Biology, Diagnostics, Pathogenomics and Mitigation Strategies of Jackfruit-Bronzing Bacterium Pantoea stewartii subspecies stewartii: What Do We Know So Far about This Culprit?
Abstract
:1. Introduction
2. Significance of Jackfruit-Bronzing Disease
3. Pantoea stewartii Subspecies stewartii
3.1. History of Pantoea Species
3.2. Biology
4. Diagnostics of Pantoea stewartii Subspecies stewartii from Diseased Jackfruit with Bronzing Symptoms
4.1. Phenotypic Characterization
4.2. Molecular Characterization
4.2.1. Polymerase Chain Reaction
4.2.2. Barcoding
5. Pathogenomics and Pathogenicity of Pantoea stewartii subspecies stewartii
5.1. Membrane Transport: ATP-Binding Cassette Transporters and Type-VI Secretion System
5.2. Cell Wall and Capsule: Capsular- and Exopolysaccharides
6. Potential Mitigation Strategies for Jackfruit-Bronzing Disease
6.1. Cultural Practices
6.1.1. Monitoring and Sanitation
6.1.2. Disease-Free Seeds
6.1.3. Resistant Varieties
6.1.4. Biological Control
6.1.5. Intercropping
6.2. Chemical Control
6.2.1. Bactericides
6.2.2. Insecticide and Antibiotic Treatment
7. Conclusions and Future Prospects
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Anvar Hussain, N.A.; Hoque, M.; Agarwal, S.; Syed, I.; Raihan, M. Jackfruit (Artocarpus heterophyllus). In Antioxidants in Fruits: Properties and Health Benefits; Nayik, G.A., Amir, G., Eds.; Springer Nature Singapore Pte Ltd.: Singapore, 2020; pp. 461–477. ISBN 9789811572845. [Google Scholar]
- Ismail, N.; Kaur, B. Consumer preference for jackfruit varieties in Malaysia. J. Agribus. Mark. 2013, 6, 37–51. [Google Scholar]
- Hossain, A.K.M.A.; Haq, N. Practical manual 10. Jackfruit: Artocarpus heterophyllus (Field manual for extension and farmers); Southampton Centre for Underutilised Crops: Southampton, UK, 2006; ISBN 0854328343. [Google Scholar]
- Swami, S.B.; Thakor, N.J.; Haldankar, P.M.; Kalse, S.B. Jackfruit and its many functional components as related to human health: A review. Compr. Rev. Food Sci. Food Saf. 2012, 11, 565–576. [Google Scholar] [CrossRef]
- Balamaze, J.; Muyonga, J.H.; Byaruhanga, Y.B. Production and utilization of jackfruit (Artocarpus heterophyllus) In Uganda. African J. Food, Agric. Nutr. Dev. 2019, 19, 14289–14302. [Google Scholar] [CrossRef]
- CABI. Artocarpus heterophyllus (Jackfruit). Available online: https://www.cabi.org/isc/datasheet/1832#tosummaryOfInvasiveness (accessed on 8 September 2021).
- Ranasinghe, R.A.S.N.; Maduwanthi, S.D.T.; Marapana, R.A.U.J. Nutritional and health benefits of jackfruit (Artocarpus heterophyllus Lam.): A review. Int. J. Food Sci. 2019, 2019, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Sawe, B.E. World Leaders in Jackfruit Production. Available online: https://www.worldatlas.com/articles/world-leaders-in-jackfruit-production.html (accessed on 22 January 2022).
- Norris, A.; Van Hag, L.; Su, C.; Attenborough, E.; Buckingham, E.; Perry, O.; Marcsik, D. Processing Jackfruit into Ready-to-Eat Products and Ingredients; AgriFutures Australia: Wagga Wagga, NSW, Australia, 2021. [Google Scholar]
- Menteri, J.P. Annual Report Performance Management and Delivery Unit (Pemandu). 2013. Available online: http://www.pemandu.gov.my/ (accessed on 12 April 2020).
- Department of Agriculture, Booklet Statistic Tanaman (Sub-Sektor Tanaman Makanan). 2021. Available online: www.doa.gov.my (accessed on 18 April 2022).
- MAFI Agrofood Statistics. 2019. Available online: https://www.mafi.gov.my/documents/20182/361765/Perangkaan+Agromakanan+2019.pdf/6546231e-053e-4afb-b38d-90bc01913dbd (accessed on 18 April 2022).
- Statista Research Department Production volume of jackfruit in the Philippines from 2011 to 2020. Available online: https://www.statista.com/statistics/590131/production-of-jackfruit-philippines/ (accessed on 19 April 2022).
- Jaffar, N.S.; Osman, M.S.; Koyube, M.N.K. New bacterial fruit rot disease of jackfruit caused by Dickeya fangzhongdai in Malaysia. Malays. J. Microbiol. 2019, 15, 214–219. [Google Scholar] [CrossRef]
- Borines, L.M.; Palermo, V.G.; Guadalquiver, G.A.; Dwyer, C.; Drenth, A.; Daniel, R.; Guest, D.I. Jackfruit decline caused by Phytophthora palmivora (Butler). Australas. Plant Pathol. 2014, 43, 123–129. [Google Scholar] [CrossRef]
- Shakywar, R.C. Diseases of jackfruit crops and their management. In Diseases of Fuits and Vegetable Crops; Apple Academic Press: Palm Bay, FL, USA, 2020; pp. 95–106. ISBN 9780429322181. [Google Scholar]
- Keshari, N.; Mallikarjun, G. Plant parasitic nematodes: A major constraint in fruit production. In Nematodes - Recent Advances, Management and New Perspectives; IntechOpen: London, UK, 2022; pp. 1–33. [Google Scholar]
- Long, H.B.; Sun, Y.F.; Bai, C.; Peng, D.L. First report of the root-knot nematode Meloidogyne enterolobii infecting jackfruit tree in China. Plant Dis. 2015, 99, 1868. [Google Scholar] [CrossRef]
- Pradhan, P.; Thakur, D.; Sahoo, N.K. Nematodes associate with big fruit trees and their community analysis survey of state Odisha, India. J. Entomol. Zool. Stud. 2020, 8, 1046–1048. [Google Scholar]
- Zulperi, D.; Manaf, N.; Ismail, S.I.; Karam, D.S.; Yusof, M.T. First report of Pantoea stewartii subspecies stewartii causing fruit bronzing of jackfruit (Artocarpus heterophyllus), a new emerging disease in Peninsular Malaysia. Plant Dis. 2017, 101, 831. [Google Scholar] [CrossRef]
- Gapasin, R.M.; Garcia, R.P.; Advincula, C.T.; De la Cruz, C.S.; Borines, L.M. Fruit bronzing: A new disease affecting jackfruit caused by (Smith) Mergaert Pantoea stewartii et al. Ann. Trop. Res. 2014, 36, 17–31. [Google Scholar] [CrossRef] [Green Version]
- Hernández-Morales, A.; Pérez-Casillas, J.M.; Soria-Guerra, R.E.; Velázquez-Fernández, J.B.; Arvizu-Gómez, J.L. First report of Pantoea stewartii subsp. stewartii causing jackfruit bronzing disease in Mexico. J. Plant Pathol. 2017, 99, 799–818. [Google Scholar] [CrossRef]
- Abidin, N.; Zulperi, D.; Ismail, S.I.; Yusof, M.T.; Ismail-suhaimy, N.W. Diagnostic approach and genetic diversity of jackfruit bronzing bacterium in Malaysia. Asian J. Plant Pathol. 2018, 12, 46–55. [Google Scholar] [CrossRef]
- Abidin, N.; Ismail, S.I.; Vadamalai, G.; Yusof, M.T.; Hakiman, M.; Karam, D.S.; Zulperi, D. Pathogenic variability of the jackfruit-bronzing bacterium Pantoea stewartii subspecies stewartii infection to jackfruit varieties and its pivotal plant hosts in Malaysia. Agronomy 2021, 11, 2113. [Google Scholar] [CrossRef]
- Cangao, C.A. Rust-Like Symptoms and Rot on Jackfruit: A Combination of Disease and Abiotic Factors? Available online: https://www.itfnet.org/v1/2016/05/pineapple-agronomy/#:~:text=Pineappleswillgrowina,toachievethedesiredlevel (accessed on 27 December 2021).
- Abidin, N.; Ismail, S.I.; Vadamalai, G.; Yusof, M.T.; Hakiman, M.; Karam, D.S.; Ismail-Suhaimy, N.W.; Ibrahim, R.; Zulperi, D. Genetic diversity of Pantoea stewartii subspecies stewartii causing jackfruit-bronzing disease in Malaysia. PLoS ONE 2020, 15, 1–18. [Google Scholar] [CrossRef]
- Ibrahim, R.; Ismail-Suhaimy, N.W.; Shu-Qing, T.; Ismail, S.I.; Abidin, N.; Hakiman, M.; Karam, D.S.; Ahmad-Hamdani, M.S.; Yusof, M.T.; Zulperi, D. Molecular characterization and phylogenetic analysis of Pantoea stewartii subspecies stewartii causing bronzing disease of jackfruit in Malaysia based on cps and hrp gene sequences. J. Plant Pathol. 2020, 102, 193–199. [Google Scholar] [CrossRef]
- Bolda, M. Strawberry Fruit Bronzing Occurring on Coast. Available online: http://ucanr.edu/ (accessed on 10 September 2021).
- Jenkins, J.E.E.; Wiggell, D.; Fletcher, J.T. Tomato fruit bronzing. Ann. Appl. Biol. 1965, 55, 71–81. [Google Scholar] [CrossRef]
- Koike, S.T.; Zalom, F.G.; Larson, K.D. Bronzing of strawberry fruit as affected by production practices, environmental factors, and thrips. HortScience 2009, 44, 1588–1593. [Google Scholar] [CrossRef] [Green Version]
- Azad, H.R.; Holmes, G.J.; Cooksey, D.A. A new leaf blotch disease of sudangrass caused by Pantoea ananas and Pantoea stewartii. Plant Dis. 2000, 84, 973–979. [Google Scholar] [CrossRef] [Green Version]
- Choi, O.; Kim, J. Pantoea stewartii causing stewart’s wilt on Dracaena sanderiana in Korea. J. Phytopathol. 2013, 161, 578–581. [Google Scholar] [CrossRef]
- Arayaskul, N.; Poompouang, S.; Lithanatudom, P.; K, L.S. First report of a leaf blight in rice (Oryza sativa) caused by Pantoea ananatis and Pantoea stewartii in Thailand. Plant Dis. 2020, 104, 562. [Google Scholar] [CrossRef]
- Kini, K.; Agnimonhan, R.; Afolabi, O.; Milan, B.; Soglonou, B.; Gbogbo, V.; Koebnik, R.; Silué, D. First report of a new bacterial leaf blight of rice caused by Pantoea ananatis and Pantoea stewartii in Benin. Plant Dis. 2017, 101, 242. [Google Scholar] [CrossRef]
- Kini, K.; Agnimonhan, R.; Afolabi, O.; Soglonou, B.; Silué, D.; Koebnik, R. First report of a new bacterial leaf blight of rice caused by Pantoea ananatis and Pantoea stewartii in Togo. Plant Dis. 2017, 101, 241. [Google Scholar] [CrossRef]
- Mergaert, J.; Verdonck, L.; Kersters, K. Transfer of Erwinia ananas (synonym, Erwinia uredovora) and Erwinia stewartii to the genus Pantoea emend. as Pantoea ananas (Serrano 1928) comb. nov. and Pantoea stewartii (Smith 1898) comb. nov., respectively, and description of Pantoea stewartii subsp. Int. J. Syst. Bacteriol. 1993, 43, 162–173. [Google Scholar] [CrossRef]
- CABI. Pantoea Stewartii (Bacterial Wilt of Maize). In: Crop Protection Compendium. Available online: https://www.plantwise.org/knowledgebank/datasheet/21939 (accessed on 10 September 2021).
- Anderson, T.R. An outbreak of Stewart’s bacterial wilt of corn in Ontario, Canada. Plant Dis. 1986, 70, 603f. [Google Scholar] [CrossRef]
- Dillard, H.R.; Kline, W.L. An outbreak of Stewart’s bacterial wilt of corn in New York State. Plant Dis. 1989, 73, 273. [Google Scholar] [CrossRef]
- Albarracín Orio, A.G.; Brücher, E.; Plazas, M.C.; Sayago, P.; Guerra, F.; De Rossi, R.; Ducasse, D.A.; Guerra, G.D. First report of Stewart’s wilt of maize in Argentina caused by Pantoea stewartii. Plant Dis. 2012, 96, 1819. [Google Scholar] [CrossRef]
- Haliatur, R.; Sinaga, M.; Memen, S. Giyanto First report of Stewart’s wilt of maize caused by Pantoea stewartii subsp. stewartii in Bogor district, Indonesia. J. Int. Soc. Southeast Asian Agric. Sci. 2014, 20, 131–141. [Google Scholar]
- Azizi, M.M.F.; Ismail, S.I.; Hata, E.M.; Zulperi, D.; Ina-Salwany, M.Y.; Abdullah, M.A.F. First report of Pantoea stewartii subsp. indologenes causing leaf blight on rice in Malaysia. Plant Dis. 2019, 103, 1407. [Google Scholar] [CrossRef]
- Vinodhini, J.; Kannan, R.; Sankareswari, R.U.; Akila, R.; Pillai, M.A. Characterization of new bacterial leaf blight of rice caused by Pantoea stewartii subsp. indologenes in Southern districts of Tamil Nadu. Int. J. Environ. Agric. Biotechnol. 2017, 2, 3279–3284. [Google Scholar] [CrossRef] [Green Version]
- Stumpf, S.; Kvitko, B.; Gitaitis, R.; Dutta, B. Isolation and characterization of novel Pantoea stewartii subsp. indologenes strains exhibiting center rot in onion. Plant Dis. 2018, 102, 727–733. [Google Scholar] [CrossRef] [Green Version]
- Zhang, S.; Xu, Z.Y.; Le, R.; Hu, H.Q. First report of leaf blight wilt on Dracaena sanderiana by Pantoea stewartii subsp. indologenes in China. Plant Dis. 2020, 104, 1854. [Google Scholar] [CrossRef]
- EPPO. Pantoea Stewartii subsp. Stewartii (ERWIST). Available online: https://gd.eppo.int/taxon/ERWIST/distribution (accessed on 29 August 2021).
- EFSA; van der Gaag, D.J.; Schenk, M.; Delbianco, A.; Vos, S. Pest survey card on Pantoea stewartii subsp. stewartii. EFSA Support. Publ. 2020, 17, 1878E. [Google Scholar] [CrossRef]
- Arora, T.; Parle, A. Jackfruit: A health boon. Int. J. Res. Ayurveda Pharm. 2016, 7, 59–64. [Google Scholar] [CrossRef]
- Md Sabtu, N.; Ishak, M.H.I.; Idris, N.H. The spatial epidemiology of jackfruit pest and diseases: A review. Int. J. Built Environ. Sustain. 2019, 6, 169–175. [Google Scholar] [CrossRef]
- Adnan, M. Management of insect pests and diseases of jackfruit (Artocarpus heterophyllus L.) in agroforestry system: A review. Acta Entomol. Zool. 2021, 2, 37–46. [Google Scholar] [CrossRef]
- Williams, K.P.; Gillespie, J.J.; Sobral, B.W.S.; Nordberg, E.K.; Snyder, E.E.; Shallom, J.M.; Dickerman, A.W. Phylogeny of gammaproteobacteria. J. Bacteriol. 2010, 192, 2305–2314. [Google Scholar] [CrossRef] [Green Version]
- Goszczynska, T.; Moloto, V.M.; Venter, S.N.; Coutinho, T.A. Isolation and identification of Pantoea ananatis from onion seed in South Africa. Seed Sci. Technol. 2006, 34, 655–668. [Google Scholar] [CrossRef]
- Mamede, M.C.; Tebaldi, N.D.; Mota, L.C.B.M.; Martins, O.M.; Coelho, L. Detection of Pantoea ananatis in corn seeds on semi-selective medium. Trop. Plant Pathol. 2018, 43, 254–256. [Google Scholar] [CrossRef] [Green Version]
- Coplin, D.L.; Majerczak, D.R.; Zhang, Y.; Kim, W.S.; Jock, S.; Geider, K. Identification of Pantoea stewartii subsp. stewartii by PCR and strain differentiation by PFGE. Plant Dis. 2002, 86, 304–311. [Google Scholar] [CrossRef] [Green Version]
- Duong, D.A.; Stevens, A.M.; Jensen, R.V. Complete genome assembly of Pantoea stewartii subsp. stewartii DC283, a corn pathogen. Genome Announc. 2017, 5, 1–2. [Google Scholar] [CrossRef] [Green Version]
- Kini, K.; Dossa, R.; Dossou, B.; Mariko, M.; Koebnik, R.; Silué, D. A semi-selective medium to isolate and identify bacteria of the genus Pantoea. J. Gen. Plant Pathol. 2019, 85, 424–427. [Google Scholar] [CrossRef] [Green Version]
- Cother, E.J.; Reinke, R.; McKenzie, C.; Lanoiselet, V.M.; Noble, D.H. An unusual stem necrosis of rice caused by Pantoea ananas and the first record of this pathogen on rice in Australia. Australas. Plant Pathol. 2004, 33, 495–503. [Google Scholar] [CrossRef]
- Sandle, T. Microbial identification. In Pharmaceutical Microbiology; Woodhead Publishing: Sawston, UK, 2016; pp. 103–113. ISBN 9780081000229. [Google Scholar]
- EPPO. PM 7/60 (2) Pantoea stewartii subsp. stewartii. EPPO Bull. 2016, 46, 226–236. [Google Scholar] [CrossRef]
- Balint-Kurti, P. The plant hypersensitive response: Concepts, control and consequences. Mol. Plant Pathol. 2019, 20, 1163–1178. [Google Scholar] [CrossRef] [Green Version]
- Glaeser, S.P.; Kämpfer, P. Multilocus sequence analysis (MLSA) in prokaryotic taxonomy. Syst. Appl. Microbiol. 2015, 38, 237–245. [Google Scholar] [CrossRef]
- Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 1991, 173, 697–703. [Google Scholar] [CrossRef] [Green Version]
- Gevers, D.; Cohan, F.M.; Lawrence, J.G.; Spratt, B.G.; Coenye, T.; Feil, E.J.; Stackebrandt, E.; Van de Peer, Y.; Vandamme, P.; Thompson, F.L.; et al. Re-evaluating prokaryotic species. Nat. Rev. Microbiol. 2005, 3, 733–739. [Google Scholar] [CrossRef]
- Brady, C.; Cleenwerck, I.; Venter, S.; Vancanneyt, M.; Swings, J.; Coutinho, T. Phylogeny and identification of Pantoea species associated with plants, humans and the natural environment based on multilocus sequence analysis (MLSA). Syst. Appl. Microbiol. 2008, 31, 447–460. [Google Scholar] [CrossRef] [Green Version]
- Brady, C.; Cleenwerck, I.; Venter, S.; Coutinho, T.; De Vos, P. Taxonomic evaluation of the genus Enterobacter based on multilocus sequence analysis (MLSA): Proposal to reclassify E. nimipressuralis and E. amnigenus into Lelliottia gen. nov. as Lelliottia nimipressuralis comb. nov. and Lelliottia amnigena comb. nov., respectively, E. gergoviae and E. pyrinus into Pluralibacter gen. nov. as Pluralibacter gergoviae comb. nov. and Pluralibacter pyrinus comb. nov., respectively, E. cowanii, E. radicincitans, E. oryzae and E. arachidis into Kosakonia gen. nov. as Kosakonia cowanii comb. nov., Kosakonia radicincitans comb. nov., Kosakonia oryzae comb. nov. and Kosakonia arachidis comb. nov., respectively, and E. turicensis, E. helveticus and E. pulveris into Cronobacter as Cronobacter zurichensis nom. nov., Cronobacter helveticus comb. nov. and Cronobacter pulveris comb. nov., respectively, and emended description of the genera Enterobacter and Cronobacter. Syst. Appl. Microbiol. 2013, 36, 309–319. [Google Scholar] [CrossRef]
- Brenner, D.J.; Fanning, G.R.; Leete Knutson, J.K. Attempts to classify herbicola group-Enterobacter agglomerans strains by deoxyribonucleic acid hybridization and phenotypic tests. Int. J. Syst. Bacteriol. 1984, 34, 45–55. [Google Scholar] [CrossRef] [Green Version]
- Brady, C.L.; Venter, S.N.; Cleenwerck, I.; Vandemeulebroecke, K.; De Vos, P.; Coutinho, T.A. Transfer of Pantoea citrea, Pantoea punctata and Pantoea terrea to the genus Tatumella emend. as Tatumella citrea comb. nov., Tatumella punctata comb. nov. and Tatumella terrea comb. nov. and description of Tatumella morbirosei sp. nov. Int. J. Syst. Evol. Microbiol. 2010, 60, 484–494. [Google Scholar] [CrossRef]
- Brady, C.L.; Cleenwerck, I.; Venter, S.N.; Engelbeen, K.; De Vos, P.; Coutinho, T.A. Emended description of the genus Pantoea, description of four species from human clinical samples, Pantoea septica sp. nov., Pantoea eucrina sp. nov., Pantoea brenneri sp. nov. and Pantoea conspicua sp. nov., and transfer of Pectobacterium cypripedii (Hor. Int. J. Syst. Evol. Microbiol. 2010, 60, 2430–2440. [Google Scholar] [CrossRef] [Green Version]
- Ibrahim, R.; Ismail-Suhaimy, N.W.; Shu-Qing, T.; Ismail, S.I.; Ina-Salwany, M.Y.; Yusof, M.T.; Hakiman, M.; Karam, D.S.; Zulperi, D. Draft genome sequencing data of a pathogenic Pantoea stewartii subspecies stewartii strain SQT1 causing bronzing disease of jackfruit in Malaysia. Data Br. 2020, 30, 105634. [Google Scholar] [CrossRef]
- Roper, M.C. Pantoea stewartii subsp. stewartii: Lessons learned from a xylem-dwelling pathogen of sweet corn. Mol. Plant Pathol. 2011, 12, 628–637. [Google Scholar] [CrossRef]
- Bartholomew, H.P.; Reynoso, G.; Thomas, B.J.; Mullins, C.M.; Smith, C.; Gentzel, I.N.; Giese, L.A.; Mackey, D.; Stevens, A.M. The transcription factor Lrp of Pantoea stewartii subsp. stewartii controls capsule production, motility, and virulence important for in planta growth. Front. Microbiol. 2022, 12, 1–9. [Google Scholar] [CrossRef]
- Figaj, D.; Ambroziak, P.; Przepiora, T.; Skorko-Glonek, J. The role of proteases in the virulence of plant pathogenic bacteria. Int. J. Mol. Sci. 2019, 20, 672. [Google Scholar] [CrossRef] [Green Version]
- Mohammadi, M.; Burbank, L.; Roper, M.C. Pantoea stewartii subsp. stewartii produces an endoglucanase that is required for full virulence in sweet corn. Mol. Plant-Microbe Interact. 2012, 25, 463–470. [Google Scholar] [CrossRef] [Green Version]
- Koutsoudis, M.D.; Tsaltas, D.; Minogue, T.D.; Von Bodman, S.B. Quorum-sensing regulation governs bacterial adhesion, biofilm development, and host colonization in Pantoea stewartii subspecies stewartii. Proc. Natl. Acad. Sci. USA 2006, 103, 5983–5988. [Google Scholar] [CrossRef] [Green Version]
- Pataky, J.K. Stewart’s Wilt of Corn. Available online: https://www.apsnet.org/edcenter/disandpath/prokaryote/pdlessons/Pages/StewartWilt.aspx (accessed on 4 September 2021).
- Nimtz, M.; Mort, A.; Wray, V.; Domke, T.; Zhang, Y.; Coplin, D.L.; Geider, K. Structure of stewartan, the capsular exopolysaccharide from the corn pathogen Erwinia stewartii. Carbohydr. Res. 1996, 288, 189–201. [Google Scholar] [CrossRef]
- Yang, B.Y.; Gray, J.S.S.; Montgomery, R. The structure of stewartan, a capsular polysaccharide produced by Erwinia stewartii strain DC283. Carbohydr. Res. 1996, 296, 183–201. [Google Scholar] [CrossRef]
- Jumel, K.; Geider, K.; Harding, S.E. The solution molecular weight and shape of the bacterial exopolysaccharides amylovoran and stewartan. Int. J. Biol. Macromol. 1997, 20, 251–258. [Google Scholar] [CrossRef]
- Herrera, C.M.; Koutsoudis, M.D.; Wang, X.; Von Bodman, S.B. Pantoea stewartii subsp. stewartii exhibits surface motility, which is a critical aspect of stewart’s wilt disease development on maize. Mol. Plant-Microbe Interact. 2008, 21, 1359–1370. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lewis, V.G.; Ween, M.P.; McDevitt, C.A. The role of ATP-binding cassette transporters in bacterial pathogenicity. Protoplasma 2012, 249, 919–942. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, K.J.; Song, S.; Mason, K.; Pinkett, H.W. Selective substrate uptake: The role of ATP-binding cassette (ABC) importers in pathogenesis. Biochim. Biophys. Acta - Biomembr. 2018, 1860, 868–877. [Google Scholar] [CrossRef]
- Zeng, Y.; Charkowski, A.O. The role of ATP-binding cassette transporters in bacterial phytopathogenesis. Phytopathology 2021, 111, 600–610. [Google Scholar] [CrossRef]
- Wilkens, S. Structure and mechanism of ABC transporters. F1000Prime Rep. 2015, 7, 1–9. [Google Scholar] [CrossRef]
- Wood, D.W.; Setubal, J.C.; Kaul, R.; Monks, D.E.; Kitajima, J.P.; Okura, V.K.; Zhou, Y.; Chen, L.; Wood, G.E.; Almeida, J.; et al. The genome of the natural genetic engineer Agrobacterium tumefaciens C58. Science 2001, 294, 2317–2323. [Google Scholar] [CrossRef] [Green Version]
- Masulis, I.S.; Sukharycheva, N.A.; Kiselev, S.S.; Andreeva, Z.S.; Ozoline, O.N. Between computational predictions and high-throughput transcriptional profiling: In depth expression analysis of the OppB trans-membrane subunit of Escherichia coli OppABCDF oligopeptide transporter. Res. Microbiol. 2020, 171, 55–63. [Google Scholar] [CrossRef]
- Garai, P.; Chandra, K.; Chakravortty, D. Bacterial peptide transporters: Messengers of nutrition to virulence. Virulence 2017, 8, 297–309. [Google Scholar] [CrossRef] [Green Version]
- Oshiro, E.E.; Tavares, M.B.; Suzuki, C.F.; Pimenta, D.C.; Angeli, C.B.; de Oliveira, J.C.F.; Ferro, M.I.T.; Ferreira, L.C.S.; Ferreira, R.C.C. Distribution and biological role of the oligopeptide-binding protein (OppA) in Xanthomonas species. Genet. Mol. Biol. 2010, 33, 341–347. [Google Scholar] [CrossRef] [Green Version]
- De Maayer, P.; Venter, S.N.; Kamber, T.; Duffy, B.; Coutinho, T.A.; Smits, T.H.M. Comparative genomics of the type VI secretion systems of Pantoea and Erwinia species reveals the presence of putative effector islands that may be translocated by the VgrG and Hcp proteins. BMC Genomics 2011, 12, 2–15. [Google Scholar] [CrossRef] [Green Version]
- Filloux, A.; Hachani, A.; Bleves, S. The bacterial type VI secretion machine: Yet another player for protein transport across membranes. Microbiology 2008, 154, 1570–1583. [Google Scholar] [CrossRef] [Green Version]
- Mulder, D.T.; Cooper, C.A.; Coombes, B.K. Type VI secretion system-associated gene clusters contribute to pathogenesis of Salmonella enterica serovar typhimurium. Infect. Immun. 2012, 80, 1996–2007. [Google Scholar] [CrossRef] [Green Version]
- Shyntum, D.Y.; Venter, S.N.; Moleleki, L.N.; Toth, I.; Coutinho, T.A. Comparative genomics of type VI secretion systems in strains of Pantoea ananatis from different environments. BMC Genomics 2014, 15, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Bernal, P.; Llamas, M.A.; Filloux, A. Type VI secretion systems in plant-associated bacteria. Environ. Microbiol. 2018, 20, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Hernandez, R.E.; Gallegos-Monterrosa, R.; Coulthurst, S.J. Type VI secretion system effector proteins: Effective weapons for bacterial competitiveness. Cell. Microbiol. 2020, 22, 1–9. [Google Scholar] [CrossRef]
- Mariano, G.; Monlezun, L.; Coulthurst, S.J. Dual role for DsbA in attacking and targeted bacterial cells during type VI secretion system-mediated competition. Cell Rep. 2018, 22, 774–785. [Google Scholar] [CrossRef] [Green Version]
- Russell, A.B.; Hood, R.D.; Bui, N.K.; Leroux, M.; Vollmer, W.; Mougous, J.D. Type VI secretion delivers bacteriolytic effectors to target cells. Nature 2011, 475, 343–349. [Google Scholar] [CrossRef] [Green Version]
- Kapitein, N.; Mogk, A. Deadly syringes: Type VI secretion system activities in pathogenicity and interbacterial competition. Curr. Opin. Microbiol. 2013, 16, 52–58. [Google Scholar] [CrossRef]
