Next Article in Journal
Nanomedicine-Based Advances in Brain Cancer Treatment—A Review
Previous Article in Journal
Illustrating the Pathogenesis and Therapeutic Approaches of Epilepsy by Targeting Angiogenesis, Inflammation, and Oxidative Stress
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Neuroglia
Volume 6
Issue 3
10.3390/neuroglia6030027
neuroglia-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Astrocyte-Conditioned Medium Induces Protection Against Ischaemic Injury in Primary Rat Neurons

by
Ayesha Singh
and
Ruoli Chen
*
School of Allied Health Professions and Pharmacy, Keele University, Staffordshire ST5 5BG, UK
*
Author to whom correspondence should be addressed.
Neuroglia 2025, 6(3), 27; https://doi.org/10.3390/neuroglia6030027
Submission received: 4 June 2025 / Revised: 11 July 2025 / Accepted: 16 July 2025 / Published: 17 July 2025
Browse Figures
Review Reports Versions Notes

Abstract

Background: Astrocytes are not only structural cells but also play a pivotal role in neurogenesis and neuroprotection by secreting a variety of neurotrophic factors that support neuronal survival, growth, and repair. This study investigates the time-dependent responses of primary rat cortical astrocytes to oxygen–glucose deprivation (OGD) and evaluates the neuroprotective potential of astrocyte-conditioned medium (ACM). Methods: Primary rat cortical astrocytes and neurons were obtained from postnatal Sprague Dawley rat pups (P1–3) and embryos (E17–18), respectively. Astrocytes exposed to 6, 24, and 48 h of OGD (0.3% O2) were assessed for viability, metabolic function, hypoxia-inducible factor 1 and its downstream genes expression. Results: While 6 h OGD upregulated protective genes such as Vegf, Glut1, and Pfkfb3 without cell loss, prolonged OGD, e.g., 24 or 48 h, led to significant astrocyte death and stress responses, including elevated LDH release, reduced mitochondrial activity, and increased expression of pro-apoptotic marker Bnip3. ACM from 6 h OGD-treated astrocytes significantly enhanced neuronal survival following 6 h OGD and 24 h reperfusion, preserving dendritic architecture, improving mitochondrial function, and reducing cell death. This protective effect was not observed with ACM from 24 h OGD astrocytes. Furthermore, 6 h OGD-ACM induced autophagy in neurons, as indicated by elevated LC3b-II and decreased p62 levels, suggesting autophagy as a key mechanism in ACM-mediated neuroprotection. Conclusions: These findings demonstrate that astrocytes exhibit adaptive, time-sensitive responses to ischemic stress and secrete soluble factors that can confer neuroprotection. This study highlights the therapeutic potential of targeting astrocyte-mediated signalling pathways to enhance neuronal survival following ischemic stroke.

1. Introduction

Astrocytes are the most abundant cells in the brain, closely interacting with neurons, blood vessels, extracellular matrix, and other glial cells. Traditionally regarded as supportive elements in the brain, recent studies have highlighted astrocytes’ significant role in maintaining neurological function, neural homeostasis, and in the pathogenesis of neurological disorders [1,2]. While astrocytes and neurons coexist within the ischaemic core, astrocytes tend to be more resilient to ischaemia, which has prompted increasing interest in their role in ischaemic stroke pathophysiology [3]. The growing body of evidence suggests that astrocytes are crucial players in the progression and recovery following ischaemic stroke [4].
Astrocytes play an essential role as the brain’s sentinels, responding to neuronal stress by providing metabolic and trophic support to neurons. These cells protect neurons through several anti-excitotoxic mechanisms, including the uptake of excess glutamate, provision of erythropoietin (EPO) and glutathione (GSH), regulation of antioxidant genes, mitochondrial transfer, and glycogen release to sustain neuronal energy [1]. Additionally, astrocytes sequester free iron, form glial scars, and modulate the neuroinflammatory response through cytokine production [5,6]. During ischaemia, astrocytes secrete cytokines such as interleukins (IL-6, IL-10, IL-1β), interferon γ (IFNγ), and transforming growth factor β (TGFβ), which contribute to both neurodegeneration and neuroprotection. These responses are largely regulated by the nuclear factor kappa B (NF-κB) signalling pathway [5]. Additionally, hypoxia-inducible factors (HIFs), particularly HIF-1α, are stabilised under hypoxic conditions and play a crucial role in regulating astrocytic responses to ischaemia [7,8]. HIFs promote the transcription of various genes involved in cell survival, angiogenesis, and metabolic adaptation, thereby contributing to both the protective and pathological roles of astrocytes during ischaemic injury [7,8,9]. Furthermore, astrocytes promote neurogenesis and neuronal survival by secreting a range of neurotrophic factors, including nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), glial cell line-derived neurotrophic factor (GDNF), heparin-binding EGF-like growth factor (HB-EGF), and vascular endothelial growth factor (VEGF). Notably, many of these factors are regulated by HIFs, thereby linking astrocytic responses to hypoxic conditions with mechanisms of tissue repair and regeneration following ischaemic injury [10,11,12,13,14].
Previous studies have demonstrated that soluble factors released by astrocytes can protect neurons from cell death induced by ischaemic conditions. For instance, astrocyte-conditioned medium (ACM) has been shown to protect murine neurons by releasing TGFβ, which activates the activator protein-1 (AP-1) protective pathway [15]. Recent research also suggests that ACM constituents such as IL-6, IL-10, IL-1β, and TGFβ play crucial roles in inducing ischaemic tolerance in neurons [5]. Furthermore, ACM has been shown to modulate neurotrophic factor secretion and regulate apoptosis-related proteins in response to ischaemic stress [16,17].
This study aims to investigate the role of astrocytes in neuroprotection following ischaemic injury, with a focus on the contributions of astrocyte-secreted proteins. The first part of this study evaluates the effects of in vitro ischaemia on primary rat astrocytes, assessing cell viability, glial fibrillary acidic protein (GFAP) expression, and the activation of HIF-1α and HIF-2α. The second part examines the impact of ACM derived from astrocytes subjected to ischaemic insult on primary rat cortical neurons. The study also explores the modulation of autophagic molecules by the ACM. Through these investigations, this work seeks to elucidate the mechanisms by which astrocytes contribute to neuronal survival during ischaemic stroke and to identify potential therapeutic targets for stroke treatment and recovery.

2. Experimental Procedures

2.1. Materials

All general reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise stated. Cell culture media (DMEM, neurobasal, glucose-free variants), supplements [Foetal Bovine Serum (FBS), horse serum, B27, Glutamax, L-glutamine, sodium pyruvate], antibiotics (penicillin–streptomycin), and reagents for protein and RNA analysis (Pierce BCA kit, ECL substrates, RNeasy Plus Mini Kit, Tetro cDNA synthesis kit, SensiFAST SYBR Hi-ROX) were purchased from ThermoFisher Scientific (Loughborough, UK). Antibodies and Western blotting consumables were sourced from Abcam (Cambridge, UK), Novus Biologics (Centennial, CO, USA), R&D Systems (Minneapolis, MN, USA), Dako (Agilent, Santa Clara, CA, USA), and Bio-Rad (Hercules, CA, USA). Plasticware for cell culture was supplied by Greiner Bio-One (Gloucestershire, UK).

2.2. Cell Culture

All animal procedures were approved by Keele University’s School of Life Sciences Ethics Committee under Establishment Licence X350251A8, in accordance with the UK Animals (Scientific Procedures) Act (1986).

2.2.1. Primary Rat Astrocyte Culture Preparation

Sprague Dawley rat pups (postnatal days 1–3) were euthanised via decapitation, and brains were harvested following removal of the skin from the back of the skull to the nose. Isolated brains were placed in ice-cold EBSS—the dissection media in a Petri dish, and the olfactory bulbs and cerebellum were removed. The cerebral cortices were extracted, and meninges were carefully removed before transferring the cortices to fresh ice-cold dissection media. Cortical tissue was minced using a sterile scalpel, transferred to a 50 mL falcon tube, and mechanically dissociated by trituration using a pipette. The resulting cell suspension was sequentially filtered through a 70 µm cell strainer. The filtrate was centrifuged at 300× g for 5 min, and the pellet was resuspended in 10 mL of D10 media (DMEM, 10% FBS, and 1% penicillin–streptomycin). Cells were counted and plated in PDL-coated T75 flasks at a density of 2 × 106 cells per flask. Cultures were maintained at 37 °C in a humidified incubator with 5% CO2, with 50% media changes every 2–3 days. After 7–8 days, once astrocytes reached confluency, microglia were removed by shaking the flasks at 180 revolutions per minute (rpm) for 30 min. Media were discarded, cells were washed with PBS, and fresh D10 media (10 mL) was added. Flasks were incubated for 3–6 h before overnight shaking at 220 rpm (~18 h) to remove oligodendrocyte precursor cells (OPCs). This sequential shaking and media replacement was repeated for 3–4 days. The remaining astrocyte layer was washed with PBS, treated with 5 mL TrypLE, shaken for 5 min, and tapped sharply to detach cells. The suspension was collected in 15 mL falcon tubes, centrifuged at 300× g for 5 min, and resuspended in 10 mL fresh D10 media. Cells were counted and re-plated in PDL-coated T75 flasks at a density of 2 × 106 cells per flask. Upon reaching confluency, astrocytes were trypsinised again and plated onto PDL-coated formats at the following densities: 1.5 × 106 cells/5 mL in T25 flasks (for protein/RNA extraction), 3 × 104 cells/100 µL in 96-well plates, and 1.5 × 105 cells/300 µL in 24-well plates. Cultures were maintained at 37 °C in 5% CO2, with 50% media changes every 2–3 days and used for experiments upon reaching confluency.

2.2.2. Primary Cortical Rat Neurons Culture

E17–18 rat embryos were collected and cortices dissected in cold EBSS. Tissue was digested with 0.05% trypsin and 100 µg/mL DNase, then inactivated with 10% FBS. Cells were dissociated, centrifuged (1500 rpm, 5 min), resuspended in neurobasal medium (2% B27, 2 mM L-glutamine, 1% penicillin/streptomycin), filtered (70 μm), and plated onto PDL-coated plates at 0.15 × 106 cells/cm2. Cultures were maintained at 37 °C with 5% CO2. Experiments were performed between Day in Vitro (DIV) 9–14.

2.3. Oxygen and Glucose Deprivation (OGD)

Astrocytes were switched to glucose-free DMEM with 10% FBS and 1% penicillin–streptomycin, then transferred to a purpose-built INVIVO2 400 humidified hypoxia workstation (Ruskinn Technologies, Bridgend, UK) with atmospheric conditions established at 0.3% O2, 5% CO2, 94% N2 and 37 °C for 6, 24 or 48 h. Neurons were exposed to glucose-free neurobasal medium (2% B27, 2 mM L-glutamine, 1% penicillin–streptomycin) and subjected to 6 h OGD in the same chamber.

2.4. Applying Astrocyte-Conditioned Media onto Primary Rat Neuron Culture

Upon confluence, the astrocytes were washed twice with PBS and switched to complete neurobasal media (100% media change). The cultures were maintained in the standard incubator for 2 days. After 2 days, 100% of the media was aspirated from the flasks and treated with either normoxia or OGD 6 or 24 h. Upon completion of treatment, the ACM was collected and applied to primary rat neurons (~70–80% confluence) for 6 h. Thereafter, the neurons were subject to 6 h OGD as stated above, followed by 24 h reperfusion.

2.5. Assessment of Cell Viability

2.5.1. 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT) Assays

Mitochondrial metabolic activity was assessed using the MTT assay [18], with normoxic controls defined as 100%. Results were normalised accordingly.

2.5.2. Lactate Dehydrogenase (LDH) Release Assay

LDH activity in media was measured per manufacturer’s instructions [18] and expressed as a percentage of maximal LDH release.

2.6. Immunofluorescence

Cells were fixed in 4% PFA (15 min), permeabilised in 0.1% Triton X-100 (15 min), and blocked in 5% BSA for 1 h. Primary antibodies (anti-GFAP or anti-MAP2, 1:500 in 1% BSA) were applied overnight at 4 °C. After PBS washes, secondary antibodies (goat anti-rabbit IgG-FITC, 1:200) were applied for 2 h at room temperature. Nuclei were counterstained with DAPI in Vectashield. Images were captured using a Nikon Eclipse 80i fluorescence microscope (Nikon Instruments, Tokyo, Japan) and processed using NIS-Element BR 3.22.14 software.

2.7. Protein Extraction and Western Immunoblotting

Cell lysates were prepared and quantified as previously described [18]. Proteins (20–40 µg) were denatured in Laemmli buffer (95 °C, 5 min), separated via SDS-PAGE, and transferred to nitrocellulose membranes. Membranes were blocked in 5% milk in PBS-T, incubated overnight with primary antibodies (e.g., HIF-1α, LC3B, p62), followed by HRP-conjugated secondary antibodies (1:1000). Detection was performed using ECL substrate. Membranes were stripped and re-probed with β-actin as a loading control. Densitometric analysis was performed using ImageJ (1.x) version 1.54 p.

2.8. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

Quantification of mRNA expression was performed using the comparative delta Ct method. RNA was extracted using the RNeasy Plus Kit and reverse-transcribed to cDNA using the Tetro cDNA synthesis kit. qPCR was performed on a Techne Prime Pro 48 system using SensiFAST SYBR Hi-ROX. Primers targeting Actin, Hif1α, glucose transporter 1 (Glut-1), BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 (Bnip3), prolyl hydroxylase 2 (Phd2), vascular endothelial growth factor (Vegf), 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 (Pfkfb1), 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (Pfkfb3), and lactate dehydrogenase A (Ldha) were used. Actin was used as an internal control to normalise the relative levels of mRNA, while others were responsive to hypoxia. The primers’ sequences are listed in Table 1. Relative expression was quantified using the ΔΔCt method, normalised to Actin.

2.9. Data Analysis

Experiments in 96-well format included 3–8 replicates. Independent biological replicates (n) were derived from different litters (astrocytes) or pregnant rats (neurons). Data are presented as mean ± SD. Statistical significance was assessed using one-way ANOVA with Tukey’s post hoc test in GraphPad Prism v10 (GraphPad Software Inc., San Diego, CA, USA). p-values < 0.05 were considered significant.

3. Results

3.1. Primary Rat Astrocytes Culture

A typical primary rat astrocyte culture was represented in Figure 1 consisted of 94.12 ± 6.55% of GFAP+. The astrocytes were then treated with OGD (0.3% O2) for 6 h, 24 h and 48 h. There were no significant changes in GFAP staining as well as GFAP-positive cell numbers per microscopic filed in 6 h OGD astrocytes, but significant increase in GFAP staining while reduced GFAP-positive cell numbers per microscopic field in cultures in 24 h or 48 h OGD astrocytes compared to normoxia controls (same time point) (Figure 2). There was no significant difference in GFAP intensity between 24 h and 48 h OGD-treated cultures. The cell densities (GFAP+ nuclei/microscopic field) in 24 h were significantly (p < 0.01) lower than that after 48 h OGD (Figure 2).
Mitochondrial activity and LDH release were not altered by 6 h OGD, while there was a significant reduction in mitochondrial activity and an increase in LDH release at 24 h or 48 h OGD compared to normoxia controls (same time point) (Figure 3). The mitochondrial activity was significantly lower while LDH release was significantly higher at 48 h OGD than those at 24 h OGD (Figure 3).
The expression of HIF-1α proteins was studied in primary rat astrocytes exposed to 6 h and 24 h OGD, but not in astrocytes in 48 h OGD because of low protein yielded as ~70–80% of the cells were dead in the latter. HIF-1α was stabilised by 6 or 24 h OGD, while there were no significant differences in HIF-1α expression between them (Figure 4, the full length of the Figure 4A is in Supplementary Materials).
Thereafter, effects of 6 h or 24 h OGD on hypoxia gene expressions in the primary rat astrocytes were investigated (Figure 5). Hif1α, Hif2α, or Pfkfb1 expression was not changed by either 6 h or 24 h OGD. Phd2, Vegf, Glut1, and Pfkfb3 expressions were significantly upregulated by both 6 h and 24 h OGD. Vegf expression was significantly higher at 24 h OGD compared to 6 h OGD, while there was no significant difference in Glut1, or Phd2, or Pfkfb3 expression at 24 h OGD compared to 6 h OGD. Both Epo and Bnip3 expressions were significantly upregulated by 24 h OGD, but not at 6 h OGD. Ldha was significantly upregulated by 6 h OGD, but not by 24 h OGD.

3.2. Effect of ACM on Primary Rat Neurons Following 6 h Oxygen and Glucose Deprivation

Primary rat neurons were preconditioned for 6 h with complete neurobasal media (sham treatment) or whole ACM from astrocytes subjected to normoxia, 6 h or 24 h OGD. After preconditioning treatment for 6 h, the neurons were subjected to 6 h OGD treatment followed by 24 h reperfusion. Untreated control cultures consisted of MAP2+ neurons surrounded by numerous dendrites (10.2 ± 3.4 dendrites per neuron, with each dendrites measuring 29.6 ± 6.8 µm, n = 4) (Figure 6). OGD (6 h) and reperfusion (24 h) resulted in degradation of dendrites (3.2 ± 1.8 dendrites per neuron, n = 4). The 6 h OGD-ACM preconditioned cultures consisted of neurons similar to the controls (whole: 9.3 ± 4.5 dendrites per neuron, with each dendrites measuring 27.2 ± 5.1 µm, n = 4) while 24 h OGD-ACM preconditioning could not preserve neurons subject to OGD (3.5 ± 2.0 dendrites per neuron, n = 4) (Figure 6).
Both 6 h OGD and 24 h reperfusion resulted in significantly reduced mitochondrial activity and increased LDH release by the primary rat neurons (Figure 7). Preconditioning with 6 h OGD-ACM, but not 24 h OGD ACM preserved mitochondrial activity and reduced cell losses by OGD (6 h)/reperfusion (24 h) treatment (Figure 7).
Both 6 h OGD-ACM and 24 h OGD-ACM treatments significantly upregulated Lc3b-II expression, although the expression was significantly lesser by 24 h OGD-ACM treatment compared to those by 6 h OGD-ACM treatment (Figure 8). Both 6 h OGD-ACM and 24 h OGD-ACM treatments significantly downregulated p62 expression in primary neurons, while there was no significant difference in p62 expression between 6 h OGD-ACM and 24 h OGD-ACM treated cells (Figure 8, the full length of the Figure 8A is in Supplementary Materials).

4. Discussion

In this study, we analysed cell viability and stress responses in primary rat cortical astrocytes and neurons under OGD conditions and explored the neuroprotective potential of ACM derived from astrocytes subjected to normoxia, 6 h OGD, or 24 h OGD, in the context of ischemic injury. The findings underscore the complex and multifaceted role of astrocytes in ischemic conditions, highlighting the differential contributions of soluble factors in mediating neuroprotection.
A significant reduction in mitochondrial activity and an increase in LDH release were observed at 24 h and 48 h OGD (0.3% O2) in the primary cortical rat astrocytes, aligning with previous studies showing a similar trend starting from 12 h of OGD (0% O2) [19]. In contrast, 6 h OGD (0.3% O2) did not induce significant changes in MTT activity and LDH release in primary astrocytes, suggesting a time-dependent response to ischemic injury. In the primary rat cortical neuronal cultures, the mitochondrial activity and LDH release following 6 h OGD (0.3% O2) were indicative of neuronal death [20]. Astrocytes, however, appeared to be resistant to the insult, highlighting their protective role during early ischemic stress. This might be due to their metabolic adaptations, such as shifting to anaerobic glycolysis and utilising glycogen stores to sustain energy production under low-oxygen conditions. This metabolic flexibility helps astrocytes survive in conditions that would otherwise be damaging to neurons [21].
Astrogliosis, characterised by increased GFAP expression and extended processes, was observed in astrocytes subjected to prolonged OGD for 24 h and 48 h but not after 6 h of OGD. This response aligns with previous findings demonstrating astrocytic hypertrophy and increased GFAP levels in response to ischemic injury.
HIF-1α, a key transcription factor involved in the cellular response to hypoxia, was stabilised in astrocytes OGD but its gene expressions were not altered, suggesting that the regulation during hypoxia occurs via post-transcriptional mechanisms, rather than through changes in transcription. HIF-1 stabilisation promotes the expression of survival genes and metabolic adaptations, although it can also contribute to inflammation and cell death if dysregulated [7,22,23]. Several genes involved in glycolysis and survival were upregulated in response to OGD in astrocytes. BNIP3, a pro-apoptotic gene, was upregulated in astrocytes after 24 h OGD, suggesting a role in the cell death pathway [24]. VEGF and EPO, key factors involved in angiogenesis and cell survival, were significantly upregulated in astrocytes, supporting their role in maintaining tissue integrity during ischemic conditions [25,26]. Glut1 and PFKFB3 were also upregulated, enhancing glucose uptake and glycolytic activity to sustain cellular energy levels during oxygen deprivation [27,28]. During hypoxia, lactate production through anaerobic glycolysis, catalysed by LDHA, becomes crucial for maintaining energy production. Astrocytes export lactate to neurons, where it serves as an alternative energy source [29]. This intercellular metabolic exchange is vital for maintaining brain energy homeostasis during ischemic conditions. During hypoxic conditions, HIF-1α plays a pivotal role in inducing the expression of various cytokines and chemokines in astrocytes, potentially contributing to neuroinflammatory responses [30,31]. Proinflammatory cytokines like IL-1β and TNFα, secreted by astrocytes during ischemia, can promote neurogenesis and neuroprotection [32]. This observation highlights the complexity of the ischemic astrocyte response, where the same cytokines can both promote healing and exacerbate injury depending on the temporal context and extent of injury.
Astrocytes are known to secrete a variety of factors that can either support neuronal survival or contribute to neuronal death in response to ischemic insults [33]. Our findings that soluble factors in ACM, particularly from astrocytes subjected to 6 h OGD, were neuroprotective against a subsequent OGD insult, align with previous studies showing that ACM can induce ischemic tolerance in neurons [5,15]. Neuroprotective factors such as VEGF, NGF, GDNF, HB-EGF and BDNF, which are released by astrocytes during ischemia, have been shown to promote neuronal survival, neurogenesis, and angiogenesis [10,11,12,13,14]. Additionally, ACM-derived TNFα and TGFβ can switch from “inflammatory villains” to “neuroprotective allies” during ischemia, depending on timing, concentration, and cellular context [34,35,36,37], though further detailed studies are needed to fully elucidate the specific protein profile responsible for this protection.
Our results also suggest that autophagy plays a critical role in the neuroprotective effects of ACM. In neurons preconditioned with 6 h OGD-ACM, there was an upregulation of the autophagy marker LC3b-II and a downregulation of p62, indicating the induction of autophagy. These findings align with studies that have shown that ACM from primary retinal astrocytes can activate the PI3K/Akt pathway and protect neurons via autophagy [38]. However, it should be noted that autophagy and neuroprotection may represent either interdependent or independent processes, particularly in the absence of direct investigation into the underlying signalling pathways. In addition, soluble factors such as VEGF, IL-10, and TGFβ, found in ACM, have been reported to modulate autophagy in neurons, suggesting a complex interplay between cytokines, autophagy, and neuroprotection during ischemic injury [39,40]. Interestingly, while 6 h OGD-ACM induced autophagy and promoted neuroprotection, 24 h OGD-ACM did not confer the same level of protection. Instead, it exacerbated neuronal damage. This could be due to the excessive and prolonged autophagic activity induced by the 24 h OGD condition, which has been suggested to lead to cell death rather than survival [41]. These findings highlight the importance of the timing and extent of ischemic injury in determining whether astrocyte-secreted factors have a protective or deleterious effect.

5. Limitations and Future Directions

The finding that different durations of OGD yield ACM with distinct effects is intriguing and suggests a dynamic, context-dependent astrocyte response. However, the overall strength of the conclusions could be enhanced with more comprehensive analysis. In this study, our primary aim was to assess morphological preservation as a preliminary indicator of neuroprotection following exposure to ACM. Dendritic length was chosen due to its sensitivity to stress and injury in primary neurons. However, we fully acknowledge the limitations of using this single metric and will include complementary assays such as oxidative stress markers (e.g., ROS levels), mitochondrial function (e.g., JC-1, ATP assays), or cell death pathways (e.g., caspase-3 activity, TUNEL staining) in future studies. Furthermore, RNA sequencing could have provided a broader and more informative overview of transcriptional changes, revealing key pathways rather than focusing on a few selected genes, which offer limited insight without functional validation. Additionally, more thorough characterisation of the astrocyte populations would strengthen the findings. Given that the astrocyte response is already well-documented as being both contextual and time-dependent, a deeper mechanistic analysis is essential to substantiate the study’s contribution to the field.
While the present study focused on the short-term effects of ACM on neuronal survival, the long-term effects of preconditioning with ACM, including the recovery of neuronal function and the potential for tissue regeneration, remain to be investigated. Given the complexity of the ischemic brain environment, it is likely that a combination of factors, including cytokines, growth factors, and exosomes, work in concert to promote neuroprotection. Understanding how these factors interact and the mechanisms through which they exert their effects will be crucial for developing therapeutic strategies to mitigate ischemic brain injury.
Lastly, the exact protein profile in the ACM responsible for neuroprotection remains unclear. Given that both soluble factors and exosomes may contribute to the neuroprotective effects, a more detailed characterisation of these components is needed. Additionally, the role of miRNA in the ischemic response, especially the potential contribution of miR-92b-3p and miR-124 in mediating neuroprotection, should be explored further [42,43,44].

6. Conclusions

In summary, this study highlights the complex and adaptive mechanisms that astrocytes employ to survive under ischemic conditions. While the 6 h OGD ACM appeared to confer neuroprotection to primary rat neurons, the 24 h ACM failed to do so. One possible explanation is that astrocytes subjected to brief OGD enter a preconditioned state, activating adaptive and neuroprotective pathways such as the release of trophic factors (e.g., VEGF, IL-10), antioxidants, and exosomes enriched in protective cargo [44,45,46]. In contrast, prolonged OGD may drive astrocytes into a state of cellular distress or dysfunction, leading to a shift in their secretome toward proinflammatory or neurotoxic mediators, including ROS, TNF-α, or glutamate. Moreover, extended OGD may impair astrocytic metabolic functions, reducing their ability to supply supportive metabolites such as lactate or glutamine to neurons [47,48]. It is also possible that maladaptive processes, such as dysregulated autophagy or senescence-like changes, contribute to a secretory phenotype that fails to promote neuronal survival [49]. Collectively, these findings underscore the importance of ischemia duration in shaping astrocyte–neuron interactions and highlight the need for further mechanistic studies to dissect the specific components of the ACM that mediate neuroprotection versus neurotoxicity. Our results provide a foundation for further investigations into the molecular mechanisms underlying astrocyte-mediated neuroprotection, with the goal of developing targeted therapies for ischemic stroke and other neurodegenerative conditions.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/neuroglia6030027/s1, Figure S1. HIF-1α stabilisation by oxygen–glucose deprivation (OGD) in primary rat cortical astrocytes. Representative Western blots of HIF-1α and corresponding β-actin of cells exposed to 6 or 24 h of OGD. The protein levels were quantified by densitometric analysis using Image J. Values were normalised to β-actin and corresponding Nx control. Figure S2. Autophagic marker proteins Lc3B-II and p62 protein expressions by astrocyte-conditioned media (ACM) treatments in primary rat cortical neurons. Representative Western blots of Lc3B-II and p62 and corresponding β-actin of cells exposed to 6 h or 24 h OGD ACM. The protein levels were quantified by densitometric analysis using Image J. Values were normalised to β-actin and corresponding Nx ACM.

Author Contributions

This project was conceived by R.C. The experiments were conducted by A.S. The manuscript was prepared, reviewed, amended and commented by A.S. and R.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research received funding from the Wellcome Trust (200633/z/16/z) and an Acorn fund, Keele University.

Institutional Review Board Statement

All animal procedures were approved by Keele University’s School of Life Sciences Ethics Committee under Establishment Licence X350251A8, in accordance with the UK Animals (Scientific Procedures) Act (1986).

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknolwdegments

This work was supported by research grants received from the Wellcome Trust and an Acorn fund, Keele University.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Patabendige, A.; Singh, A.; Jenkins, S.; Sen, J.; Chen, R. Astrocyte Activation in Neurovascular Damage and Repair Following Ischaemic Stroke. Int. J. Mol. Sci. 2021, 22, 4280. [Google Scholar] [CrossRef] [PubMed]
  2. O’Shea, T.M.; Ao, Y.; Wang, S.; Fiacco, T.A.; Chen, K.; Zamanian, J.L.; Bonnah, R.A.; Eyo, U.B.; Sofroniew, M.V. Derivation and transcriptional reprogramming of border-forming wound repair astrocytes after spinal cord injury or stroke in mice. Nat. Neurosci. 2024, 27, 1505–1521. [Google Scholar] [CrossRef] [PubMed]
  3. Liu, Z.; Chopp, M. Astrocytes, therapeutic targets for neuroprotection and neurorestoration in ischemic stroke. Prog. Neurobiol. 2016, 144, 103–120. [Google Scholar] [CrossRef] [PubMed]
  4. Li, J.; Gao, K.; Wang, L.; Wang, J.; Qin, M.; Wang, X.; Lian, K.; Li, C.; Gao, S.; Sun, C. Astrocytes: Therapeutic targets for stroke. Neural Regen. Res. 2025, 21, 1074–1088. [Google Scholar] [CrossRef]
  5. Becerra-Calixto, A.; Cardona-Gómez, G.P. The Role of Astrocytes in Neuroprotection after Brain Stroke: Potential in Cell Therapy. Front. Mol. Neurosci. 2017, 10, 88. [Google Scholar] [CrossRef]
  6. Bylicky, M.A.; Mueller, G.P.; Day, R.M. Mechanisms of Endogenous Neuroprotective Effects of Astrocytes in Brain Injury. Oxid. Med. Cell. Longev. 2018, 2018, 6501031. [Google Scholar] [CrossRef]
  7. Vangeison, G.; Carr, D.; Federoff, H.J.; Rempe, D.A. The good, the bad, and the cell type-specific roles of hypoxia inducible factor-1 alpha in neurons and astrocytes. J. Neurosci. 2008, 28, 1988–1993. [Google Scholar] [CrossRef]
  8. Chen, R.L.; Lai, U.H.; Zhu, L.L.; Singh, A.; Ahmed, M.; Forsyth, N.R. Reactive Oxygen Species (ROS) formation in the brain at different oxygen Levels: Role of hypoxia inducible factors. Front. Cell Dev. Biol. 2018, 6, 132. [Google Scholar] [CrossRef]
  9. Hassan, H.; Chen, R.L. Hypoxia in Alzheimer’s disease: Effects of hypoxia inducible factors. Neural Regen. Res. 2021, 16, 310–311. [Google Scholar]
  10. Chen, B.Y.; Wang, X.; Wang, Z.Y.; Wang, Y.Z.; Chen, L.W. GDNF: A key molecule for modulating neurogenesis and neuronal survival in the adult brain. Int. J. Mol. Sci. 2013, 14, 8103–8120. [Google Scholar]
  11. Zhou, Y.; Wang, Y.; Wang, J.; Anne Stetler, R.; Yang, Q.W. The roles of glial cells in ischemic stroke. Front. Cell. Neurosci. 2019, 13, 242. [Google Scholar]
  12. Li, X.; Zhang, L.; Guo, X.; Xu, J.; Zhang, Q.; Liu, Y.; Wang, Q.; Zhao, J. Astrocytes protect human brain microvascular endothelial cells from hypoxia injury by regulating VEGF expression. J. Cereb. Blood Flow Metab. 2024, 44, 254–266. [Google Scholar] [CrossRef] [PubMed]
  13. Lee, M.H.; Lee, S.H. Regulation of neurotrophic factors by HIFs and their role in neurogenesis under hypoxia. Front. Neurosci. 2018, 12, 706. [Google Scholar]
  14. Hollingworth, B.Y.A.; Pallier, P.N.; Jenkins, S.I.; Chen, R. Hypoxic Neuroinflammation in the Pathogenesis of Multiple Sclerosis. Brain Sci. 2025, 15, 248. [Google Scholar] [CrossRef]
  15. Dhandapani, K.M.; Hadman, M.; De Sevilla, L.; Wade, M.F.; Mahesh, V.B.; Brann, D.W. Astrocyte protection of neurons: Role of transforming growth factor-beta signaling via a c-Jun-AP-1 protective pathway. J. Biol. Chem. 2003, 278, 43329–43339. [Google Scholar] [CrossRef]
  16. Lu, X.; Al-Aref, R.; Zhao, D.; Shen, J.; Yan, Y.; Gao, Y. Astrocyte-conditioned medium attenuates glutamate-induced apoptotic cell death in primary cultured spinal cord neurons of rats. Neurol. Res. 2015, 37, 803–808. [Google Scholar] [CrossRef]
  17. Song, C.; Wu, Y.; Yang, Z.; Kalueff, A.; Tsao, Y.; Dong, Y.; Su, K. Astrocyte-Conditioned Medium Protects Prefrontal Cortical Neurons from Glutamate-Induced Cell Death by Inhibiting TNF-α Expression. Neuroimmunomodulation 2019, 26, 33–42. [Google Scholar] [CrossRef]
  18. Singh, A.; Wilson, J.W.; Schofield, C.J.; Chen, R.L. Hypoxia-inducible factor (HIF) prolyl hydroxylase inhibitors induce autophagy and have a protective effect in an in-vitro ischaemia model. Sci. Rep. 2020, 10, 1597. [Google Scholar] [CrossRef]
  19. Paquet, M.; Ribeiro, F.M.; Guadagno, J.; Esseltine, J.L.; Ferguson, S.S.G.; Cregan, S.P. Role of metabotropic glutamate receptor 5 signaling and homer in oxygen glucose deprivation-mediated astrocyte apoptosis. Mol. Brain 2013, 6, 9–21. [Google Scholar] [CrossRef]
  20. Singh, A.; Chow, O.; Jenkins, S.J.; Zhu, L.L.; Rose, E.; Astbury, K.; Chen, R.L. Characterizing ischaemic tolerance in PC 12 Cells and primary rat neurons. Neuroscience 2021, 453, 17–31. [Google Scholar] [CrossRef]
  21. Li, L.; Zhang, J. Astrocytes in ischemic stroke: Physiological and pathophysiological responses and therapeutic implications. Neurochem. Int. 2016, 107, 37–49. [Google Scholar]
  22. Bakleh, M.Z.; Al Haj Zen, A. The Distinct Role of HIF-1α and HIF-2α in Hypoxia and Angiogenesis. Cells 2025, 14, 673. [Google Scholar] [CrossRef]
  23. Ruscher, K.; Wieloch, T. The involvement of hypoxia-inducible factor-1α (HIF-1α) in the inflammatory response following ischemic stroke. Acta Physiol. 2015, 213, 722–729. [Google Scholar]
  24. Rankin, E.B.; Giaccia, A.J. The duration of oxygen and glucose deprivation (OGD) determines astrocyte fate: BNIP3 is significantly upregulated only by prolonged (24 h) OGD (~32-fold), triggering astrocyte apoptosis. PLoS ONE 2023, 18, e10138834. [Google Scholar]
  25. Bernaudin, M.; Bellail, A.; Marti, H.H.; Yvon, A.; Vivien, D.; Duchatelle, I.; Mackenzie, E.T.; Petit, E. Neurons and astrocytes express hypoxia-inducible factor-1α (HIF-1α) and vascular endothelial growth factor (VEGF) in response to hypoxia: Effect of exogenous VEGF on ischemic brain injury. J. Cereb. Blood Flow Metab. 2002, 22, 393–403. [Google Scholar] [CrossRef] [PubMed]
  26. Dang, J.; Liu, C.; Cheng, X.; Zhang, X.; Li, Y.; Xiao, Q.; Wang, Y.; Zhang, J. Astrocytes are a major source of erythropoietin (EPO) in the ischemic brain, and astrocyte-derived EPO reduces neuronal apoptosis. Front. Cell. Neurosci. 2021, 15, 755955. [Google Scholar]
  27. Dabertrand, F.; Armand, A.S.; Knoepfel, A.K.; Morel, S.; Kubis, N.; Gauthier, V.; Besse, A.; Tissier, F.; Aussedat, A.; Frei, R.; et al. Effects of oxygen–glucose deprivation and reperfusion on barrier properties of a co-culture blood–brain barrier model. PLoS ONE 2019, 14, e0209610. [Google Scholar]
  28. Qiu, J.; Zhang, C.; Lv, Y.; Zhang, Y.; Zhu, C.; