Osteogenic Differentiation Potential of iMSCs on GelMA-BG-MWCNT Nanocomposite Hydrogels
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Synthesis of Gelatin Methacryloyl (GelMA)
2.3. Synthesis of Tertiary Bioactive Glass (BG)
2.4. Preparation of GelMA-BG-MWCNT Nanocomposite Hydrogel Biomaterials
2.5. Cytotoxicity of iMSCs Cultured on GelMA-BG-MWCNT Nanocomposite Hydrogels
2.6. Adhesion of Cells on Gelatin- and Fibronectin-Coated GelMA-BG-MWCNT Nanocomposite Hydrogels
2.7. Osteogenic Gene Expression of Differentiated iMSCs Cultured on GelMA-BG-MWCNT Nanocomposite Hydrogels
2.8. Western Blot Analysis of Differentiated iMSCs Cultured on GelMA-BG-MWCNT Nanocomposite Hydrogels
2.9. Immunofluorescence Microscopy
2.10. Evaluation of Mineralization of Differentiated iMSCs Cultured on GelMA-BG-MWCNT Nanocomposite Hydrogels
2.11. Statistical Analysis
3. Results
3.1. Cell Viability of Mesenchymal Stem Cells Derived from Human Induced Pluripotent Stem Cells (iMSCs) on GelMA-BG-MWCNT Nanocomposite Hydrogels
3.2. Optimization of iMSC Adhesion on GelMA-BG-MWCNT Nanocomposite Hydrogels
3.3. Osteogenic Gene Expression of Differentiated iMSCs Cultured on GelMA-BG-MWCNT Nanocomposite Hydrogels
3.4. Osteogenic Protein Expression of Differentiated iMSCs Cultured on GelMA-BG-MWCNT Nanocomposite Hydrogels
3.5. Mineralization of Differentiated iMSCs Cultured on GelMA-BG-MWCNT Nanocomposite Hydrogels
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Arambula-Maldonado, R.; Liu, Y.; Xing, M.; Mequanint, K. Bioactive and electrically conductive GelMA-BG-MWCNT nanocomposite hydrogel bone biomaterials. Biomater. Adv. 2023, 154, 213616. [Google Scholar] [CrossRef] [PubMed]
- Fukada, E.; Yasuda, I. On the Piezoelectric Effect of Bone. J. Phys. Soc. Jpn. 1957, 12, 1158–1162. [Google Scholar] [CrossRef]
- Balmer, T.W.; Vesztergom, S.; Broekmann, P.; Stahel, A.; Büchler, P. Characterization of the electrical conductivity of bone and its correlation to osseous structure. Sci. Rep. 2018, 8, 8601. [Google Scholar] [CrossRef]
- Aslankoohi, N.; Mequanint, K. Intrinsically fluorescent bioactive glass-poly(ester amide) hybrid microparticles for dual drug delivery and bone repair. Mater. Sci. Eng. C 2021, 128, 112288. [Google Scholar] [CrossRef]
- Arambula-Maldonado, R.; Mequanint, K. Carbon-based electrically conductive materials for bone repair and regeneration. Mater. Adv. 2022, 3, 5186–5206. [Google Scholar] [CrossRef]
- e Silva, E.P.; Huang, B.; Helaehil, J.V.; Nalesso, P.R.L.; Bagne, L.; de Oliveira, M.A.; Albiazetti, G.C.C.; Aldalbahi, A.; El-Newehy, M.; Santamaria, M., Jr.; et al. In vivo study of conductive 3D printed PCL/MWCNTs scaffolds with electrical stimulation for bone tissue engineering. Bio-Des. Manuf. 2021, 4, 190–202. [Google Scholar] [CrossRef]
- Liu, X.; George, M.N.; Li, L.; Gamble, D.; Miller II, A.L.; Gaihre, B.; Waletzki, B.E.; Lu, L. Injectable Electrical Conductive and Phosphate Releasing Gel with Two-Dimensional Black Phosphorus and Carbon Nanotubes for Bone Tissue Engineering. ACS Biomater. Sci. Eng. 2020, 6, 4653–4665. [Google Scholar] [CrossRef] [PubMed]
- Minagawa, T.; Tabata, Y.; Oyama, A.; Furukawa, H.; Yamao, T.; Yamamoto, Y. Controlled Release of Granulocyte Colony-Stimulating Factor Enhances Osteoconductive and Biodegradable Properties of Beta-Tricalcium Phosphate in a Rat Calvarial Defect Model. Int. J. Biomater. 2014, 2014, 1–11. [Google Scholar] [CrossRef]
- Arambula-Maldonado, R.; Geraili, A.; Xing, M.; Mequanint, K. Tissue engineering and regenerative therapeutics: The nexus of chemical engineering and translational medicine. Can. J. Chem. Eng. 2021, 99, 2069–2086. [Google Scholar] [CrossRef]
- Kirsch, M.; Birnstein, L.; Pepelanova, I.; Handke, W.; Rach, J.; Seltsam, A.; Scheper, T.; Lavrentieva, A. Gelatin-Methacryloyl (GelMA) Formulated with Human Platelet Lysate Supports Mesenchymal Stem Cell Proliferation and Differentiation and Enhances the Hydrogel’s Mechanical Properties. Bioengineering 2019, 6, 76. [Google Scholar] [CrossRef]
- Hench, L.L. Bioceramics. J. Am. Ceram. Soc. 2005, 81, 1705–1728. [Google Scholar] [CrossRef]
- Aslankoohi, N.; Lin, S.; Mequanint, K. Bioactive fluorescent hybrid microparticles as a stand-alone osteogenic differentiation inducer. Mater. Today Bio 2022, 13, 100187. [Google Scholar] [CrossRef] [PubMed]
- Sanchez, A.G.; Prokhorov, E.; Luna-Barcenas, G.; Hernández-Vargas, J.; Román-Doval, R.; Mendoza, S.; Rojas-Chávez, H. Chitosan-hydroxyapatite-MWCNTs nanocomposite patch for bone tissue engineering applications. Mater. Today Commun. 2021, 28, 102615. [Google Scholar] [CrossRef]
- Ngo, S.T.; Lee, W.-F.; Wu, Y.-F.; Salamanca, E.; Aung, L.M.; Chao, Y.-Q.; Tsao, T.-C.; Hseuh, H.-W.; Lee, Y.-H.; Wang, C.-C.; et al. Fabrication of Solvent-Free PCL/β-TCP Composite Fiber for 3D Printing: Physiochemical and Biological Investigation. Polymers 2023, 15, 1391. [Google Scholar] [CrossRef] [PubMed]
- Al-Khattaby, L.A.; Soliman, I.E.; Aboelnasr, M.A.; Eldera, S.S. In vitro study of the biphasic calcium phosphate/chitosan hybrid biomaterial scaffold fabricated via solvent casting and evaporation technique for bone regeneration. Nanotechnol. Rev. 2023, 12, 20230149. [Google Scholar] [CrossRef]
- Oonishi, H.; Hench, L.L.; Wilson, J.; Sugihara, F.; Tsuji, E.; Matsuura, M.; Kin, S.; Yamamoto, T.; Mizokawa, S. Quantitative comparison of bone growth behavior in granules of Bioglass®, A-W glass-ceramic, and hydroxyapatite. J. Biomed. Mater. Res. 2000, 51, 37–46. [Google Scholar] [CrossRef]
- Ogose, A.; Hotta, T.; Kawashima, H.; Kondo, N.; Gu, W.; Kamura, T.; Endo, N. Comparison of hydroxyapatite and beta tricalcium phosphate as bone substitutes after excision of bone tumors. J. Biomed. Mater. Res. 2005, 72B, 94–101. [Google Scholar] [CrossRef]
- Maçon, A.L.B.; Kim, T.B.; Valliant, E.M.; Goetschius, K.; Brow, R.K.; Day, D.E.; Hoppe, A.; Boccaccini, A.R.; Kim, I.Y.; Ohtsuki, C.; et al. A unified in vitro evaluation for apatite-forming ability of bioactive glasses and their variants. J. Mater. Sci. Mater. Med. 2015, 26, 115. [Google Scholar] [CrossRef]
- Hench, L.L.; Splinter, R.J.; Allen, W.C.; Greenlee, T.K. Bonding mechanisms at the interface of ceramic prosthetic materials. J. Biomed. Mater. Res. 1971, 5, 117–141. [Google Scholar] [CrossRef]
- Hamadouche, M.; Meunier, A.; Greenspan, D.C.; Blanchat, C.; Zhong, J.P.; La Torre, G.P.; Sedel, L. Long-termin vivo bioactivity and degradability of bulk sol-gel bioactive glasses. J. Biomed. Mater. Res. 2001, 54, 560–566. [Google Scholar] [CrossRef]
- Acuña, D.; Cohn, N.; Quero, F. Electrospun bioactive tertiary glass nanoparticles-containing silica/gelatin/polyethylene oxide hybrid membranes for potential dental bone tissue engineering applications. Mater. Lett. 2023, 337, 133997. [Google Scholar] [CrossRef]
- Bento, R.; Gaddam, A.; Ferreira, J.M.F. Sol–Gel Synthesis and Characterization of a Quaternary Bioglass for Bone Regeneration and Tissue Engineering. Materials 2021, 14, 4515. [Google Scholar] [CrossRef] [PubMed]
- Jones, J.R.; Gentleman, E.; Polak, J. Bioactive Glass Scaffolds for Bone Regeneration. Elements 2007, 3, 393–399. [Google Scholar] [CrossRef]
- Hench, L.L.; West, J.K. The sol-gel process. Chem. Rev. 1990, 90, 33–72. [Google Scholar] [CrossRef]
- Li, R.; Clark, A.E.; Hench, L.L. An investigation of bioactive glass powders by sol-gel processing. J. Appl. Biomater. 1991, 2, 231–239. [Google Scholar] [CrossRef] [PubMed]
- Pittenger, M.F.; Discher, D.E.; Péault, B.M.; Phinney, D.G.; Hare, J.M.; Caplan, A.I. Mesenchymal stem cell perspective: Cell biology to clinical progress. Npj Regen. Med. 2019, 4, 22. [Google Scholar] [CrossRef] [PubMed]
- Jungbluth, P.; Spitzhorn, L.-S.; Grassmann, J.; Tanner, S.; Latz, D.; Rahman, M.S.; Bohndorf, M.; Wruck, W.; Sager, M.; Grotheer, V.; et al. Human iPSC-derived iMSCs improve bone regeneration in mini-pigs. Bone Res. 2019, 7, 32. [Google Scholar] [CrossRef] [PubMed]
- Sheyn, D.; Ben-David, S.; Shapiro, G.; De Mel, S.; Bez, M.; Ornelas, L.; Sahabian, A.; Sareen, D.; Da, X.; Pelled, G.; et al. Human Induced Pluripotent Stem Cells Differentiate Into Functional Mesenchymal Stem Cells and Repair Bone Defects. Stem Cells Transl. Med. 2016, 5, 1447–1460. [Google Scholar] [CrossRef]
- Yang, Y.-H.K.; Ogando, C.R.; Wang See, C.; Chang, T.-Y.; Barabino, G.A. Changes in phenotype and differentiation potential of human mesenchymal stem cells aging in vitro. Stem Cell Res. Ther. 2018, 9, 131. [Google Scholar] [CrossRef]
- Aslankoohi, N.; Mequanint, K. Poly(ester amide)–Bioactive Glass Hybrid Biomaterials for Bone Regeneration and Biomolecule Delivery. ACS Appl. Bio Mater. 2020, 3, 3621–3630. [Google Scholar] [CrossRef]
- Esseltine, J.L.; Shao, Q.; Brooks, C.; Sampson, J.; Betts, D.H.; Séguin, C.A.; Laird, D.W. Connexin43 Mutant Patient-Derived Induced Pluripotent Stem Cells Exhibit Altered Differentiation Potential. J. Bone Miner. Res. 2017, 32, 1368–1385. [Google Scholar] [CrossRef] [PubMed]
- Fusaki, N.; Ban, H.; Nishiyama, A.; Saeki, K.; Hasegawa, M. Efficient induction of transgene-free human pluripotent stem cells using a vector based on Sendai virus, an RNA virus that does not integrate into the host genome. Proc. Jpn. Acad. Ser. B 2009, 85, 348–362. [Google Scholar] [CrossRef]
- Shao, Q.; Esseltine, J.L.; Huang, T.; Novielli-Kuntz, N.; Ching, J.E.; Sampson, J.; Laird, D.W. Connexin43 is Dispensable for Early Stage Human Mesenchymal Stem Cell Adipogenic Differentiation But is Protective against Cell Senescence. Biomolecules 2019, 9, 474. [Google Scholar] [CrossRef] [PubMed]
