Exogenous EBR Ameliorates Endogenous Hormone Contents in Tomato Species under Low-Temperature Stress
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials and Growth Condition
2.2. Hormone Profiling
2.3. Lipid Peroxidation Assay and Proline Content
2.4. Enzyme Activity
2.5. RNA Extraction and Real Time PCR
2.6. Statistical Analyses
3. Results
3.1. Effects of EBR on Endogenous Hormones in Tomato Leaves Exposed to a Low Temperature
3.2. MDA and Proline Are Increased By a Low Temperature
3.3. Effects of EBR on Activity of Antioxidant Enzymes
3.4. Effect of EBR on Expression Pattern of ERF Genes
4. Discussion
4.1. EBR Improves Cold Tolerance by Affecting ABA Content
4.2. EBR Application Affects the Auxin and GA Content under Low-Temperature Stress
4.3. MDA and Proline Are Not Affected by EBR Treatment
4.4. Effects of EBR on Activity of Antioxidant Enzymes
4.5. Effects of Low-Temperature Stress on Cold-Related Genes
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ahammed, G.J.; Xia, X.-J.; Li, X.; Shi, K.; Yu, J.-Q.; Zhou, Y.-H. Role of brassinosteroid in plant adaptation to abiotic stresses and its interplay with other hormones. Curr. Protein Pept. Sci. 2015, 16, 462–473. [Google Scholar] [CrossRef]
- Heidari, P. Comparative analysis of C-repeat binding factors (CBFs) in tomato and arabidopsis. Braz. Arch. Biol. Technol. 2019, 62. [Google Scholar] [CrossRef] [Green Version]
- Jiang, Y.; Huang, L.; Cheng, F.; Zhou, Y.; Xia, X.; Mao, W.; Shi, K.; Yu, J. Brassinosteroids accelerate recovery of photosynthetic apparatus from cold stress by balancing the electron partitioning, carboxylation and redox homeostasis in cucumber. Physiol. Plant 2013, 148, 133–145. [Google Scholar] [CrossRef]
- Fariduddin, Q.; Yusuf, M.; Ahmad, I.; Ahmad, A. Brassinosteroids and their role in response of plants to abiotic stresses. Biol. Plant 2014, 58, 9–17. [Google Scholar] [CrossRef]
- Ahammed, G.J.; Li, X.; Liu, A.; Chen, S. Brassinosteroids in Plant Tolerance to Abiotic Stress. J. Plant Growth Regul. 2020, 1–14. [Google Scholar] [CrossRef]
- Faraji, S.; Ahmadizadeh, M.; Heidari, P. Genome-wide comparative analysis of Mg transporter gene family between Triticum turgidum and Camelina sativa. BioMetals 2021, 4, 1–22. [Google Scholar]
- Chen, Z.-Y.; Wang, Y.-T.; Pan, X.-B.; Xi, Z.-M. Amelioration of cold-induced oxidative stress by exogenous 24-epibrassinolide treatment in grapevine seedlings: Toward regulating the ascorbate–glutathione cycle. Sci. Hortic. 2019, 244, 379–387. [Google Scholar] [CrossRef]
- Khan, T.A.; Yusuf, M.; Ahmad, A.; Bashir, Z.; Saeed, T.; Fariduddin, Q.; Hayat, S.; Mock, H.-P.; Wu, T. Proteomic and physiological assessment of stress sensitive and tolerant variety of tomato treated with brassinosteroids and hydrogen peroxide under low-temperature stress. Food Chem. 2019, 289, 500–511. [Google Scholar] [CrossRef] [PubMed]
- Bajguz, A.; Hayat, S. Effects of brassinosteroids on the plant responses to environmental stresses. Plant Physiol. Biochem. 2009, 47, 1–8. [Google Scholar] [CrossRef]
- Sun, Y.; He, Y.; Irfan, A.R.; Liu, X.; Yu, Q.; Zhang, Q.; Yang, D. Exogenous Brassinolide Enhances the Growth and Cold Resistance of Maize (Zea mays L.) Seedlings under Chilling Stress. Agronomy 2020, 10, 488. [Google Scholar] [CrossRef] [Green Version]
- Huang, X.; Chen, M.-H.; Yang, L.-T.; Li, Y.-R.; Wu, J.-M. Effects of exogenous abscisic acid on cell membrane and endogenous hormone contents in leaves of sugarcane seedlings under cold stress. Sugar Tech. 2015, 17, 59–64. [Google Scholar] [CrossRef]
- Wang, F.; Ahammed, G.J.; Li, G.; Bai, P.; Jiang, Y.; Wang, S.; Chen, S. Ethylene is involved in red light-induced anthocyanin biosynthesis in cabbage (Brassica oleracea). Int. J. Agric. Biol. 2019, 21, 955–963. [Google Scholar]
- Wang, Y.-T.; Chen, Z.-Y.; Jiang, Y.; Duan, B.-B.; Xi, Z.-M. Involvement of ABA and antioxidant system in brassinosteroid-induced water stress tolerance of grapevine (Vitis vinifera L.). Sci. Hortic. 2019, 256, 108596. [Google Scholar] [CrossRef]
- Ahmadizadeh, M.; Chen, J.-T.; Hasanzadeh, S.; Ahmar, S.; Heidari, P. Insights into the genes involved in the ethylene biosynthesis pathway in Arabidopsis thaliana and Oryza sativa. J. Genet. Eng. Biotechnol. 2020, 18, 1–20. [Google Scholar] [CrossRef]
- Rezaee, S.; Ahmadizadeh, M.; Heidari, P. Genome-wide characterization, expression profiling, and post- transcriptional study of GASA gene family. Gene Rep. 2020, 20, 100795. [Google Scholar] [CrossRef]
- Heidari, P.; Mazloomi, F.; Nussbaumer, T.; Barcaccia, G. Insights into the SAM synthetase gene family and its roles in tomato seedlings under abiotic stresses and hormone treatments. Plants 2020, 9, 586. [Google Scholar] [CrossRef]
- Ogweno, J.O.; Song, X.S.; Shi, K.; Hu, W.H.; Mao, W.H.; Zhou, Y.H.; Yu, J.Q.; Nogués, S. Brassinosteroids alleviate heat-induced inhibition of photosynthesis by increasing carboxylation efficiency and enhancing antioxidant systems in Lycopersicon esculentum. J. Plant Growth Regul. 2008, 27, 49–57. [Google Scholar] [CrossRef]
- Hayat, S.; Hasan, S.A.; Yusuf, M.; Hayat, Q.; Ahmad, A. Effect of 28-homobrassinolide on photosynthesis, fluorescence and antioxidant system in the presence or absence of salinity and temperature in Vigna radiata. Environ. Exp. Bot. 2010, 69, 105–112. [Google Scholar] [CrossRef]
- Yu, J.Q.; Huang, L.F.; Hu, W.H.; Zhou, Y.H.; Mao, W.H.; Ye, S.F.; Nogués, S. A role for brassinosteroids in the regulation of photosynthesis in Cucumis sativus. J. Exp. Bot. 2004, 55, 1135–1143. [Google Scholar] [CrossRef]
- Yuan, L.; Yuan, Y.; Du, J.; Sun, J.; Guo, S. Effects of 24-epibrassinolide on nitrogen metabolism in cucumber seedlings under Ca (NO3) 2 stress. Plant Physiol. Biochem. 2012, 61, 29–35. [Google Scholar] [CrossRef]
- Yusuf, M.; Fariduddin, Q.; Ahmad, I.; Ahmad, A. Brassinosteroid-mediated evaluation of antioxidant system and nitrogen metabolism in two contrasting cultivars of Vigna radiata under different levels of nickel. Physiol. Mol. Biol. Plants 2014, 20, 449–460. [Google Scholar] [CrossRef] [Green Version]