- Robitaille, S.; Trus, E.; Ross, B.D. Bacterial defense against the type VI secretion system. Trends Microbiol. 2021, 29, 187–190. [Google Scholar] [CrossRef]
- Pissaridou, P.; Allsopp, L.P.; Wettstadt, S.; Howard, S.A.; Mavridou, D.A.I.; Filloux, A. The Pseudomonas aeruginosa T6SS-VgrG1b spike is topped by a PAAR protein eliciting DNA damage to bacterial competitors. Proc. Natl. Acad. Sci. USA 2018, 115, 12519–12524. [Google Scholar] [CrossRef] [Green Version]
- Records, A.R.; Gross, D.C. Sensor kinases RetS and LadS regulate Pseudomonas syringae type VI secretion and virulence factors. J. Bacteriol. 2010, 192, 3584–3596. [Google Scholar] [CrossRef] [Green Version]
- Zheng, J.; Shin, O.S.; Cameron, D.E.; Mekalanos, J.J. Quorum sensing and a global regulator TsrA control expression of type VI secretion and virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. USA 2010, 107, 21128–21133. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Russell, A.B.; Peterson, S.B.; Mougous, J.D. Type VI secretion system effectors: Poisons with a purpose. Nat. Rev. Microbiol. 2014, 12, 137–148. [Google Scholar] [CrossRef] [PubMed]
- Ho, B.T.; Dong, T.G.; Mekalanos, J.J. A view to a kill: The bacterial type VI secretion system. Cell Host Microbe 2014, 15, 9–21. [Google Scholar] [CrossRef] [Green Version]
- Hachani, A.; Wood, T.E.; Filloux, A. Type VI secretion and anti-host effectors. Curr. Opin. Microbiol. 2016, 29, 81–93. [Google Scholar] [CrossRef]
- Pukatzki, S.; Ma, A.T.; Revel, A.T.; Sturtevant, D.; Mekalanos, J.J. Type VI secretion system translocates a phage tail spike-like protein into target cells where it cross-links actin. Proc. Natl. Acad. Sci. USA 2007, 104, 15508–15513. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leiman, P.G.; Basler, M.; Ramagopal, U.A.; Bonanno, J.B.; Sauder, J.M.; Pukatzki, S.; Burley, S.K.; Almo, S.C.; Mekalanos, J.J. Type VI secretion apparatus and phage tail-associated protein complexes share a common evolutionary origin. Proc. Natl. Acad. Sci. USA 2009, 106, 4154–4159. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Purcell, M.; Shuman, H.A. The Legionella pneumophila icmGCDJBF genes are required for killing of human macrophages. Infect. Immun. 1998, 66, 2245–2255. [Google Scholar] [CrossRef] [Green Version]
- Gomez-Valero, L.; Chiner-Oms, A.; Comas, I.; Buchrieser, C.; Hershberg, R. Evolutionary dissection of the Dot/Icm system based on comparative genomics of 58 Legionella species. Genome Biol. Evol. 2019, 11, 2619–2632. [Google Scholar] [CrossRef] [PubMed]
- Ma, L.S.; Lin, J.S.; Lai, E.M. An IcmF family protein, ImpLM, is an integral inner membrane protein interacting with ImpKL, and its Walker a motif is required for type VI secretion system-mediated Hcp secretion in Agrobacterium tumefaciens. J. Bacteriol. 2009, 191, 4316–4329. [Google Scholar] [CrossRef] [Green Version]
- Sexton, J.A.; Miller, J.L.; Yoneda, A.; Kehl-Fie, T.E.; Vogel, J.P. Legionella pneumophila DotU and IcmF are required for stability of the Dot/Icm complex. Infect. Immun. 2004, 72, 5983–5992. [Google Scholar] [CrossRef] [Green Version]
- VanRheenen, S.M.; Duménil, G.; Isberg, R.R. IcmF and DotU are required for optimal effector translocation and trafficking of the Legionella pneumophila vacuole. Infect. Immun. 2004, 72, 5972–5982. [Google Scholar] [CrossRef] [Green Version]
- Li, B.; Wang, X.; Chen, J.; Liu, H.; Ali, K.A.; Wang, Y.; Qiu, W.; Sun, G. IcmF and DotU are required for the virulence of Acidovorax oryzae strain RS-1. Arch. Microbiol. 2018, 200, 897–910. [Google Scholar] [CrossRef]
- Zusman, T.; Feldman, M.; Halperin, E.; Segal, G. Characterization of the icmH and icmF genes required for Legionella pneumophila intracellular growth, genes that are present in many bacteria associated with eukaryotic cells. Infect. Immun. 2004, 72, 3398–3409. [Google Scholar] [CrossRef] [Green Version]
- Bladergroen, M.R.; Badelt, K.; Spaink, H.P. Infection-blocking genes of a symbiotic Rhizobium leguminosarum strain that are involved in temperature-dependent protein secretion. Mol. Plant-Microbe Interact. 2003, 16, 53–64. [Google Scholar] [CrossRef] [Green Version]
- Ma, L.S.; Narberhaus, F.; Lai, E.M. IcmF family protein TssM exhibits ATPase activity and energizes type VI secretion. J. Biol. Chem. 2012, 287, 15610–15621. [Google Scholar] [CrossRef] [Green Version]
- Miller, J.M.; Enemark, E.J. Fundamental characteristics of AAA+ protein family structure and function. Archaea 2016, 2016, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Ogura, T.; Wilkinson, A.J. AAA+ superfamily ATPases: Common structure-diverse function. Genes Cells 2001, 6, 575–597. [Google Scholar] [CrossRef]
- Basler, M. Type VI secretion system: Secretion by a contractile nanomachine. Philos. Trans. R. Soc. B Biol. Sci. 2015, 370. [Google Scholar] [CrossRef] [Green Version]
- Bönemann, G.; Pietrosiuk, A.; Diemand, A.; Zentgraf, H.; Mogk, A. Remodelling of VipA/VipB tubules by ClpV-mediated threading is crucial for type VI protein secretion. EMBO J. 2009, 28, 315–325. [Google Scholar] [CrossRef] [Green Version]
- Shrivastava, S.; Mande, S.S. Identification and functional characterization of gene components of type VI secretion system in bacterial genomes. PLoS ONE 2008, 3, e2995. [Google Scholar] [CrossRef] [Green Version]
- Mougous, J.D.; Gifford, C.A.; Ramsdell, T.L.; Mekalanos, J.J. Threonine phosphorylation post-translationally regulates protein secretion in Pseudomonas aeruginosa. Nat. Cell Biol. 2007, 9, 797–803. [Google Scholar] [CrossRef]
- Pennell, S.; Westcott, S.; Ortiz-Lombardía, M.; Patel, D.; Li, J.; Nott, T.J.; Mohammed, D.; Buxton, R.S.; Yaffe, M.B.; Verma, C.; et al. Structural and functional analysis of phosphothreonine-dependent FHA domain interactions. Structure 2010, 18, 1587–1595. [Google Scholar] [CrossRef] [Green Version]
- Venegas, L.A.; Pershad, K.; Bankole, O.; Shah, N.; Kay, B.K. A comparison of phosphospecific affinity reagents reveals the utility of recombinant Forkhead-associated domains in recognizing phosphothreonine-containing peptides. N. Biotechnol. 2016, 33, 537–543. [Google Scholar] [CrossRef] [Green Version]
- Kamber, T.; Pothier, J.F.; Pelludat, C.; Rezzonico, F.; Duffy, B.; Smits, T.H.M. Role of the type VI secretion systems during disease interactions of Erwinia amylovora with its plant host. BMC Genomics 2017, 18, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Shyntum, D.Y.; Theron, J.; Venter, S.N.; Moleleki, L.N.; Toth, I.K.; Coutinho, T.A. Pantoea ananatis utilizes a type VI secretion system for pathogenesis and bacterial competition. Mol. Plant-Microbe Interact. 2015, 28, 420–431. [Google Scholar] [CrossRef] [Green Version]
- Green, E.R.; Mecsas, J. Bacterial secretion systems: An overview. Microbiol. Spectr. 2016, 4, VMBF-0012-2015. [Google Scholar] [CrossRef] [Green Version]
- Bernhard, F.; Schullerus, D.; Bellemann, P.; Nimtz, M.; Coplin, D.L.; Geider, K. Genetic transfer of amylovoran and stewartan synthesis between Erwinia amylovora and Erwinia stewartii. Microbiology 1996, 142, 1087–1096. [Google Scholar] [CrossRef] [Green Version]
- Dolph, P.J.; Majerczak, D.R.; Coplin, D.L. Characterization of a gene cluster for exopolysaccharide biosynthesis and virulence in Erwinia stewartii. J. Bacteriol. 1988, 170, 865–871. [Google Scholar] [CrossRef] [Green Version]
- Whitfield, C.; Szymanski, C.M.; Aebi, M. Eubacteria. In Essentials of Glycobiology [Internet], 3rd ed.; The Consortium of Glycobiology Editors, La Jolla, California; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2017; pp. 1–11. [Google Scholar]
- Limoli, D.H.; Jones, C.J.; Wozniak, D.J. Bacterial extracellular polysaccharides in biofilm formation and function. Microbiol. Spectr. 2015, 3, 1–30. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bogino, P.C.; de las Mercedes Oliva, M.; Sorroche, F.G.; Giordano, W. The role of bacterial biofilms and surface components in plant-bacterial associations. Int. J. Mol. Sci. 2013, 14, 15838–15859. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Von Bodman, S.B.; Majerczak, D.R.; Coplin, D.L. A negative regulator mediates quorum-sensing control of exopolysaccharide production in Pantoea stewartii subsp. stewartii. Proc. Natl. Acad. Sci. USA 1998, 95, 7687–7692. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Langlotz, C.; Schollmeyer, M.; Coplin, D.L.; Nimtz, M.; Geider, K. Biosynthesis of the repeating units of the exopolysaccharides amylovoran from Erwinia amylovora and stewartan from Pantoea stewartii. Physiol. Mol. Plant Pathol. 2011, 75, 163–169. [Google Scholar] [CrossRef]
- Knirel, Y.A.; Van Calsteren, M.R. Bacterial exopolysaccharides. In Comprehensive Glycoscience, 2nd ed.; Elsevier Inc.: Amsterdam, The Netherlands, 2021; pp. 21–95. ISBN 9780128194751. [Google Scholar]
- Laws, A.; Gu, Y.; Marshall, V. Biosynthesis, characterisation, and design of bacterial exopolysaccharides from lactic acid bacteria. Biotechnol. Adv. 2001, 19, 597–625. [Google Scholar] [CrossRef]
- Sklar, J.G.; Wu, T.; Gronenberg, L.S.; Malinverni, J.C.; Kahne, D.; Silhavy, T.J. Lipoprotein SmpA is a component of the YaeT complex that assembles outer membrane proteins in Escherichia coli. Proc. Natl. Acad. Sci. USA 2007, 104, 6400–6405. [Google Scholar] [CrossRef] [Green Version]
- Kim, S.; Malinverni, J.C.; Sliz, P.; Silhavy, T.J.; Harrison, S.C.; Kahne, D. Structure and function of an essential component of the outer membrane protein assembly machine. Science 2007, 317, 961–964. [Google Scholar] [CrossRef] [Green Version]
- Drummelsmith, J.; Whitfield, C. Gene products required for surface expression of the capsular form of the group 1 K antigen in Escherichia coli (O9a:K30). Mol. Microbiol. 1999, 31, 1321–1332. [Google Scholar] [CrossRef] [Green Version]
- Kim, M.K.; Lee, Y.H.; Kim, H.; Lee, J.; Ryu, J.S. Characterization of the wzc gene from Pantoea sp. strain PPE7 and its influence on extracellular polysaccharide production and virulence on Pleurotus eryngii. Microbiol. Res. 2015, 170, 157–167. [Google Scholar] [CrossRef]
- Pereira, S.B.; Santos, M.; Leite, J.P.; Flores, C.; Eisfeld, C.; Büttel, Z.; Mota, R.; De, F.R.R.; Gales, P.L.; Cabral, J.H.M.; et al. The role of the tyrosine kinase Wzc (Sll0923) and the phosphatase Wzb (Slr0328) in the production of extracellular polymeric substances (EPS) by Synechocystis PCC 6803. Microbiologyopen 2019, 8, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Guo, H.; Yi, W.; Song, J.; Wang, P.G. Current understanding on biosynthesis of microbial polysaccharides. Curr. Top. Med. Chem. 2008, 8, 141–151. [Google Scholar] [CrossRef]
- Newman, M.A.; Von Roepenack, E.; Daniels, M.; Dow, M. Lipopolysaccharides and plant responses to phytopathogenic bacteria. Mol. Plant Pathol. 2000, 1, 25–31. [Google Scholar] [CrossRef]
- Clifford, J.C.; Rapicavoli, J.N.; Roper, M.C. A rhamnose-rich O-antigen mediates adhesion, virulence, and host colonization for the xylem-limited phytopathogen Xylella fastidiosa. Mol. Plant-Microbe Interact. 2013, 26, 676–685. [Google Scholar] [CrossRef] [Green Version]
- Kabanova, A.P.; Shneider, M.M.; Korzhenkov, A.A.; Bugaeva, E.N.; Miroshnikov, K.K.; Zdorovenko, E.L.; Kulikov, E.E.; Toschakov, S.V.; Ignatov, A.N.; Knirel, Y.A.; et al. Host specificity of the Dickeya bacteriophage PP35 is directed by a tail spike interaction with bacterial O-antigen, enabling the infection of alternative non-pathogenic bacterial host. Front. Microbiol. 2019, 10, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Lee, C.; Mannaa, M.; Kim, N.; Kim, J.; Choi, Y.; Kim, S.H.; Jung, B.; Lee, H.H.; Lee, J.; Seo, Y.S. Stress tolerance and virulence-related roles of lipopolysaccharide in Burkholderia glumae. Plant Pathol. J. 2019, 35, 445–458. [Google Scholar] [CrossRef]
- Lerouge, I.; Vanderleyden, J. O-antigen structural variation: Mechanisms and possible roles in animal/plant-microbe interactions. FEMS Microbiol. Rev. 2002, 26, 17–47. [Google Scholar] [CrossRef] [Green Version]
- Rapicavoli, J.N.; Blanco-Ulate, B.; Muszyński, A.; Figueroa-Balderas, R.; Morales-Cruz, A.; Azadi, P.; Dobruchowska, J.M.; Castro, C.; Cantu, D.; Roper, M.C. Lipopolysaccharide O-antigen delays plant innate immune recognition of Xylella fastidiosa. Nat. Commun. 2018, 9, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Plantwise. Pest Management Decision Guide: Green List. Bacterial Wilt of Maize. Available online: www.plantwise.org (accessed on 20 January 2022).
- Blomme, G.; Dita, M.; Jacobsen, K.S.; Vicente, L.P.; Molina, A.; Ocimati, W.; Poussier, S.; Prior, P. Bacterial diseases of bananas and enset: Current state of knowledge and integrated approaches toward sustainable management. Front. Plant Sci. 2017, 8, 1–25. [Google Scholar] [CrossRef]
- Galanti, R.; Lutgen, H. Greenhouse and Nursery Sanitation. Available online: https://www.ctahr.hawaii.edu/site/Info.aspx (accessed on 22 January 2022).
- Afzal, I.; Shabir, R.; Rauf, S. Seed production technologies of some major field crops. In Agronomic Crops; Hasanuzzaman, M., Ed.; Springer: Singapore, 2019; Volume 1, pp. 655–678. ISBN 9789813291515. [Google Scholar]
- UK CABI. Pantoea Stewartii (Bacterial Wilt of Maize). Invasive Species Compendium. Available online: httpsL//www.cabi.org/isc/datasheet/21939 (accessed on 24 January 2022).
- Braun, E.J. Ultrastructural investigation of resistant and susceptible maize inbreds infected with Erwinia stewartii. Phytopathology 1982, 72, 159–166. [Google Scholar] [CrossRef]
- Parker, G.B.; Hooker, A.L. Inheritance of resistance to Erwinia stewartii in four inbred lines of dent corn: Qualitative and quantitative analyses. Maydica 1993, 38, 223–229. [Google Scholar]
- Department of Agriculture. Varieties Registered for National Crop List. Available online: http://pvpbkkt.doa.gov.my/ (accessed on 22 January 2022).
- Woods, T.; Israel, H.; Sherf, A. Isolation and partial characterization of a bacteriophage of Erwinia stewartii from the corn flea beetle, Chaetocnema pulicaria. Prot. Ecol. 1981, 3, 229–236. [Google Scholar]
- Maitra, S.; Hossain, A.; Brestic, M.; Skalicky, M.; Ondrisik, P.; Gitari, H.; Brahmachari, K.; Shankar, T.; Bhadra, P.; Palai, J.B.; et al. Intercropping—a low input agricultural strategy for food and environmental security. Agronomy 2021, 11, 343. [Google Scholar] [CrossRef]
- Teshome, S. Review on strategy of developing intercropping practices. Int. J. Curr. Res. Acad. Rev. 2019, 7, 61–67. [Google Scholar] [CrossRef]
- Ming He, H.; Na Liu, L.; Munir, S.; Bashir, N.H.; Wang, Y.; Yang, J.; Li, C. yun Crop diversity and pest management in sustainable agriculture. J. Integr. Agric. 2019, 18, 1945–1952. [Google Scholar] [CrossRef]
- Poddar, N.; Yele, Y.; Kumari, A. Cropping system approach in IPM. In Adaptive Crop Protection Management Strategies; Prasad, D., Lal, G., Ahmad, I., Eds.; Write and Print Publications: New Delhi, India, 2020; pp. 358–371. ISBN 9789388317085. [Google Scholar]
- Rahaman, M.A.; Rahman, A.; Miah, M.G.; Hoque, M.A.; Rahman, M.M. Productivity and profitability of jackfruit-eggplant agroforestry system in the terrace ecosystem of Bangladesh. Turkish J. Agric. - Food Sci. Technol. 2018, 6, 124. [Google Scholar] [CrossRef] [Green Version]
- Hasan, M.; Ahmed, M.; Miah, M. Agro-economic performance of jackfruit-pineapple agroforestry system in Madhupur tract. J. Agric. Rural Dev. 1970, 6, 147–156. [Google Scholar] [CrossRef]
- Islam, M.S.; Kamruzzaman, M.; Rahman, K.T. Economic aspect of different agroforestry practices in Tangail district. Ann. Bangladesh Agric. 2018, 22, 107–118. [Google Scholar]
- Malézieux, E.; Crozat, Y.; Dupraz, C.; Laurans, M.; Makowski, D.; Ozier-Lafontaine, H.; Rapidel, B.; De Tourdonnet, S.; Valantin-Morison, M. Mixing plant species in cropping systems: Concepts, tools and models: A review. Sustain. Agric. 2009, 29, 329–353. [Google Scholar] [CrossRef] [Green Version]
- Bybee-Finley, K.A.; Ryan, M.R. Advancing intercropping research and practices in industrialized agricultural landscapes. Agriculture 2018, 8, 80. [Google Scholar] [CrossRef] [Green Version]
- Yruela, I. Copper in plants. Brazilian J. Plant Physiol. 2005, 17, 145–156. [Google Scholar] [CrossRef] [Green Version]
- Yruela, I. Copper in plants: Acquisition, transport and interactions. Funct. Plant Biol. 2009, 36, 409–430. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Borkow, G.; Gabbay, J. Copper as a biocidal tool. Curr. Med. Chem. 2005, 12, 2163–2175. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hardy, S.; Keith, F.; Barkley, P. Using Copper Sprays to Control Diseases in Citrus. Available online: http://mvcitrus.org.au/ (accessed on 22 January 2022).
- Gitaitis, R.D.; Walcott, R.R.; Wells, M.L.; Diaz Perez, J.C.; Sanders, F.H. Transmission of Pantoea ananatis, causal agent of center rot of onion, by tobacco thrips, Frankliniella fusca. Plant Dis. 2003, 87, 675–678. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nischwitz, C.; Gitaitis, R.; Sanders, H.; Langston, D.; Mullinix, B.; Torrance, R.; Boyhan, G.; Zolobowska, L. Use of fatty acid methyl ester profiles to compare copper-tolerant and copper-sensitive strains of Pantoea ananatis. Phytopathology 2007, 97, 1298–1304. [Google Scholar] [CrossRef] [Green Version]
- Balogh, B.; Canteros, B.I.; Stall, R.E.; Jones, J.B. Control of citrus canker and citrus bacterial spot with bacteriophages. Plant Dis. 2008, 92, 1048–1052. [Google Scholar] [CrossRef] [Green Version]
- Ninot, A.; Aletà, N.; Moragrega, C.; Montesinos, E. Evaluation of a reduced copper spraying program to control bacterial blight of walnut. Plant Dis. 2002, 86, 583–587. [Google Scholar] [CrossRef] [Green Version]
- Gent, D.H.; Schwartz, H.F. Management of Xanthomonas leaf blight of onion with a plant activator, biological control agents, and copper bactericides. Plant Dis. 2005, 89, 631–639. [Google Scholar] [CrossRef]
- Martin, H.L.; Hamilton, V.A.; Kopittke, R.A. Copper tolerance in Australian populations of Xanthomonas campestris pv. vesicatoria contributes to poor field control of bacterial spot of pepper. Plant Dis. 2004, 88, 921–924. [Google Scholar] [CrossRef] [Green Version]
- Romero, A.M.; Kousik, C.S.; Ritchie, D.F. Resistance to bacterial spot in bell pepper induced by acibenzolar-S-methyl. Plant Dis. 2001, 85, 189–194. [Google Scholar] [CrossRef] [Green Version]
- Louws, F.J.; Wilson, M.; Campbell, H.L.; Cuppels, D.A.; Jones, J.B.; Shoemaker, P.B.; Sahin, F.; Miller, S.A. Field control of bacterial spot and bacterial speck of tomato using a plant activator. Plant Dis. 2001, 85, 481–488. [Google Scholar] [CrossRef] [Green Version]
- Poudel, N.S.; Neupane, S. Bacterial diseases of plants in Nepal: A review. Asian J. Agric. Hortic. Res. 2018, 2, 1–10. [Google Scholar] [CrossRef]
- Lamichhane, J.R.; Osdaghi, E.; Behlau, F.; Köhl, J.; Jones, J.B.; Aubertot, J.N. Thirteen decades of antimicrobial copper compounds applied in agriculture. A review. Agron. Sustain. Dev. 2018, 38, 1–18. [Google Scholar] [CrossRef] [Green Version]
- Djaenuddin, N.; Muis, A. Padi. J. Penelit. dan Pengemb. Pertan. 2018, 37, 41–48. [Google Scholar]
- Kuhar, T.P.; Stivers-Young, L.J.; Hoffmann, M.P.; Taylor, A.G. Control of corn flea beetle and Stewart’s wilt in sweet corn with imidacloprid and thiamethoxam seed treatments. Crop Prot. 2002, 21, 25–31. [Google Scholar] [CrossRef]
- Munkvold, G.P.; McGee, D.C.; Iles, A. Effects of imidacloprid seed treatment of corn on foliar feeding and Erwinia stewartii transmission by the corn flea beetle. Plant Dis. 1996, 80, 747–749. [Google Scholar] [CrossRef]
- Pataky, J.K.; Michener, P.M.; Freeman, N.D.; Whalen, J.M.; Hawk, J.A.; Weldekidan, T.; Teyker, R.H. Rates of seed treatment insecticides and control of Stewart’s wilt in sweet corn. Plant Dis. 2005, 89, 262–268. [Google Scholar] [CrossRef] [Green Version]
- Crane, J.H.; Balerdi, C.F.; Campbell, R.J. The jackfruit (Artocarpus heterophyllus Lam.) in Florida. Edis 2006, 18, 1–13. [Google Scholar] [CrossRef]
- Elevitch, C.R.; Manner, H.I. Artocarpus heterophyllus (jackfruit). Species Profiles Pac. Isl. Agrofor. 2006, 10, 1–25. [Google Scholar]
- Witherup, C.; Zuberi, M.I.; Hossain, S.; Zerega, N.J.C. Genetic diversity of Bangladeshi jackfruit (Artocarpus heterophyllus) over time and across seedling sources. Econ. Bot. 2019, 73, 233–248. [Google Scholar] [CrossRef]
- Nalis, S. Keefektifan perlakuan microwave, air panas, panas kering dan bakterisida untuk menekan infeksi Pantoea stewartii subsp. stewartii pada benih jagung manis. Master’s Dissertation, Institut Pertanian Bogor, Bogor Regency, Indonesia, 2015. [Google Scholar]
- Guo, Y.; Liang, Z.; Huang, H. Elimination of bacterial wilt from imported corn seeds with agricultural antibiotics. Chinese J. Biol. Control 1991, 7, 30–33. [Google Scholar]
Test | Outcome | Reference |
---|---|---|
Gram staining | (-) Gram-negative, short straight rods (0.4−0.7 × 0.9−1.7 µm) | [21,26,59] |
Kovac’s oxidase test | (-) No color change | |
Capsule staining | (-) Non-capsulated | |
Endospore staining | (-) Non-endospore former | |
Motility | (-) Non-motility | |
Tween80 hydrolysis | (-) No opaque haloes | |
Acetoin and indole production | (-) No production | |
Nitrate reduction | (-) No reduction | |
Growth on cis-aconitate | (-) No growth | |
Acid from carbohydrates | (-) Maltose, arbutin, salicin | |
Catalase reaction | (+) Produce bubbles | |
Oxygen requirement | (+) Facultative anaerobe | |
Potato test | (+) Produce lesion or pit | |
Starch hydrolysis | (+) Utilize starch in the medium | |
Gelatin liquefaction | (+) Hydrolyze gelatin | |
Tobacco hypersensitivity | (+) Necrosis of infiltrated tissues | |
Acid from carbohydrates | (+) Glucose, galactose, fructose and sucrose, raffinose |
Primer Name | Primer Sequence (5′-3) | Target Gene | Amplicon Size (bp) | References |
---|---|---|---|---|
ES16 ESIG2c | GCGAACTTGGC-AGAGAT GCGCTTGCGTGT-TATGAG | 16S−23S rRNA/ITS | 920 | [20,21,26,54] |
cpsL1 cpsR2 | CCTGTCAGTCTCGAACC ATCTCGAACCGGTAACC | cpsD | 1100 | [21,22,27,54] |
hrp1d hrp3c | GCACTCATTCCGACCAC GCGGCATACCTAACTCC | hrpS | 900 | [22,27,54] |
fD1 rD1 | AGAGTTTGATCCTGGCTCAG AAGGAGGTGATCCAGCC | 16S rRNA | 1500 | [22,62] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ibrahim, R.; Ismail, S.I.; Ina-Salwany, M.Y.; Zulperi, D. Biology, Diagnostics, Pathogenomics and Mitigation Strategies of Jackfruit-Bronzing Bacterium Pantoea stewartii subspecies stewartii: What Do We Know So Far about This Culprit? Horticulturae 2022, 8, 702. https://doi.org/10.3390/horticulturae8080702
Ibrahim R, Ismail SI, Ina-Salwany MY, Zulperi D. Biology, Diagnostics, Pathogenomics and Mitigation Strategies of Jackfruit-Bronzing Bacterium Pantoea stewartii subspecies stewartii: What Do We Know So Far about This Culprit? Horticulturae. 2022; 8(8):702. https://doi.org/10.3390/horticulturae8080702
Chicago/Turabian StyleIbrahim, Rohaya, Siti Izera Ismail, Md Yasin Ina-Salwany, and Dzarifah Zulperi. 2022. "Biology, Diagnostics, Pathogenomics and Mitigation Strategies of Jackfruit-Bronzing Bacterium Pantoea stewartii subspecies stewartii: What Do We Know So Far about This Culprit?" Horticulturae 8, no. 8: 702. https://doi.org/10.3390/horticulturae8080702