- Gregory, C.A.; Grady Gunn, W.; Peister, A.; Prockop, D.J. An Alizarin red-based assay of mineralization by adherent cells in culture: Comparison with cetylpyridinium chloride extraction. Anal. Biochem. 2004, 329, 77–84. [Google Scholar] [CrossRef] [PubMed]
- Joddar, B.; Hoshiba, T.; Chen, G.; Ito, Y. Stem cell culture using cell-derived substrates. Biomater. Sci. 2014, 2, 1595–1603. [Google Scholar] [CrossRef] [PubMed]
- Faia-Torres, A.B.; Goren, T.; Ihalainen, T.O.; Guimond-Lischer, S.; Charnley, M.; Rottmar, M.; Maniura-Weber, K.; Spencer, N.D.; Reis, R.L.; Textor, M.; et al. Regulation of Human Mesenchymal Stem Cell Osteogenesis by Specific Surface Density of Fibronectin: A Gradient Study. ACS Appl. Mater. Interfaces 2015, 7, 2367–2375. [Google Scholar] [CrossRef] [PubMed]
- Mogha, P.; Iyer, S.; Majumder, A. Extracellular matrix protein gelatin provides higher expansion, reduces size heterogeneity, and maintains cell stiffness in a long-term culture of mesenchymal stem cells. Tissue Cell 2023, 80, 101969. [Google Scholar] [CrossRef] [PubMed]
- Yin, B.; Yang, H.; Yang, M. Integrating Soft Hydrogel with Nanostructures Reinforces Stem Cell Adhesion and Differentiation. J. Compos. Sci. 2022, 6, 19. [Google Scholar] [CrossRef]
- Li, X.; Klausen, L.H.; Zhang, W.; Jahed, Z.; Tsai, C.-T.; Li, T.L.; Cui, B. Nanoscale Surface Topography Reduces Focal Adhesions and Cell Stiffness by Enhancing Integrin Endocytosis. Nano Lett. 2021, 21, 8518–8526. [Google Scholar] [CrossRef]
- Hou, Y.; Xie, W.; Yu, L.; Camacho, L.C.; Nie, C.; Zhang, M.; Haag, R.; Wei, Q. Surface Roughness Gradients Reveal Topography-Specific Mechanosensitive Responses in Human Mesenchymal Stem Cells. Small 2020, 16, 1905422. [Google Scholar] [CrossRef]
- Knight, D.K.; Gillies, E.R.; Mequanint, K. Biomimetic l-aspartic acid-derived functional poly(ester amide)s for vascular tissue engineering. Acta Biomater. 2014, 10, 3484–3496. [Google Scholar] [CrossRef] [PubMed]
- Arredondo, R.; Poggioli, F.; Martínez-Díaz, S.; Piera-Trilla, M.; Torres-Claramunt, R.; Tío, L.; Monllau, J.C. Fibronectin-coating enhances attachment and proliferation of mesenchymal stem cells on a polyurethane meniscal scaffold. Regen. Ther. 2021, 18, 480–486. [Google Scholar] [CrossRef]
- Gao, S.; Chen, B.; Gao, M.; Xu, Y.; Yang, X.; Yang, C.; Pan, S. Substrate Stiffness of Bone Microenvironment Controls Functions of Pre-Osteoblasts and Fibroblasts In Vitro. Biomimetics 2023, 8, 344. [Google Scholar] [CrossRef]
- Klavert, J.; Van Der Eerden, B.C.J. Fibronectin in Fracture Healing: Biological Mechanisms and Regenerative Avenues. Front. Bioeng. Biotechnol. 2021, 9, 663357. [Google Scholar] [CrossRef]
- Kristensen, H.B.; Andersen, T.L.; Marcussen, N.; Rolighed, L.; Delaisse, J.-M. Osteoblast Recruitment Routes in Human Cancellous Bone Remodeling. Am. J. Pathol. 2014, 184, 778–789. [Google Scholar] [CrossRef] [PubMed]
- Einhorn, T.A. The Cell and Molecular Biology of Fracture Healing. Clin. Orthop. Relat. Res. 1998, 355S, S7–S21. [Google Scholar] [CrossRef] [PubMed]
- Maes, C.; Kobayashi, T.; Selig, M.K.; Torrekens, S.; Roth, S.I.; Mackem, S.; Carmeliet, G.; Kronenberg, H.M. Osteoblast Precursors, but Not Mature Osteoblasts, Move into Developing and Fractured Bones along with Invading Blood Vessels. Dev. Cell 2010, 19, 329–344. [Google Scholar] [CrossRef]
- Hojo, H.; Ohba, S. Sp7 Action in the Skeleton: Its Mode of Action, Functions, and Relevance to Skeletal Diseases. Int. J. Mol. Sci. 2022, 23, 5647. [Google Scholar] [CrossRef]
- Rashid, H.; Ma, C.; Chen, H.; Wang, H.; Hassan, M.Q.; Sinha, K.; De Crombrugghe, B.; Javed, A. Sp7 and Runx2 molecular complex synergistically regulate expression of target genes. Connect. Tissue Res. 2014, 55, 83–87. [Google Scholar] [CrossRef]
- Hojo, H.; Saito, T.; He, X.; Guo, Q.; Onodera, S.; Azuma, T.; Koebis, M.; Nakao, K.; Aiba, A.; Seki, M.; et al. Runx2 regulates chromatin accessibility to direct the osteoblast program at neonatal stages. Cell Rep. 2022, 40, 111315. [Google Scholar] [CrossRef]
- Artigas, N.; Ureña, C.; Rodríguez-Carballo, E.; Rosa, J.L.; Ventura, F. Mitogen-activated Protein Kinase (MAPK)-regulated Interactions between Osterix and Runx2 Are Critical for the Transcriptional Osteogenic Program. J. Biol. Chem. 2014, 289, 27105–27117. [Google Scholar] [CrossRef] [PubMed]
- Morinobu, M.; Ishijima, M.; Rittling, S.R.; Tsuji, K.; Yamamoto, H.; Nifuji, A.; Denhardt, D.T.; Noda, M. Osteopontin Expression in Osteoblasts and Osteocytes During Bone Formation Under Mechanical Stress in the Calvarial Suture In Vivo. J. Bone Miner. Res. 2003, 18, 1706–1715. [Google Scholar] [CrossRef] [PubMed]
- Hunter, G.K. Role of Osteopontin in Modulation of Hydroxyapatite Formation. Calcif. Tissue Int. 2013, 93, 348–354. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, D.E.; Thula-Mata, T.; Toro, E.J.; Yeh, Y.-W.; Holt, C.; Holliday, L.S.; Gower, L.B. Multifunctional role of osteopontin in directing intrafibrillar mineralization of collagen and activation of osteoclasts. Acta Biomater. 2014, 10, 494–507. [Google Scholar] [CrossRef] [PubMed]
- Depalle, B.; McGilvery, C.M.; Nobakhti, S.; Aldegaither, N.; Shefelbine, S.J.; Porter, A.E. Osteopontin regulates type I collagen fibril formation in bone tissue. Acta Biomater. 2021, 120, 194–202. [Google Scholar] [CrossRef] [PubMed]
- Somaiah, C.; Kumar, A.; Mawrie, D.; Sharma, A.; Patil, S.D.; Bhattacharyya, J.; Swaminathan, R.; Jaganathan, B.G. Collagen Promotes Higher Adhesion, Survival and Proliferation of Mesenchymal Stem Cells. PLoS ONE 2015, 10, e0145068. [Google Scholar] [CrossRef] [PubMed]
- Akhir, H.M.; Teoh, P.L. Collagen type I promotes osteogenic differentiation of amniotic membrane-derived mesenchymal stromal cells in basal and induction media. Biosci. Rep. 2020, 40, BSR20201325. [Google Scholar] [CrossRef] [PubMed]
- Mizuno, M.; Fujisawa, R.; Kuboki, Y. Type I collagen-induced osteoblastic differentiation of bone-marrow cells mediated by collagen-?2?1 integrin interaction. J. Cell. Physiol. 2000, 184, 207–213. [Google Scholar] [CrossRef]
- Chiu, L.-H.; Lai, W.-F.T.; Chang, S.-F.; Wong, C.-C.; Fan, C.-Y.; Fang, C.-L.; Tsai, Y.-H. The effect of type II collagen on MSC osteogenic differentiation and bone defect repair. Biomaterials 2014, 35, 2680–2691. [Google Scholar] [CrossRef]
- Janicki, P.; Kasten, P.; Kleinschmidt, K.; Luginbuehl, R.; Richter, W. Chondrogenic pre-induction of human mesenchymal stem cells on β-TCP: Enhanced bone quality by endochondral heterotopic bone formation. Acta Biomater. 2010, 6, 3292–3301. [Google Scholar] [CrossRef]
- Lian, C.; Wang, X.; Qiu, X.; Wu, Z.; Gao, B.; Liu, L.; Liang, G.; Zhou, H.; Yang, X.; Peng, Y.; et al. Collagen type II suppresses articular chondrocyte hypertrophy and osteoarthritis progression by promoting integrin β1−SMAD1 interaction. Bone Res. 2019, 7, 8. [Google Scholar] [CrossRef]
- Florencio-Silva, R.; Sasso, G.R.D.S.; Sasso-Cerri, E.; Simões, M.J.; Cerri, P.S. Biology of Bone Tissue: Structure, Function, and Factors That Influence Bone Cells. BioMed Res. Int. 2015, 2015, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Malaval, L.; Modrowski, D.; Gupta, A.K.; Aubin, J.E. Cellular expression of bone-related proteins during in vitro osteogenesis in rat bone marrow stromal cell cultures. J. Cell. Physiol. 1994, 158, 555–572. [Google Scholar] [CrossRef] [PubMed]
- Khoswanto, C. Role of matrix metalloproteinases in bone regeneration: Narrative review. J. Oral Biol. Craniofacial Res. 2023, 13, 539–543. [Google Scholar] [CrossRef] [PubMed]
- Agnihotri, R.; Crawford, H.C.; Haro, H.; Matrisian, L.M.; Havrda, M.C.; Liaw, L. Osteopontin, a Novel Substrate for Matrix Metalloproteinase-3 (Stromelysin-1) and Matrix Metalloproteinase-7 (Matrilysin). J. Biol. Chem. 2001, 276, 28261–28267. [Google Scholar] [CrossRef]
- Gordon, J.A.R.; Tye, C.E.; Sampaio, A.V.; Underhill, T.M.; Hunter, G.K.; Goldberg, H.A. Bone sialoprotein expression enhances osteoblast differentiation and matrix mineralization in vitro. Bone 2007, 41, 462–473. [Google Scholar] [CrossRef]
GelMA-BG-MWCNT Nomenclature | GelMA (wt.%) | BG (wt.%) | MWCNT (wt.%) | ||||
---|---|---|---|---|---|---|---|
100-0-0 | 100 | 0 | 0 | ||||
70-30-0 | 70-30-1 | 70-30-2 | 70 | 30 | 0 | 1 | 2 |
Gene | Forward (5′ → 3′) | Reverse (5′ → 3′) |
---|---|---|
Runx2 | CCCAGTATGAGAGTAGGTGTCC | GGGTAAGACTGGTCATAGGACC |
Sp7 | TTCTGCGGCAAGAGGTTCACTC | GTGTTTGCTCAGGTGGTCGCTT |
Col2A1 | AGCCTGGTGATGATGGTGAA | ACTCTCACCCTTCACACCAG |
OPN | TCACCTGTGCCATACCAGTT | TGTGGTCATGGCTTTCGTTG |
18S | GCGGTTCTATTTTGTTGGTTT | CTCCGACTTTCGTTCTTGATT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Arambula-Maldonado, R.; Mequanint, K. Osteogenic Differentiation Potential of iMSCs on GelMA-BG-MWCNT Nanocomposite Hydrogels. Biomimetics 2024, 9, 338. https://doi.org/10.3390/biomimetics9060338
Arambula-Maldonado R, Mequanint K. Osteogenic Differentiation Potential of iMSCs on GelMA-BG-MWCNT Nanocomposite Hydrogels. Biomimetics. 2024; 9(6):338. https://doi.org/10.3390/biomimetics9060338
Chicago/Turabian StyleArambula-Maldonado, Rebeca, and Kibret Mequanint. 2024. "Osteogenic Differentiation Potential of iMSCs on GelMA-BG-MWCNT Nanocomposite Hydrogels" Biomimetics 9, no. 6: 338. https://doi.org/10.3390/biomimetics9060338