular energy production [81].
Hydroxy acetoneServe as a carbon source for cellular respiration [82].Applications related to skin health due to its moisturizing and gentle exfoliating effects [82].
O-PhosphocholineIntermediate in phospholipid metabolism and significant in cell membrane stability and signaling [83]. Responds to abiotic stressorsInvolved in inflammatory processes and have a potential role in anti-cancer therapies [84].
Saccharopineintermediate in the lysine degradation pathway and associated with plant responses to stress and osmotic balance [85].Linked to energy production and nitrogen balance and may have neuroprotective effects and potential applications in neuromodulatory therapies, particularly given its role in stress responses [85].
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Thepthong, K.; Kanjanawattanawong, S. In Vitro Production of Plantlets and Microrhizomes, Genetic Fidelity Assessment, and Metabolic Profiling of Boesenbergia rotunda (L.) Mansf. Horticulturae 2025, 11, 186. https://doi.org/10.3390/horticulturae11020186

AMA Style

Thepthong K, Kanjanawattanawong S. In Vitro Production of Plantlets and Microrhizomes, Genetic Fidelity Assessment, and Metabolic Profiling of Boesenbergia rotunda (L.) Mansf. Horticulturae. 2025; 11(2):186. https://doi.org/10.3390/horticulturae11020186

Chicago/Turabian Style

Thepthong, Kankamon, and Supanath Kanjanawattanawong. 2025. "In Vitro Production of Plantlets and Microrhizomes, Genetic Fidelity Assessment, and Metabolic Profiling of Boesenbergia rotunda (L.) Mansf." Horticulturae 11, no. 2: 186. https://doi.org/10.3390/horticulturae11020186

APA Style

Thepthong, K., & Kanjanawattanawong, S. (2025). In Vitro Production of Plantlets and Microrhizomes, Genetic Fidelity Assessment, and Metabolic Profiling of Boesenbergia rotunda (L.) Mansf. Horticulturae, 11(2), 186. https://doi.org/10.3390/horticulturae11020186

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop