Next Article in Journal
Ethephon-Induced Abscission of Oil Palm Fruits at Optimal Bunch Ripeness and Retting Period to Improve Commercial Seed Production
Next Article in Special Issue
Overcoming Pre-Fertilization Barriers in Intertribal Crosses between Anemone coronaria L. and Ranunculus asiaticus L.
Previous Article in Journal
Effect of Foliar Supplied PGRs on Flower Growth and Antioxidant Activity of African Marigold (Tagetes erecta L.)
Previous Article in Special Issue
Morphological Characterization of Tetraploids of Limonium sinuatum (L.) Mill. Produced by Oryzalin Treatment of Seeds
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 7
Issue 10
10.3390/horticulturae7100379
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Dehydrins and Soluble Sugars Involved in Cold Acclimation of Rosa wichurana and Rose Cultivar ‘Yesterday’

by
Lin Ouyang
1,2,*,
Leen Leus
3,
Ellen De Keyser
3 and
Marie-Christine Van Labeke
2
1
Institute of Urban Agriculture, Chinese Academy of Agricultural Sciences, 99 Hupan West Road, Tianfu New Area, Chengdu 610000, China
2
Department of Plants and Crops, Ghent University, Coupure Links 653, 9000 Ghent, Belgium
3
Plant Sciences Unit, Flanders Research Institute for Agriculture, Fisheries and Food (ILVO), Caritasstraat 39, 9090 Melle, Belgium
*
Author to whom correspondence should be addressed.
Horticulturae 2021, 7(10), 379; https://doi.org/10.3390/horticulturae7100379
Submission received: 30 August 2021 / Revised: 30 September 2021 / Accepted: 1 October 2021 / Published: 8 October 2021
(This article belongs to the Special Issue Breeding, Genetics and Genomics of Ornamental Plants)
Browse Figures
Versions Notes

Abstract

:
Rose is the most economically important ornamental plant. However, cold stress seriously affects the survival and regrowth of garden roses in northern regions. Cold acclimation was studied using two genotypes (Rosa wichurana and R. hybrida ‘Yesterday’) selected from a rose breeding program. During the winter season (November to April), the cold hardiness of stems, soluble sugar content, and expression of dehydrins and the related key genes in the soluble sugar metabolism were analyzed. ‘Yesterday’ is more cold-hardy and acclimated faster, reaching its maximum cold hardiness in December. R. wichurana is relatively less cold-hardy, only reaching its maximum cold hardiness in January after prolonged exposure to freezing temperatures. Dehydrin transcripts accumulated significantly during November–January in both genotypes. Soluble sugars are highly involved in cold acclimation, with sucrose and oligosaccharides significantly correlated with cold hardiness. Sucrose occupied the highest proportion of total soluble sugars in both genotypes. During November–January, downregulation of RhSUS was found in both genotypes, while upregulation of RhSPS was observed in ‘Yesterday’ and upregulation of RhINV2 was found in R. wichurana. Oligosaccharides accumulated from November to February and decreased to a significantly low level in April. RhRS6 had a significant upregulation in December in R. wichurana. This study provides insight into the cold acclimation mechanism of roses by combining transcription patterns with metabolite quantification.

1. Introduction

Rose is the most economically important ornamental plant. For garden roses grown in northern regions (Northern Europe, North China, Russia, the northern regions of the US and Canada), winter temperatures restrict the geographical distribution and affect winter survival, growth, and ornamental quality of garden roses. Breeding for improved cold hardiness would allow roses to survive wintry temperatures without extra protection, an important selling point for gardeners in colder regions. The study of the mechanisms involved in cold acclimation can help future varietal development in breeding programs as well as the selection of cold-hardy garden roses. Woody plants have evolved the ability to adapt to low temperatures and develop cold hardiness. Cold hardiness has a seasonal dynamic characterized by three phases: cold acclimation during autumn–winter, mid-winter hardiness (maximum level of cold hardiness), and deacclimation (loss of tolerance) during winter–spring. Evaluation of cold hardiness using electrolyte leakage analysis is a reliable method for the stems of woody plants [1,2]. Low temperatures can lead to the loss of membrane integrity, resulting in cellular damage and solute leakage across the membrane. The level of electrolyte leakage is related to the freezing temperatures and cold tolerance of plants.
Cold acclimation, the process by which the plant achieves cold hardiness/freezing tolerance, is associated with a wide spectrum of physiological and biochemical changes that occur in response to the decrease of photoperiod, light intensity and temperatures [3,4,5,6]. The most prominent changes during cold acclimation include growth reduction, a decrease in tissue water content, changes in membrane lipid compositions, induction of stress proteins, accumulation of osmolytes (soluble sugars, proline, betaine, etc.), and enhancement of the antioxidant system [7,8,9,10,11]. These changes are the results of genetic adjustments starting from the signal perception and transduction to transcriptional regulation, and finally to downstream stress-responsive gene expression [12,13].
Dehydrins are highly hydrophilic proteins which belong to the late embryo-abundant (LEA and LEA-like) II group of proteins. They play multiple roles in enhancing freezing tolerance, including cryoprotection of enzymes, stabilization of cell membranes, protection of cellular components, and scavenging reactive oxygen species [14,15]. It is assumed that they repair the rigidity of the membrane by forming amphipathic α-helices to stabilize cell membranes [16,17]. Dehydrins may also prevent freeze-induced dehydration by interacting with soluble sugars in the cells [18]. This interaction may be due to the information of stable glasses [19]. The accumulation of both soluble sugars and cold stress proteins is necessary to achieve the maximum cold hardiness [20].
Soluble sugars contribute to the plant’s cold hardiness level by protecting cells from freezing injury in a number of ways. Soluble sugars that function as compatible solutes (osmolytes) can stabilize the osmotic potential of cells and prevent an excessive water loss to the apoplast space, resulting in the enlargement of ice crystals. An accumulation of soluble sugars increases solute concentration and thus drops the freezing point of cells [7]; this has been observed in both herbaceous and woody plants during cold acclimation [21,22,23,24]. Soluble sugars can act as cryoprotectants, protecting cell membranes by interacting with lipid molecules [25] and protecting specific enzymes during cold-induced dehydration. Sugars may also stabilize the cell membranes by interacting with lipid molecules [26]. Several essential genes involved in the metabolism of soluble sugars were found to be responsive to cold stress: sucrose synthase (SUS), sucrose-phosphate synthase (SPS), and invertase (INV) in the sucrose metabolism pathway [27,28]; raffinose synthase (RS) and galactinol (Gols) in the RFOs (raffinose family oligosaccharides) synthesis pathway [29,30,31].
In the present study, two garden roses with distinct genetic backgrounds (one rose species (R. wichurana) and one rose cultivar (R. hybrida ‘Yesterday’)) were selected to study cold acclimation under natural conditions. This study revealed both biochemical and molecular mechanisms involved in cold acclimation of two different rose genotypes, with a main focus on the role of dehydrins and cryoprotective soluble sugars.

2. Materials and Methods

2.1. Plant Material and Experimental Field Condition

R. wichurana is one of the wild rose species. R. hybrida ‘Yesterday’, bred by Harkness (United Kingdom, 1974), is one of the modern rose cultivars and belongs to the rose type Polyantha. Both genotypes are diploid roses. The coldest USDA (United States Department of Agriculture) plant hardiness zone of R. wichurana is 5b (−26.1 to −23.3 °C); the hardiness zone for ‘Yesterday’ is 4b (31.7 to −28.9 °C) (http://www.helpmefind.com/rose/index.php; accessed on 4 October 2021). Plant material for R. wichurana and ‘Yesterday’ started as rooted cuttings in summer 2014. The experiment was conducted at ILVO (Melle, Belgium, 51°0′ N, 3°48′ E). The roses were planted outdoors in February 2015 in light sandy loam soil (pHKCl 5.67, the organic matter 1.35%) and pruned in March 2015 to allow new shoots to grow. A randomized block design was arranged in two blocks; each block included 30 plants per genotype. Stems that emerged during that season were sampled on 19 November 2015, 14 December 2015, 20 January 2016, 19 February 2016, 14 March 2016, and 18 April 2016. Sampled stems were transferred on ice to the laboratory.

2.2. Controlled Freezing Test

Cold hardiness as evaluated by LT50 was conducted using a controlled freezing test (n = 5). Internodal stem segments (0.5 cm long) were taken from the middle part of the current-year stem. Stem segments were placed in a cryostat (Polystat 37, Fisher Scientific, Merelbeke, Belgium) from 0 °C to seven target temperatures (−5, −10, −15, −20, −25, −30, −35, and −80 °C) at a cooling rate of 6 °C h−1 (0.1 °C min−1). The detailed protocol of the controlled freezing test was described by Ouyang et al. [32]. Index of injury (It) based on electrolyte leakage (EL) values were calculated according to Flint et al. [33] and transformed into the adjusted It value taking into account the It at −80 °C [34]. LT50 values were calculated from the injury versus temperature plot using logistic regression.

2.3. Soluble Sugars

Stem tissue samples of each replicate representing a balanced mix of the apical, median, and basal zone were ground in liquid nitrogen with a mill (IKA® A11 Basic Analytical Mill, Staufen, Germany). The analysis was done in five replicates for each genotype. Soluble sugars were extracted as described in Ouyang et al. [32]. Sucrose, hexoses (glucose and fructose), and oligosaccharides (raffinose and stachyose) were quantified via high-performance anion-exchange chromatography with pulsed amperometric detection (ACQUITY UPLC H-Class, Waters, Milford, MA, USA) using a CarboPac PA-20 analytical column and companion guard column of Dionex (Thermo Fisher Scientific, Sunnyvale, CA, USA) and an eluent of 50 mM NaOH at 22 °C.

2.4. RNA Extraction and Reverse Transcription

Stem tissue samples of each replicate representing a balanced mix of the apical, median, and basal zone were ground in liquid nitrogen. The analysis was done in three replicates for each genotype. Each replicate of the RNA sample was extracted from 100 mg of the ground tissue sample in 700 μL extraction buffer using a CTAB protocol. The RNA quality was controlled and tested by the NanoDrop (ND-1000) spectrophotometer (Isogen Life Science, Utrecht, The Netherlands). The RNA quality was further determined by the ExperionTM Automated Electrophoresis System and RNA StdSens Chips (Bio-Rad Laboratories N.V., Temse, Belgium) with a random selection of about 10% of total samples spread over the two genotypes and sampling points. RNA samples (starting from 550 ng of RNA) were converted to single-stranded cDNA using the iScriptTM cDNA Synthesis Kit (Bio-Rad Laboratories N.V., Temse, Belgium). Detailed protocols were based on Luypaert et al. [35].

2.5. Gene Isolation and Expression

Candidate genes associated with dehydrins and soluble sugar metabolism were selected according to the literature (Table 1). These homologous sequences were locally BLASTed against the ILVO Rosa hybrida transcriptome database in CLCbio. This transcriptome database was built based on transcriptomic data of R. wichurana and ‘Yesterday’. BLASTx [36] was used to confirm fragment identity. Several dehydrins were found, but only RhDHN5 and RhDHN6 were expressed and thus retained for further study. Four key genes involved in the soluble sugar metabolism were studied—including RhSPS1, RhSUS, and RhINV2 in the sucrose metabolism pathway, and RhRS6 in the RFOs (raffinose family oligosaccharides) synthesis pathway (Table 1). RT-qPCR primers of target genes were designed using Primer3Plus software [37] (Table 2). The RT-qPCR analysis was performed as described in Luypaert et al. [35]. Candidate reference genes (PGK, RPS18c, 2-UBC9, APT1, ACT, CAB, HMG1, HSP81, MDHC1, RBCS1A, and TUB) were chosen from Pipino [38]. GeNorm analysis was conducted based on Vandesompele et al. [39], and gene-specific amplification efficiencies were determined by LinRegPCR according to Ruijter et al. [40] (Table 2). A normalization factor based on three validated reference genes (PGK, PRS18c, and 2-UBC9) was used for the calculation of calibrated normalized relative quantities (CNRQ) in the qbase+ software (Biogazelle, Ghent, Belgium) [41]. CNRQ values were exported to Microsoft Excel. Biological replicates were averaged geometrically.

2.6. Statistical Analysis

The homoscedasticity of data was checked by Levene’s test (p ≥ 0.01) before performing a one-way analysis of variance (ANOVA). LT50 and soluble sugars were analyzed with a one-way ANOVA and the accompanying Scheffé’s post-hoc test (p = 0.05). CNRQ values were log-transformed. Gene expression was analyzed using one-way ANOVA with a Scheffé’s post-hoc test at a 0.05 significance level; if homoscedasticity of data was not fulfilled, a Kruskal–Wallis test was performed (p = 0.05). Statistics were analyzed in SPSS Statistics 24.0, and all figures were performed in SigmaPlot 13.0. Gene expression graphs are made according to non-log transformed data. Correlation analysis between LT50 and the concentration of sugars and between LT50 and gene expression were conducted by Spearman’s two-tailed test (p = 0.05).