- Yuan, G.-F.; Jia, C.-G.; Li, Z.; Sun, B.; Zhang, L.-P.; Liu, N.; Wang, Q.-M. Effect of brassinosteroids on drought resistance and abscisic acid concentration in tomato under water stress. Sci. Hortic. 2010, 126, 103–108. [Google Scholar] [CrossRef]
- Yusuf, M.; Fariduddin, Q.; Ahmad, A. 24-Epibrassinolide modulates growth, nodulation, antioxidant system, and osmolyte in tolerant and sensitive varieties of Vigna radiata under different levels of nickel: A shotgun approach. Plant Physiol. Biochem. 2012, 57, 143–153. [Google Scholar] [CrossRef] [PubMed]
- Ahanger, M.A.; Ashraf, M.; Bajguz, A.; Ahmad, P. Brassinosteroids regulate growth in plants under stressful environments and crosstalk with other potential phytohormones. J. Plant Growth Regul. 2018, 37, 1007–1024. [Google Scholar] [CrossRef]
- Choudhary, S.P.; Yu, J.-Q.; Yamaguchi-Shinozaki, K.; Shinozaki, K.; Tran, L.-S.P. Benefits of brassinosteroid crosstalk. Trends Plant Sci. 2012, 17, 594–605. [Google Scholar] [CrossRef]
- Heidari, P.; Ahmadizadeh, M.; Izanlo, F.; Nussbaumer, T. In silico study of the CESA and CSL gene family in Arabidopsis thaliana and Oryza sativa: Focus on post-translation modifications. Plant Gene 2019, 19, 100189. [Google Scholar] [CrossRef]
- Zhao, M.; Yuan, L.; Wang, J.; Xie, S.; Zheng, Y.; Nie, L.; Zhu, S.; Hou, J.; Chen, G.; Wang, C. Transcriptome analysis reveals a positive effect of brassinosteroids on the photosynthetic capacity of wucai under low temperature. BMC Genom. 2019, 20, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Fang, P.; Yan, M.; Chi, C.; Wang, M.; Zhou, Y.; Zhou, J.; Shi, K.; Xia, X.; Foyer, C.H.; Yu, J. Brassinosteroids act as a positive regulator of photoprotection in response to chilling stress. Plant Physiol. 2019, 180, 2061–2076. [Google Scholar] [CrossRef]
- Deng, X.-G.; Zhu, T.; Zhang, D.-W.; Lin, H.-H. The alternative respiratory pathway is involved in brassinosteroid-induced environmental stress tolerance in Nicotiana benthamiana. J. Exp. Bot. 2015, 66, 6219–6232. [Google Scholar] [CrossRef] [Green Version]
- Xi, Z.; Wang, Z.; Fang, Y.; Hu, Z.; Hu, Y.; Deng, M.; Zhang, Z. Effects of 24-epibrassinolide on antioxidation defense and osmoregulation systems of young grapevines (V. vinifera L.) under chilling stress. Plant Growth Regul. 2013, 71, 57–65. [Google Scholar] [CrossRef]
- Xia, X.; Fang, P.; Guo, X.; Qian, X.; Zhou, J.; Shi, K.; Zhou, Y.; Yu, J. Brassinosteroid-mediated apoplastic H2O2-glutaredoxin 12/14 cascade regulates antioxidant capacity in response to chilling in tomato. Plant Cell Environ. 2018, 41, 1052–1064. [Google Scholar] [CrossRef]
- Cui, J.; Zhou, Y.; Ding, J.; Xia, X.; Shi, K.A.I.; Chen, S.; Asami, T.; Chen, Z.; Yu, J. Role of nitric oxide in hydrogen peroxide-dependent induction of abiotic stress tolerance by brassinosteroids in cucumber. Plant Cell Environ. 2011, 34, 347–358. [Google Scholar] [CrossRef]
- Ahmad, F.; Singh, A.; Kamal, A. Crosstalk of brassinosteroids with other phytohormones under various abiotic stresses. J. Appl. Biol. Biotech. 2018, 6, 56–62. [Google Scholar]
- Ntatsi, G.; Savvas, D.; Ntatsi, G.; Kläring, H.P.; Schwarz, D. Growth, yield, and metabolic responses of temperature-stressed tomato to grafting onto rootstocks differing in cold tolerance. J. Am. Soc. Hortic. Sci. 2014, 139, 230–243. [Google Scholar] [CrossRef] [Green Version]
- Tang, Y.; Wang, L.; Ma, C.; Liu, J.; Liu, B.; Li, H. The use of HPLC in determination of endogenous hormones in anthers of bitter melon. J. Life Sci. 2011, 5, 139–142. [Google Scholar]
- Li, X.-J.; Yang, M.-F.; Chen, H.; Qu, L.-Q.; Chen, F.; Shen, S.-H. Abscisic acid pretreatment enhances salt tolerance of rice seedlings: Proteomic evidence. Biochim. Biophys. Acta (BBA) Proteins Proteom. 2010, 1804, 929–940. [Google Scholar] [CrossRef] [PubMed]
- Campos, P.S.; nia Quartin, V.; chicho Ramalho, J.; Nunes, M.A. Electrolyte leakage and lipid degradation account for cold sensitivity in leaves ofCoffea sp. plants. J. Plant Physiol. 2003, 160, 283–292. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Z.; Huang, R. Analysis of malondialdehyde, chlorophyll proline, soluble sugar, and glutathione content in Arabidopsis seedling. Bio-Protocol 2013, 3, e817. [Google Scholar] [CrossRef]
- Mittova, V.; Volokita, M.; Guy, M.; Tal, M. Activities of SOD and the ascorbate-glutathione cycle enzymes in subcellular compartments in leaves and roots of the cultivated tomato and its wild salt-tolerant relative Lycopersicon pennellii. Physiol. Plant 2000, 110, 42–51. [Google Scholar] [CrossRef]
- Aebi, H. [13] Catalase in vitro. In Methods in Enzymology; Elsevier: Amsterdam, The Netherlands, 1984; Volume105, pp. 121–126. ISBN 0076-6879. [Google Scholar]
- Sharma, M.K.; Kumar, R.; Solanke, A.U.; Sharma, R.; Tyagi, A.K.; Sharma, A.K. Identification, phylogeny, and transcript profiling of ERF family genes during development and abiotic stress treatments in tomato. Mol. Genet. Genom. 2010, 284, 455–475. [Google Scholar] [CrossRef]
- Chinnusamy, V.; Ohta, M.; Kanrar, S.; Lee, B.; Hong, X.; Agarwal, M.; Zhu, J.-K. ICE1: A regulator of cold-induced transcriptome and freezing tolerance in Arabidopsis. Genes Dev. 2003, 17, 1043–1054. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Peleg, Z.; Blumwald, E. Hormone balance and abiotic stress tolerance in crop plants. Curr. Opin. Plant Biol. 2011, 14, 290–295. [Google Scholar] [CrossRef]
- Eremina, M.; Rozhon, W.; Poppenberger, B. Hormonal control of cold stress responses in plants. Cell Mol. Life Sci. 2016, 73, 797–810. [Google Scholar] [CrossRef] [PubMed]
- Krishna, P. Brassinosteroid-mediated stress responses. J. Plant Growth Regul. 2003, 22, 289–297. [Google Scholar] [CrossRef] [PubMed]
- Kuromori, T.; Seo, M.; Shinozaki, K. ABA transport and plant water stress responses. Trends Plant Sci. 2018, 23, 513–522. [Google Scholar] [CrossRef]
- Xue-Xuan, X.; Hong-Bo, S.; Yuan-Yuan, M.; Gang, X.; Jun-Na, S.; Dong-Gang, G.; Cheng-Jiang, R. Biotechnological implications from abscisic acid (ABA) roles in cold stress and leaf senescence as an important signal for improving plant sustainable survival under abiotic-stressed conditions. Crit. Rev. Biotechnol. 2010, 30, 222–230. [Google Scholar] [CrossRef]
- Ku, Y.-S.; Sintaha, M.; Cheung, M.-Y.; Lam, H.-M. Plant hormone signaling crosstalks between biotic and abiotic stress responses. Int. J. Mol. Sci. 2018, 19, 3206. [Google Scholar] [CrossRef] [Green Version]
- Hu, Y.; Yu, D. BRASSINOSTEROID INSENSITIVE2 interacts with ABSCISIC ACID INSENSITIVE5 to mediate the antagonism of brassinosteroids to abscisic acid during seed germination in Arabidopsis. Plant Cell 2014, 26, 4394–4408. [Google Scholar] [CrossRef] [Green Version]
- An, B.; Wang, Q.; Zhang, X.; Zhang, B.; Luo, H.; He, C. Comprehensive transcriptional and functional analyses of HbGASA genes reveal their roles in fungal pathogen resistance in Hevea brasiliensis. Tree Genet. Genomes 2018, 14, 41. [Google Scholar] [CrossRef]
- Zhang, S.; Cai, Z.; Wang, X. The primary signaling outputs of brassinosteroids are regulated by abscisic acid signaling. Proc. Natl. Acad. Sci. USA 2009, 106, 4543–4548. [Google Scholar] [CrossRef] [Green Version]
- Divi, U.K.; Rahman, T.; Krishna, P. Brassinosteroid-mediated stress tolerance in Arabidopsis shows interactions with abscisic acid, ethylene and salicylic acid pathways. BMC Plant Biol. 2010, 10, 151. [Google Scholar] [CrossRef] [Green Version]
- Bajguz, A. Brassinosteroid enhanced the level of abscisic acid in Chlorella vulgaris subjected to short-term heat stress. J. Plant Physiol. 2009, 166, 882–886. [Google Scholar] [CrossRef] [PubMed]
- Tanveer, M.; Shahzad, B.; Sharma, A.; Khan, E.A. 24-Epibrassinolide application in plants: An implication for improving drought stress tolerance in plants. Plant Physiol. Biochem. 2019, 135, 295–303. [Google Scholar] [CrossRef] [PubMed]
- Anwar, A.; Liu, Y.; Dong, R.; Bai, L.; Yu, X.; Li, Y. The physiological and molecular mechanism of brassinosteroid in response to stress: A review. Biol. Res. 2018, 51, 46. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hardtke, C.S.; Dorcey, E.; Osmont, K.S.; Sibout, R. Phytohormone collaboration: Zooming in on auxin–brassinosteroid interactions. Trends Cell Biol. 2007, 17, 485–492. [Google Scholar] [CrossRef]
- Tong, H.; Xiao, Y.; Liu, D.; Gao, S.; Liu, L.; Yin, Y.; Jin, Y.; Qian, Q.; Chu, C. Brassinosteroid regulates cell elongation by modulating gibberellin metabolism in rice. Plant Cell 2014, 26, 4376–4393. [Google Scholar] [CrossRef] [Green Version]
- Kurepin, L.V.; Dahal, K.P.; Savitch, L.V.; Singh, J.; Bode, R.; Ivanov, A.G.; Hurry, V.; Huener, N. Role of CBFs as integrators of chloroplast redox, phytochrome and plant hormone signaling during cold acclimation. Int. J. Mol. Sci. 2013, 14, 12729–12763. [Google Scholar] [CrossRef]
- Colebrook, E.H.; Thomas, S.G.; Phillips, A.L.; Hedden, P. The role of gibberellin signalling in plant responses to abiotic stress. J. Exp. Biol. 2014, 217, 67–75. [Google Scholar] [CrossRef] [Green Version]
- Albacete, A.; Ghanem, M.E.; Martínez-Andújar, C.; Acosta, M.; Sánchez-Bravo, J.; Martínez, V.; Lutts, S.; Dodd, I.C.; Pérez-Alfocea, F. Hormonal changes in relation to biomass partitioning and shoot growth impairment in salinized tomato (Solanum lycopersicum L.) plants. J. Exp. Bot. 2008, 59, 4119–4131. [Google Scholar] [CrossRef]
- Shibasaki, K.; Uemura, M.; Tsurumi, S.; Rahman, A. Auxin response in Arabidopsis under cold stress: Underlying molecular mechanisms. Plant Cell 2009, 21, 3823–3838. [Google Scholar] [CrossRef] [Green Version]
- Sun, L.; Feraru, E.; Feraru, M.I.; Waidmann, S.; Wang, W.; Passaia, G.; Wang, Z.-Y.; Wabnik, K.; Kleine-Vehn, J. PIN-LIKES coordinate brassinosteroid signaling with nuclear auxin input in Arabidopsis thaliana. Curr. Biol. 2020, 30, 1579–1588. [Google Scholar] [CrossRef] [Green Version]
- Goda, H.; Sawa, S.; Asami, T.; Fujioka, S.; Shimada, Y.; Yoshida, S. Comprehensive comparison of auxin-regulated and brassinosteroid-regulated genes in Arabidopsis. Plant Physiol. 2004, 134, 1555–1573. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- KIM, T.; Lee, S.M.; JOO, S.; Yun, H.S.; Lee, Y.E.W.; Kaufman, P.B.; Kirakosyan, A.R.A.; KIM, S.; Nam, K.H.; Lee, J.S. Elongation and gravitropic responses of Arabidopsis roots are regulated by brassinolide and IAA. Plant Cell Environ. 2007, 30, 679–689. [Google Scholar] [CrossRef] [PubMed]
- Bai, M.-Y.; Shang, J.-X.; Oh, E.; Fan, M.; Bai, Y.; Zentella, R.; Sun, T.; Wang, Z.-Y. Brassinosteroid, gibberellin and phytochrome impinge on a common transcription module in Arabidopsis. Nat. Cell Biol. 2012, 14, 810–817. [Google Scholar] [CrossRef] [Green Version]
- Gallego-Bartolomé, J.; Minguet, E.G.; Grau-Enguix, F.; Abbas, M.; Locascio, A.; Thomas, S.G.; Alabadí, D.; Blázquez, M.A. Molecular mechanism for the interaction between gibberellin and brassinosteroid signaling pathways in Arabidopsis. Proc. Natl. Acad. Sci. USA 2012, 109, 13446–13451. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Q.-F.; Wang, C.; Jiang, L.; Li, S.; Sun, S.S.M.; He, J.-X. An interaction between BZR1 and DELLAs mediates direct signaling crosstalk between brassinosteroids and gibberellins in Arabidopsis. Sci. Signal. 2012, 5, ra72. [Google Scholar] [CrossRef]
- İşeri, Ö.D.; Körpe, D.A.; Sahin, F.I.; Haberal, M. Hydrogen peroxide pretreatment of roots enhanced oxidative stress response of tomato under cold stress. Acta Physiol. Plant 2013, 35, 1905–1913. [Google Scholar] [CrossRef]
- Hayat, S.; Ali, B.; Hasan, S.A.; Ahmad, A. Brassinosteroid enhanced the level of antioxidants under cadmium stress in Brassica juncea. Environ. Exp. Bot. 2007, 60, 33–41. [Google Scholar] [CrossRef]
- Sharma, I.; Ching, E.; Saini, S.; Bhardwaj, R.; Pati, P.K. Exogenous application of brassinosteroid offers tolerance to salinity by altering stress responses in rice variety Pusa Basmati-1. Plant Physiol. Biochem. 2013, 69, 17–26. [Google Scholar] [CrossRef] [PubMed]
- Hayat, S.; Hayat, Q.; Alyemeni, M.N.; Wani, A.S.; Pichtel, J.; Ahmad, A. Role of proline under changing environments: A review. Plant Signal. Behav. 2012, 7, 1456–1466. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Posmyk, M.M.; Janas, K.M. Effects of seed hydropriming in presence of exogenous proline on chilling injury limitation in Vigna radiata L. seedlings. Acta Physiol. Plant 2007, 29, 509–517. [Google Scholar] [CrossRef]
- Çoban, Ö.; Baydar, N.G. Brassinosteroid effects on some physical and biochemical properties and secondary metabolite accumulation in peppermint (Mentha piperita L.) under salt stress. Ind. Crops Prod. 2016, 86, 251–258. [Google Scholar] [CrossRef]
- Öktem, H.A.; Eyidoðan, F.; Demirba, D.; Bayraç, A.T.; Öz, M.T.; Özgür, E.; Selçuk, F.; Yücel, M. Antioxidant responses of lentil to cold and drought stress. J. plant Biochem. Biotechnol. 2008, 17, 15–21. [Google Scholar] [CrossRef]
- Kamran, M.; Parveen, A.; Ahmar, S.; Malik, Z.; Hussain, S.; Chattha, M.S.; Saleem, M.H.; Adil, M.; Heidari, P.; Chen, J.-T. An Overview of Hazardous Impacts of Soil Salinity in Crops, Tolerance Mechanisms, and Amelioration through Selenium Supplementation. Int. J. Mol. Sci. 2020, 21, 148. [Google Scholar] [CrossRef] [Green Version]
- Duan, M.; Feng, H.-L.; Wang, L.-Y.; Li, D.; Meng, Q.-W. Overexpression of thylakoidal ascorbate peroxidase shows enhanced resistance to chilling stress in tomato. J. Plant Physiol. 2012, 169, 867–877. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Wu, Q.; Sprague, S.A.; Park, J.; Oh, M.; Rajashekar, C.B.; Koiwa, H.; Nakata, P.A.; Cheng, N.; Hirschi, K.D. Tomato expressing Arabidopsis glutaredoxin gene AtGRXS17 confers tolerance to chilling stress via modulating cold responsive components. Hortic. Res. 2015, 2, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Sharma, P.; Kumar, A.; Bhardwaj, R. Plant steroidal hormone epibrassinolide regulate–Heavy metal stress tolerance in Oryza sativa L. by modulating antioxidant defense expression. Environ. Exp. Bot. 2016, 122, 1–9. [Google Scholar] [CrossRef]
- Wang, Q.; Ding, T.; Gao, L.; Pang, J.; Yang, N. Effect of brassinolide on chilling injury of green bell pepper in storage. Sci. Hortic. 2012, 144, 195–200. [Google Scholar] [CrossRef]
- Hu, W.H.; Wu, Y.; Zeng, J.Z.; He, L.; Zeng, Q.M. Chill-induced inhibition of photosynthesis was alleviated by 24-epibrassinolide pretreatment in cucumber during chilling and subsequent recovery. Photosynthetica 2010, 48, 537–544. [Google Scholar] [CrossRef]
- Wu, X.X.; He, J.; Zhu, Z.W.; Yang, S.J.; Zha, D.S. Protection of photosynthesis and antioxidative system by 24-epibrassinolide in Solanum melongena under cold stress. Biol. Plant 2014, 58, 185–188. [Google Scholar] [CrossRef]
- Riechmann, J.L.; Heard, J.; Martin, G.; Reuber, L.; Jiang, C.-Z.; Keddie, J.; Adam, L.; Pineda, O.; Ratcliffe, O.J.; Samaha, R.R. Arabidopsis transcription factors: Genome-wide comparative analysis among eukaryotes. Science 2000, 290, 2105–2110. [Google Scholar] [CrossRef]
- Faraji, S.; Filiz, E.; Kazemitabar, S.K.; Vannozzi, A.; Palumbo, F.; Barcaccia, G.; Heidari, P. The AP2/ERF Gene Family in Triticum durum: Genome-Wide Identification and Expression Analysis under Drought and Salinity Stresses. Genes 2020, 11, 1464. [Google Scholar] [CrossRef] [PubMed]
- Nakano, T.; Suzuki, K.; Fujimura, T.; Shinshi, H. Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiol. 2006, 140, 411–432. [Google Scholar] [CrossRef] [Green Version]
- Ahmadizadeh, M.; Heidari, P. Bioinformatics study of transcription factors involved in cold stress. Biharean Biol. 2014, 8, 83–86. [Google Scholar]
- Kagale, S.; Divi, U.K.; Krochko, J.E.; Keller, W.A.; Krishna, P. Brassinosteroid confers tolerance in Arabidopsis thaliana and Brassica napus to a range of abiotic stresses. Planta 2007, 225, 353–364. [Google Scholar] [CrossRef] [PubMed]
- Xie, Z.; Nolan, T.; Jiang, H.; Tang, B.; Zhang, M.; Li, Z.; Yin, Y. The AP2/ERF transcription factor TINY modulates brassinosteroid-regulated plant growth and drought responses in Arabidopsis. Plant Cell 2019, 31, 1788–1806. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dhaubhadel, S.; Chaudhary, S.; Dobinson, K.F.; Krishna, P. Treatment with 24-epibrassinolide, a brassinosteroid, increases the basic thermotolerance of Brassica napus and tomato seedlings. Plant Mol. Biol. 1999, 40, 333–342. [Google Scholar] [CrossRef]
- Yin, W.; Dong, N.; Niu, M.; Zhang, X.; Li, L.; Liu, J.; Liu, B.; Tong, H. Brassinosteroid-regulated plant growth and development and gene expression in soybean. Crop. J. 2019, 7, 411–418. [Google Scholar] [CrossRef]
Gene Name | Gene ID | Primer (5′-3′) | Product Size (bp) |
---|---|---|---|
ERF.B13 | Solyc08g078190 | F: GGTGAAGAAGTATGAATGGATCGA | 71 |
R: TCACAGGAACCGAAACAATCG | |||
ERF2 | Solyc01g090310 | F: CTTATGACCAAGCCGCATTC | 74 |
R: ACCCGAGCCGATTAAATGAG | |||
ERF52 | Solyc03g117130 | F: CATTGGGGATCTTGGGTTTC | 143 |
R: TTAGTGCGTGCTGTTGAACC | |||
ERF13 | Solyc04g054910 | F: TCAAGTATGGCCTCCTGCAA | 88 |
R: GAGCAACCTTCACTATTACATGAC | |||
ICE1 | Solyc03g118310 | F: ATGGAGGAACTGGTTCTTGG | 139 |
R: TCCACACCTCCATCATCAAC | |||
EF-1α | Solyc06g005060 | F: GGAACTTGAGAAGGAGCCTAAG | 158 |
R: CAACACCAACAGCAACAGTCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Heidari, P.; Entazari, M.; Ebrahimi, A.; Ahmadizadeh, M.; Vannozzi, A.; Palumbo, F.; Barcaccia, G. Exogenous EBR Ameliorates Endogenous Hormone Contents in Tomato Species under Low-Temperature Stress. Horticulturae 2021, 7, 84. https://doi.org/10.3390/horticulturae7040084
Heidari P, Entazari M, Ebrahimi A, Ahmadizadeh M, Vannozzi A, Palumbo F, Barcaccia G. Exogenous EBR Ameliorates Endogenous Hormone Contents in Tomato Species under Low-Temperature Stress. Horticulturae. 2021; 7(4):84. https://doi.org/10.3390/horticulturae7040084
Chicago/Turabian StyleHeidari, Parviz, Mahdi Entazari, Amin Ebrahimi, Mostafa Ahmadizadeh, Alessandro Vannozzi, Fabio Palumbo, and Gianni Barcaccia. 2021. "Exogenous EBR Ameliorates Endogenous Hormone Contents in Tomato Species under Low-Temperature Stress" Horticulturae 7, no. 4: 84. https://doi.org/10.3390/horticulturae7040084