3. Results

3.1. Air Temperature and Day Length Condition

Cold hardiness of woody plants is a seasonal dynamic process including three phases: acclimation, mid-winter hardiness and deacclimation. As the process is mainly influenced by changes in temperature and photoperiod, the mean temperature and day length were recorded seven days before the sampling points. The air temperature was monitored on location at 30-min intervals by a sensor integrated into a weather station (HortiMaX, Maasdijk, The Netherlands) and installed near the trial field at ILVO (Melle, Belgium, 51°0′ N, 3°48′ E) on the greenhouse roof, 5 m above the ground level. Data for day length at Melle was based on information found at https://www.timeanddate.com (accessed on 4 October 2021).
The average temperatures dropped from 9.9 °C in November to 5.5 °C in December and dropped further to below zero in January (−2 °C) and February (−1.8 °C). In March the mean temperature increased to −0.1 °C then rose sharply to 5.2 °C in April. Negative minimum temperatures were noted in January, February, and March. Day length shifted from 8 h 57 min in November to 8 h 2 min in December and then lengthened to 13 h 48 min at the end of April.

3.2. Cold Hardiness

Seasonal changes in cold hardiness as estimated by LT50 values (i.e., the temperature that causes 50% of injury) are given in Figure 1. LT50 values decreased from November to December/January, remained relatively low in February-March, and increased to April. A significantly lower LT50 value of −26.4 °C was found in December for ‘Yesterday’ (p < 0.05) compared to that in other months. This indicates a strong and fast acclimation pattern, with the highest cold hardiness achieved in early winter. In contrast with ‘Yesterday’, R. wichurana developed maximum cold hardiness later in January and reached a lower mid-winter hardiness of −20.1 °C. It can be concluded that ‘Yesterday’ has a fast acclimation and is relatively more cold-hardy than R. wichurana. A certain degree of deacclimation of both genotypes was observed during January–March with a strong deacclimation observed in April.

3.3. Expression Analysis of Dehydrins

The expression of RhDHN5 and RhDHN6 was induced from November to January in both genotypes (Figure 2). High transcript abundance was observed in the more cold-hardy genotype ‘Yesterday’ during this period, indicating a higher induction when compared to that during February-April. The expression of RhDHN5 and RhDHN6 showed a similar seasonal pattern in R. wichurana, although transcript levels were lower than in ‘Yesterday’. In addition, the expression levels of RhDHN5 and RhDHN6 in ‘Yesterday’ from November to January were much higher than those in R. wichurana, which corresponds to the stronger development of cold hardiness (lower LT50 value) observed in ‘Yesterday’ during the same period. No significant correlations between gene expression of dehydrins and LT50 were observed in either genotype.

3.4. Soluble Sugars

Sucrose represented the largest proportion of total soluble sugars in the test season (Figure 3). In ‘Yesterday’, the proportion of sucrose was highest in November and December at around 75%, followed by a slight decrease to 66.3–69.8% during January-February. After a recovery in March, the proportion of sucrose dropped to 53.5% in April. In R. wichurana, the proportion of sucrose increased sharply from 41.3% in November to 62.0% in December and remained relatively stable during December-April, varying between 61.9–65.2%. A negative correlation between sucrose and LT50 value was detected in ‘Yesterday’ (r = 0.42, p < 0.05).
The second-largest proportion of total soluble sugars were hexoses, measured in the range of 15.3–46.0% in ‘Yesterday’ and 30.0–50.3% in R. wichurana (Figure 3).
Oligosaccharides, including raffinose and stachyose, were the least abundant sugars (< 10%) in both genotypes (Figure 3). In ‘Yesterday’, oligosaccharides accumulated during December–February, measured at 7.8–9.5%. In R. wichurana, a higher proportion of oligosaccharides (6.7–8.4%) was also observed in November–February. In April, the oligosaccharide fraction was only 0.5% and 0.8% in ‘Yesterday’ and R. wichurana, respectively. Furthermore, oligosaccharides showed a significant negative correlation with LT50 value for both ‘Yesterday’ (r = −0.70, p < 0.01) and R. wichurana (r = −0.68, p < 0.01).

3.5. Expression Analysis of Sugar Metabolism-Related Genes

Sucrose is synthesized by SPS in the cytosol and is degraded either by SUS or by INV into hexoses or derivatives. The expression pattern of RhSPS1, RhSUS, and RhINV2 is given in Figure 4a–c, respectively. For ‘Yesterday’, the expression of RhSPS1 was upregulated from November to January; however, transcripts of RhSPS1 were hardly detectable in R. wichurana. RhSUS transcripts were low during November-January for the two genotypes but increased towards April. This upregulation of RhSUS was pronounced for the cold-hardy genotype of ‘Yesterday’. For R. wichurana, the expression of RhINV2 was induced during November–December and decreased after January. In contrast, for ‘Yesterday’ the expression of RhINV2 remained relatively stable during cold acclimation. Raffinose synthase (RS) is a critical gene in the RFOs (raffinose family oligosaccharides) pathway. However, the four-fold upregulation of RhRS6 was found only in the less cold-hardy genotype R. wichurana in December as compared to November and January (Figure 4d). No significant correlations were found between the expression levels of sugar metabolism-related genes and LT50 values in ‘Yesterday’ and R. wichurana.

4. Discussion

Breeding of roses with a strong freezing tolerance is necessary for application in northern climates. Cold acclimation, the ability to adapt to seasonal changes in temperature, is a prerequisite for perennial plants in temperate and boreal climate zones. Cold acclimation depends on various biochemical adaptations. The present study focused on two crucial metabolic pathways: cryoprotective dehydrins and soluble sugars.
The cold hardiness of ‘Yesterday’ and R. wichurana conforms to the seasonal dynamic shown in most plants. It is characterized by three phases: cold acclimation, mid-winter hardiness, and deacclimation. Two patterns of cold acclimation were observed in the roses under study. ‘Yesterday’ had a fast acclimation, reaching its highest cold hardiness level in December, despite the relative lack of sub-zero temperatures. In contrast, R. wichurana reached its highest cold hardiness level in January when the average minimum temperature was below zero, suggesting that freezing events are needed for the full development of cold hardiness in this less cold-hardy genotype. The observation that ‘Yesterday’ with a higher maximum hardiness level is more cold-hardy than R. wichurana, conforms the published cold hardiness (USDA zone) information. The rate of deacclimation is reported as being relatively faster than cold acclimation [44], which was also confirmed in our study: the rising temperature in March–April resulted in a sharp rise of LT50 and loss of cold hardiness. A faster deacclimation was found in the more cold-hardy genotype ‘Yesterday’. Rapid deacclimation has also been observed in other woody ornamentals, indicating that the pace of deacclimation is not correlated to maximum cold hardiness [45,46].
The first dehydrin (ppdhn1) found in peach (Prunus persica) has higher transcript levels in bark tissue during autumn and early winter [42]. We have identified RhDHN5/6, which are homologues of ppdhn1, in rose. As in peach, our results also show significant upregulation in rose during the period from November to January (Figure 2). Dehydrins in rose respond strongly to low temperatures, as also found in the bark tissue of apple (Rosaceae family) where 5 °C induced transcript levels ranging from 15-fold (MdDhn3) to a maximum of 122-fold (MdDhn1) [47]. From February to April, the decrease of RhDHN5 and RhDHN6 was associated with deacclimation; this correlation has also been observed in blueberry and Scots pine [48,49]. The seasonal pattern of dehydrin genes/proteins is also reported in different tissues (leaves, stem, and floral buds) of woody plants (e.g., apple, peach, birch, Rhododendron) during the overwintering process [50,51,52,53,54]. The observed seasonal dynamic of dehydrins in rose showed a positive relation to the changing pattern of cold hardiness level (determined by LT50), suggesting that dehydrins might be closely associated with the freezing tolerance of rose. In Scots pine, several dehydrin genes belong to the top 50 genes. Dehydrins correlate significantly with cold hardiness of Scots pine, and were therefore selected as a marker candidate for frost tolerance in this species [55].
Soluble sugars act as osmoregulators/osmolytes under cold stress. They stabilize osmotic potential, reduce cellular dehydration, protect macromolecules, and serve as scavengers of reactive oxygen species [5,21].
Sucrose is the principal agent in cell membranes protection, as its hydroxyl groups replace water in the phospholipid groups of the membrane. The accumulation of sucrose is essential for cold acclimation [18,56]. For ‘Yesterday’, the proportion of sucrose is relatively higher in the months of November and December and much lower in April, consistent with their cold hardiness pattern. For R. wichurana, the proportion of sucrose gradually increased to a maximum in December, with a slight decrease noted from January to April. This slower increase and decrease of sucrose proportion are also in accordance with the rather late response of cold acclimation and deacclimation found in R. wichurana. The correlation between sucrose and LT50 values in ‘Yesterday’ also indicate the important role of sucrose in the development of cold hardiness. The proportion of hexoses showed a reverse seasonal pattern compared to sucrose in both rose genotypes: hexoses decreased during cold acclimation and increased during deacclimation (especially in April). Compared to sucrose and raffinose, hexoses have a lower cryoprotective efficiency [57]. Oligosaccharides act as osmoprotectants and are strongly associated with the development of cold hardiness in many woody plants [58,59,60]. In both rose genotypes, although oligosaccharides (raffinose + stachyose) were the least abundant sugars (<10%), the accumulation of oligosaccharides during cold acclimation was prominent, while these sugars were hardly detectable in April showing a strong association with cold hardiness (Figure 3). In addition, the prominent correlation between oligosaccharides and LT50 values in both genotypes showed that oligosaccharides are closely associated with cold hardiness.
SPS (sucrose-phosphate synthase) is involved in the biosynthesis of sucrose in the cytosol. The upregulation of RhSPS1 was clearly detected in the more cold-hardy genotype ‘Yesterday’ during acclimation. Increased activities of SPS were also observed during cold acclimation in poplar [61]. Consistent with these observations, the induction of RhSPS1 is also associated with the apparent increase of sucrose proportion in the stem tissue of ‘Yesterday’ during November-February (Figure 3a). SUS (sucrose synthase) is associated with both sucrose synthesis and degradation but its main function is the cleavage of sucrose [62]. A similar expression pattern of RhSUS was found in both genotypes: it was suppressed during cold acclimation and increased steadily from February to April (Figure 4b). This regulation of RhSUS may help the plants to maintain a higher level of sucrose during cold acclimation (Figure 3). INVs (invertases) can cause the cleavage of sucrose into glucose and fructose and are classified into three forms based on their subcellular location, namely cell wall invertases, cytoplasmic invertases, and vacuolar invertases [28]. According to the BLASTx result, RhINV2 might be vacuolar invertase. The upregulation of RhINV2 in R. wichurana might enable the less cold-hardy genotype to maintain sufficient monosaccharide levels to support different functions in the cell. However, the lack of upregulation of RhINV2 in ‘Yesterday’ may help the cold-hardy genotype to keep higher sucrose levels (Figure 3a). RS encodes the enzyme of the rate-limiting step in raffinose biosynthesis, and its regulation precedes the biosynthesis of raffinose [63]. However, the strong upregulation of RhRS6 was only observed in R. wichurana in December, and the regulation pattern of RhRS6 cannot fully reflect the accumulation of oligosaccharides which may be due to either a long sampling period or temperature fluctuations in the field. Furthermore, the present study focused on one raffinose synthase gene that was reported to be closely associated with cold hardiness in tea plants [43]. Further study of gene families of RS or other key genes related to the RFOs synthesis pathway might provide better explanation of the prominent accumulation of oligosaccharides during cold acclimation.

5. Conclusions

A seasonal dynamic of cold hardiness (cold acclimation, mid-winter hardiness, and deaaclimation) is found in two rose genotypes that showed different patterns of cold acclimation. ‘Yesterday’ acclimated faster and achieved its maximum cold hardiness in December, while R. wichurana acclimated relatively slowly, only reaching its highest cold hardiness level in January. The accumulation of dehydrins in two genotypes may be closely associated with their cold acclimation. Dehydrin transcripts (RhDHN5 and RhDHN6) accumulated significantly during November–January, with more pronounced accumulation in the more cold-hardy genotype ‘Yesterday’. The proportion of sucrose and oligosaccharides increased during cold acclimation in both genotypes. However, the accumulation patterns were different, possibly due to the distinct expression patterns of essential genes involved in their pathway. Sucrose and oligosaccharides are involved in cold acclimation and are associated with cold hardiness. The differences in gene regulation in the two genotypes may be due to their distinct genetic backgrounds, which led to different adaptation strategies to cold stress. A better understanding of the underlying biochemical and molecular mechanisms involved in the cold acclimation of roses will help to select hardy roses in breeding programs. In the present study, we found that dehydrins and soluble sugars played an important role in the process of cold acclimation. Sucrose and oligosaccharides are significantly associated with cold hardiness of Yesterday and R. wichurana.

Author Contributions

L.O. and M.-C.V.L. planned the experiment. L.O. conducted the experiment and analyzed all the data. L.O. and M.-C.V.L. interpreted the data. L.O. wrote the manuscript. M.-C.V.L., L.L. and E.D.K. revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Sichuan Science and Technology Program, grant number 2021JDRC0140 and The Agricultural Science and Technology Innovation Program (34-IUA-05).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All-new research data were presented in this contribution.

Acknowledgments

We acknowledge Pheno Geno Roses. BV (The Netherlands) for providing the rose material, Magali Losschaert for assistance during RT-qPCR analysis, Christophe Petit for technical support, and Miriam Levenson for English style corrections.

Conflicts of Interest

The authors have declared that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Jun, S.H.; Yu, D.J.; Hur, Y.Y.; Lee, H.J. Identifying reliable methods for evaluating cold hardiness in grapevine buds and canes. Hortic. Environ. Biotechnol. 2021. [Google Scholar] [CrossRef]
  2. Kovaleski, A.P.; Grossman, J.J. Standardization of electrolyte leakage data and a novel liquid nitrogen control improve measurements of cold hardiness in woody tissue. Plant Methods 2021, 17, 1–20. [Google Scholar] [CrossRef]
  3. Huner, N.P.; Öquist, G.; Sarhan, F. Energy balance and acclimation to light and cold. Trends Plant Sci. 1998, 3, 224–230. [Google Scholar] [CrossRef]
  4. Welling, A.; Moritz, T.; Palva, E.T.; Junttila, O. Independent activation of cold acclimation by low temperature and short photoperiod in hybrid aspen. Plant Physiol. 2002, 129, 1633–1641. [Google Scholar] [CrossRef] [Green Version]
  5. Theocharis, A.; Clément, C.; Barka, E.A. Physiological and molecular changes in plants grown at low temperatures. Planta 2012, 235, 1091–1105. [Google Scholar] [CrossRef]
  6. Liu, B.; Xia, Y.-P.; Krebs, S.L.; Medeiros, J.; Arora, R. Seasonal responses to cold and light stresses by two elevational ecotypes of Rhododendron catawbiense: A comparative study of overwintering strategies. Environ. Exp. Bot. 2019, 163, 86–96. [Google Scholar] [CrossRef]
  7. Levitt, J. Chilling, Freezing, and High Temperature Stresses. In Responses of Plants to Environmental Stresses, 2nd ed.; Levitt, J., Ed.; Academic Press: New York, NY, USA, 1980; Volume 1, pp. 1–497. [Google Scholar]
  8. Uemura, M.; Joseph, R.A.; Steponkus, P.L. Cold Acclimation of Arabidopsis thaliana (Effect on plasma membrane lipid composition and freeze-induced lesions). Plant Physiol. 1995, 109, 15–30. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Luo, L.; Lin, S.-Z.; Zheng, H.-Q.; Lei, Y.; Zhang, Q.; Zhang, Z.-Y. The role of antioxidant system in freezing acclimation-induced freezing resistance of Populus suaveolens cuttings. For. Stud. China 2007, 9, 107–113. [Google Scholar] [CrossRef]
  10. Gusta, L.V.; Wisniewski, M. Understanding plant cold hardiness: An opinion. Physiol. Plant. 2012, 147, 4–14. [Google Scholar] [CrossRef] [PubMed]
  11. Masocha, V.F.; Li, Q.; Zhu, Z.; Chai, F.; Sun, X.; Wang, Z.; Yang, L.; Wang, Q.; Xin, H. Proteomic variation in Vitis amurensis and V. vinifera buds during cold acclimation. Sci. Hortic. 2019, 263, 109143. [Google Scholar] [CrossRef]
  12. Wisniewski, M.; Nassuth, A.; Arora, R. Cold hardiness in trees: A mini-review. Front. Plant Sci. 2018, 9, 1394. [Google Scholar] [CrossRef]
  13. Horvath, D.P.; Zhang, J.; Chao, W.S.; Mandal, A.; Rahman, M.; Anderson, J.V. Genome-wide association studies and transcriptome changes during acclimation and deacclimation in divergent Brassica napus varieties. Int. J. Mol. Sci. 2020, 21, 9148. [Google Scholar] [CrossRef]
  14. Burchett, S.; Niven, S.; Fuller, M.P. The effect of cold acclimation on the water relations and freezing tolerance of Hordeum vulgare L. Cryo Lett. 2007, 27, 295–303. [Google Scholar]
  15. Graether, S.P.; Boddington, K.F. Disorder and function: A review of the dehydrin protein family. Front. Plant Sci. 2014, 5, 576. [Google Scholar] [CrossRef] [Green Version]
  16. Thomashow, M.F. PLANT COLD ACCLIMATION: Freezing tolerance genes and regulatory mechanisms. Annu. Rev. Plant Biol. 1999, 50, 571–599. [Google Scholar] [CrossRef] [Green Version]
  17. Hanin, M.; Brini, F.; Ebel, C.; Toda, Y.; Takeda, S.; Masmoudi, K. Plant dehydrins and stress tolerance. Plant Signal. Behav. 2011, 6, 1503–1509. [Google Scholar] [CrossRef] [PubMed]
  18. Rekarte-Cowie, I.; Ebshish, O.S.; Mohamed, K.S.; Pearce, R.S. Sucrose helps regulate cold acclimation of Arabidopsis thaliana. J. Exp. Bot. 2008, 59, 4205–4217. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  19. Wolkers, W.F.; McCready, S.; Brandt, W.F.; Lindsey, G.G.; Hoekstra, F.A. Isolation and characterization of a D-7 LEA protein from pollen that stabilizes glasses in vitro. Biochim. Biophys. Acta Protein Struct. Mol. Enzym. 2001, 1544, 196–206. [Google Scholar] [CrossRef]
  20. Trischuk, R.G.; Schilling, B.S.; Low, N.H.; Gray, G.R.; Gusta, L.V. Cold acclimation, de-acclimation and re-acclimation of spring canola, winter canola and winter wheat: The role of carbohydrates, cold-induced stress proteins and vernalization. Environ. Exp. Bot. 2014, 106, 156–163. [Google Scholar] [CrossRef]
  21. Wanner, L.A.; Junttila, O. Cold-induced freezing tolerance in Arabidopsis. Plant Physiol. 1999, 120, 391–400. [Google Scholar] [CrossRef] [Green Version]
  22. Yu, D.J.; Hwang, J.Y.; Chung, S.W.; Oh, H.D.; Yun, S.K.; Lee, H.J. Changes in cold hardiness and carbohydrate content in peach (Prunus persica) trunk bark and wood tissues during cold acclimation and deacclimation. Sci. Hortic. 2017, 219, 45–52. [Google Scholar] [CrossRef]
  23. Winde, J.; Sønderkær, M.; Nielsen, K.L.; Pagter, M. Is range expansion of introduced Scotch broom (Cytisus scoparius) in Denmark limited by winter cold tolerance? Plant Ecol. 2020, 221, 709–723. [Google Scholar] [CrossRef]
  24. Deslauriers, A.; Garcia, L.; Charrier, G.; Buttò, V.; Pichette, A.; Paré, M. Cold acclimation and deacclimation in wild blueberry: Direct and indirect influence of environmental factors and non-structural carbohydrates. Agric. For. Meteorol. 2021, 301–302, 108349. [Google Scholar] [CrossRef]
  25. Carpenter, J.F.; Hand, S.C.; Crowe, L.M.; Crowe, J.H. Cryoprotection of phosphofructokinase with organic solutes: Characterization of enhanced protection in the presence of divalent cations. Arch. Biochem. Biophys. 1986, 250, 505–512. [Google Scholar] [CrossRef]
  26. Uemura, M.; Steponkus, P.L. Cold acclimation in plants: Relationship between the lipid composition and the cryostability of the plasma membrane. J. Plant Res. 1999, 112, 245–254. [Google Scholar] [CrossRef]
  27. Zhang, L.-L.; Zhao, M.-G.; Tian, Q.-Y.; Zhang, W.-H. Comparative studies on tolerance of Medicago truncatula and Medicago falcata to freezing. Planta 2011, 234, 445–457. [Google Scholar] [CrossRef]
  28. Ruan, Y.-L. Sucrose metabolism: Gateway to diverse carbon use and sugar signaling. Annu. Rev. Plant Biol. 2014, 65, 33–67. [Google Scholar] [CrossRef]
  29. Zuther, E.; Buchel, K.; Hundertmark, M.; Stitt, M.; Hincha, D.K.; Heyer, A.G. The role of raffinose in the cold acclimation response of Arabidopsis thaliana. FEBS Lett. 2004, 576, 169–173. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  30. Unda, F.; Canam, T.; Preston, L.; Mansfield, S.D. Isolation and characterization of galactinol synthases from hybrid poplar. J. Exp. Bot. 2011, 63, 2059–2069. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  31. Wang, X.; Chen, Y.; Jiang, S.; Xu, F.; Wang, H.; Wei, Y.; Shao, X. PpINH1, an invertase inhibitor, interacts with vacuolar invertase PpVIN2 in regulating the chilling tolerance of peach fruit. Hortic. Res. 2020, 7, 168. [Google Scholar] [CrossRef]
  32. Ouyang, L.; Leus, L.; Van Labeke, M.-C. Three-year screening for cold hardiness of garden roses. Sci. Hortic. 2018, 245, 12–18. [Google Scholar] [CrossRef]
  33. Flint, H.L.; Boyce, B.R.; Beattie, D.J. Index of injury—A useful expression of freezing injury to plant tissues as determined by the electrolytic method. Can. J. Plant Sci. 1967, 47, 229–230. [Google Scholar] [CrossRef] [Green Version]
  34. Lim, C.C.; Arora, R.; Townsend, E.C. Comparing Gompertz and Richards Functions to Estimate Freezing Injury in Rhododendron Using Electrolyte Leakage. J. Am. Soc. Hortic. Sci. 1998, 123, 246–252. [Google Scholar] [CrossRef]
  35. Luypaert, G.; Witters, J.; Van Huylenbroeck, J.; De Clercq, P.; De Riek, J.; De Keyser, E. Induced expression of selected plant defence related genes in pot azalea, Rhododendron simsii hybrid. Euphytica 2017, 213, 227. [Google Scholar] [CrossRef]
  36. Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Untergasser, A.; Nijveen, H.; Rao, X.; Bisseling, T.; Geurts, R.; Leunissen, J.A.M. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 2007, 35, W71–W74. [Google Scholar] [CrossRef] [Green Version]
  38. Pipino, L. Improving Seed Production Efficiency for Hybrid Rose Breeding. Doctoral Dissertation, Ghent University, Ghent, Belgium, 2011. [Google Scholar]
  39. Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, RESEARCH0034. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  40. Ruijter, J.M.; Ramakers, C.; Hoogaars, W.M.H.; Karlen, Y.; Bakker, O.; Van den Hoff, M.J.B.; Moorman, A.F.M. Amplification efficiency: Linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Res. 2009, 37, e45. [Google Scholar] [CrossRef] [Green Version]
  41. Hellemans, J.; Mortier, G.; De Paepe, A.; Speleman, F.; Vandesompele, J. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol. 2007, 8, R19. [Google Scholar] [CrossRef] [Green Version]
  42. Artlip, T.S.; Callahan, A.M.; Bassett, C.L.; Wisniewski, M. Seasonal expression of a dehydrin gene in sibling deciduous and evergreen genotypes of peach (Prunus persica [L.] Batsch). Plant Mol. Biol. 1997, 33, 61–70. [Google Scholar] [CrossRef]
  43. Yue, C.; Cao, H.-L.; Wang, L.; Zhou, Y.-H.; Huang, Y.-T.; Hao, X.; Wang, Y.-C.; Wang, B.; Yang, Y.-J.; Wang, X.-C. Effects of cold acclimation on sugar metabolism and sugar-related gene expression in tea plant during the winter season. Plant Mol. Biol. 2015, 88, 591–608. [Google Scholar] [CrossRef]
  44. Kalberer, S.R.; Wisniewski, M.; Arora, R. Deacclimation and reacclimation of cold-hardy plants: Current understanding and emerging concepts. Plant Sci. 2006, 171, 3–16. [Google Scholar] [CrossRef]
  45. Kalberer, S.R.; Leyva-Estrada, N.; Krebs, S.L.; Arora, R. Frost dehardening and rehardening of floral buds of deciduous azaleas are influenced by genotypic biogeography. Environ. Exp. Bot. 2007, 59, 264–275. [Google Scholar] [CrossRef]
  46. Pagter, M.; Hausman, J.-F.; Arora, R. Deacclimation kinetics and carbohydrate changes in stem tissues of Hydrangea in response to an experimental warm spell. Plant Sci. 2011, 180, 140–148. [Google Scholar] [CrossRef] [PubMed]
  47. Wisniewski, M.; Bassett, C.; Norelli, J.; Macarisin, D.; Artlip, T.; Gasic, K.; Korban, S. Expressed sequence tag analysis of the response of apple (Malus × domestica ‘Royal Gala’) to low temperature and water deficit. Physiol. Plant. 2008, 133, 298–317. [Google Scholar] [CrossRef] [PubMed]
  48. Kontunen-Soppela, S.; Taulavuori, K.; Taulavuori, E.; Lähdesmäki, P.; Laine, K. Soluble proteins and dehydrins in nitrogen-fertilized Scots pine seedlings during deacclimation and the onset of growth. Physiol. Plant. 2000, 109, 404–409. [Google Scholar] [CrossRef]
  49. Arora, R.; Rowland, L.J.; Ogden, E.L.; Dhanaraj, A.L.; Marian, C.O.; Ehlenfeldt, M.K.; Vinyard, B. Dehardening kinetics, bud development, and dehydrin metabolism in blueberry cultivars during deacclimation at constant, warm temperatures. J. Am. Soc. Hortic. Sci. 2004, 129, 667–674. [Google Scholar] [CrossRef] [Green Version]
  50. Arora, R.; Wisniewski, M. Accumulation of a 60-kD dehydrin protein in peach xylem tissues and its relationship to cold acclimation. HortScience 1996, 31, 923–925. [Google Scholar] [CrossRef] [Green Version]
  51. Marian, C.O.; Eris, A.; Krebs, S.L.; Arora, R. Environmental regulation of a 25 kDa dehydrin in relation to Rhododendron cold Acclimation. J. Am. Soc. Hortic. Sci. 2004, 129, 354–359. [Google Scholar] [CrossRef] [Green Version]
  52. Welling, A.; Rinne, P.; Viherä-Aarnio, A.; Kontunen-Soppela, S.; Heino, P.; Palva, E.T. Photoperiod and temperature differentially regulate the expression of two dehydrin genes during overwintering of birch (Betula pubescens Ehrh.). J. Exp. Bot. 2004, 55, 507–516. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Liang, N.; Xia, H.; Wu, S.; Ma, F. Genome-wide identification and expression profiling of dehydrin gene family in Malus domestica. Mol. Biol. Rep. 2012, 39, 10759–10768. [Google Scholar] [CrossRef]
  54. Shin, H.; Oh, S.-I.; Kim, M.-A.; Yun, S.K.; Oh, Y.; Son, I.-C.; Kim, H.-S.; Kim, D. Relationship between cold hardiness and dehydrin gene expression in peach shoot tissues under field conditions. Hortic. Environ. Biotechnol. 2015, 56, 280–287. [Google Scholar] [CrossRef]
  55. Joosen, R.V.L.; Lammers, M.; Balk, P.A.; Brønnum, P.; Konings, M.C.J.M.; Perks, M.; Stattin, E.; Van Wordragen, M.F.; Van Der Geest, A.H.M. Correlating gene expression to physiological parameters and environmental conditions during cold acclimation of Pinus sylvestris, identification of molecular markers using cDNA microarrays. Tree Physiol. 2006, 26, 1297–1313. [Google Scholar] [CrossRef] [Green Version]
  56. Koster, K.; Leopold, A.C. Sugars and desiccation tolerance in seeds. Plant Physiol. 1988, 88, 829–832. [Google Scholar] [CrossRef] [Green Version]
  57. Crowe, J.H.; Carpenter, J.F.; Crowe, L.M.; Anchordoguy, T.J. Are freezing and dehydration similar stress vectors? A comparison of modes of interaction of stabilizing solutes with biomolecules. Cryobiology 1990, 27, 219–231. [Google Scholar] [CrossRef]
  58. Pagter, M.; Jensen, C.R.; Petersen, K.K.; Liu, F.; Arora, R. Changes in carbohydrates, ABA and bark proteins during seasonal cold acclimation and deacclimation in Hydrangea species differing in cold hardiness. Physiol. Plant. 2008, 134, 473–485. [Google Scholar] [CrossRef]
  59. Palonen, P.; Buszard, D.; Donnelly, D. Changes in carbohydrates and freezing tolerance during cold acclimation of red raspberry cultivars grown in vitro and in vivo. Physiol. Plant. 2008, 110, 393–401. [Google Scholar] [CrossRef]
  60. Van Labeke, M.-C.; Volckaert, E. Evaluation of electrolyte leakage for detecting cold acclimatization in six deciduous tree species. Acta Hortic. 2010, 885, 403–410. [Google Scholar] [CrossRef]
  61. Schrader, S.; Sauter, J.J. Seasonal changes of sucrose-phosphate synthase and sucrose synthase activities in poplar wood (Populus × canadensis Moench ‘robusta’) and their possible role in carbohydrate metabolism. J. Plant Physiol. 2002, 159, 833–843. [Google Scholar] [CrossRef]
  62. Goldner, W.; Thom, M.; Maretzki, A. Sucrose metabolism in sugarcane cell suspension cultures. Plant Sci. 1991, 73, 143–147. [Google Scholar] [CrossRef]
  63. Kaplan, F.; Kopka, J.; Sung, D.Y.; Zhao, W.; Popp, M.; Porat, R.; Guy, C.L. Transcript and metabolite profiling during cold acclimation of Arabidopsis reveals an intricate relationship of cold-regulated gene expression with modifications in metabolite content. Plant J. 2007, 50, 967–981. [Google Scholar] [CrossRef]
Horticulturae 07 00379 g001 550
Figure 1. Seasonal changes of cold hardiness of stems expressed as LT50 (temperature of 50% relative electrolyte leakage) of two rose genotypes (Rosa hybrida ‘Yesterday’ and R. wichurana). Different letters indicate significant differences among sampling time points within each genotype (p = 0.05). Values are means ± SE (n = 5).
Figure 1. Seasonal changes of cold hardiness of stems expressed as LT50 (temperature of 50% relative electrolyte leakage) of two rose genotypes (Rosa hybrida ‘Yesterday’ and R. wichurana). Different letters indicate significant differences among sampling time points within each genotype (p = 0.05). Values are means ± SE (n = 5).
Horticulturae 07 00379 g001
Horticulturae 07 00379 g002 550
Figure 2. Seasonal changes in expression of dehydrins including RhDHN5 (a) and RhDHN6 (b) in the more cold-hardy genotype (Rosa hybrida ‘Yesterday’) and the less cold-hardy genotype (R. wichurana). Data were assessed by one-way ANOVA and a Scheffé post-hoc test (p = 0.05). Different letters (A, B, etc.; or a, b, etc.) indicate significant differences between time points within each genotype. Normalized relative quantities (CNRQs, non-log-transformed) are presented as geometric means ± SE (n = 3).
Figure 2. Seasonal changes in expression of dehydrins including RhDHN5 (a) and RhDHN6 (b) in the more cold-hardy genotype (Rosa hybrida ‘Yesterday’) and the less cold-hardy genotype (R. wichurana). Data were assessed by one-way ANOVA and a Scheffé post-hoc test (p = 0.05). Different letters (A, B, etc.; or a, b, etc.) indicate significant differences between time points within each genotype. Normalized relative quantities (CNRQs, non-log-transformed) are presented as geometric means ± SE (n = 3).
Horticulturae 07 00379 g002
Horticulturae 07 00379 g003 550
Figure 3. Proportions of sucrose, hexoses (glucose + fructose), and oligosaccharides (raffinose + stachyose) in total soluble sugars of the more cold-hardy genotype (Rosa hybrida ‘Yesterday’) (a) and the less cold-hardy genotype (R. wichurana) (b) within each sampling points. Values are means (n = 5).
Figure 3. Proportions of sucrose, hexoses (glucose + fructose), and oligosaccharides (raffinose + stachyose) in total soluble sugars of the more cold-hardy genotype (Rosa hybrida ‘Yesterday’) (a) and the less cold-hardy genotype (R. wichurana) (b) within each sampling points. Values are means (n = 5).
Horticulturae 07 00379 g003
Horticulturae 07 00379 g004 550
Figure 4. Seasonal changes in gene expression of RhSPS1 (a), RhSUS (b), and RhINV2 (c) in sucrose biosynthesis and RhRS6 (d) in RFOs (raffinose family oligosaccharides) biosynthesis in the more cold-hardy genotype (Rosa hybrida ‘Yesterday’) and the less cold-hardy genotype (R. wichurana). Data were assessed by one-way ANOVA and a Scheffé post-hoc test (p = 0.05) except for RhSUS of ‘Yesterday’ by the Kruskal–Wallis test (p = 0.05). Different letters (A, B, etc.; or a, b, etc.) indicate significant differences between sampling time points within each genotype. Normalized relative quantities (CNRQs, non-log-transformed) are presented as geometric means ± SE (n = 3).
Figure 4. Seasonal changes in gene expression of RhSPS1 (a), RhSUS (b), and RhINV2 (c) in sucrose biosynthesis and RhRS6 (d) in RFOs (raffinose family oligosaccharides) biosynthesis in the more cold-hardy genotype (Rosa hybrida ‘Yesterday’) and the less cold-hardy genotype (R. wichurana). Data were assessed by one-way ANOVA and a Scheffé post-hoc test (p = 0.05) except for RhSUS of ‘Yesterday’ by the Kruskal–Wallis test (p = 0.05). Different letters (A, B, etc.; or a, b, etc.) indicate significant differences between sampling time points within each genotype. Normalized relative quantities (CNRQs, non-log-transformed) are presented as geometric means ± SE (n = 3).
Horticulturae 07 00379 g004
Table
Table 1. List of candidate genes in other species used to identify the putative homologue and isolate from the Rosa spp. transcriptome database.
Table 1. List of candidate genes in other species used to identify the putative homologue and isolate from the Rosa spp. transcriptome database.
Genes in RosesFunctional AnnotationSpeciesAcc. No.
RhDHN5/6 * DehydrinPrunus persicaU34809
RhSPS1Sucrose-phosphate synthase Camellia sinensisKF696388
RhSUSSucrose synthase Camellia sinensisKF921302
RhINV2InvertaseCamellia sinensisKP053402
RhRS6Raffinose synthaseCamellia sinensisKP162174
* RhDHN5/6 were chosen according to Artlip et al. [42], and other four candidate genes (RhSPS1, RhSUS, RhINV2, and RhRS6) were chosen from Yue et al. [43].
Table
Table 2. List of RT-qPCR primer sequences and product size for Rosa spp. target gene fragments and reference genes.
Table 2. List of RT-qPCR primer sequences and product size for Rosa spp. target gene fragments and reference genes.
GeneAcc. No.F or RPrimer Sequence 5′–3′Amplicon Size (bp)PCR
Efficiencies
RhDHN5MH249069FGGTCACAAGGACGATCCCTA861.886
RCCCTTATGCTCTTGGTGCTC
RhDHN6MH249070FCCGTGAGAATAAGGGAGTGG1061.914
RGCCGTAACCCGGTGTAGTAG
RhSUSMH249072FAGACCCTTCTCACTGGGACA1421.798
RGCGATCAAGGTTGGAGACA
RhINV2MH249073FTCTGTGGCAACTGATGTTGTT1301.893
RTTGTTCGTCCACCTTGAGC
RhRS6MH249076FCATTAGTGGCGGACCTGTTT841.912
RCCGTCCGGCAATACTATCTT
RhPGK * EC586265.1FGCCAAAGTCATCTTGGCTTC1011.869
RCCACTCCAAGGAGCTCAGAC
RhRPS18c * BI977264.1FATCTCGAGCGGTTGAAGAAG971.890
RTGCGACCAGTAGTCTTGGTG
Rh2-UBC9 * EC586612.1FGACCCAAATCCTGATGATCC1041.903
RCGTACTTCTGGGTCCAGCTC
* These genes were selected from Pipino [38].
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Ouyang, L.; Leus, L.; De Keyser, E.; Van Labeke, M.-C. Dehydrins and Soluble Sugars Involved in Cold Acclimation of Rosa wichurana and Rose Cultivar ‘Yesterday’. Horticulturae 2021, 7, 379. https://doi.org/10.3390/horticulturae7100379

AMA Style

Ouyang L, Leus L, De Keyser E, Van Labeke M-C. Dehydrins and Soluble Sugars Involved in Cold Acclimation of Rosa wichurana and Rose Cultivar ‘Yesterday’. Horticulturae. 2021; 7(10):379. https://doi.org/10.3390/horticulturae7100379

Chicago/Turabian Style

Ouyang, Lin, Leen Leus, Ellen De Keyser, and Marie-Christine Van Labeke. 2021. "Dehydrins and Soluble Sugars Involved in Cold Acclimation of Rosa wichurana and Rose Cultivar ‘Yesterday’" Horticulturae 7, no. 10: 379. https://doi.org/10.3390/horticulturae7100379

APA Style

Ouyang, L., Leus, L., De Keyser, E., & Van Labeke, M. -C. (2021). Dehydrins and Soluble Sugars Involved in Cold Acclimation of Rosa wichurana and Rose Cultivar ‘Yesterday’. Horticulturae, 7(10), 379. https://doi.org/10.3390/horticulturae7100379

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop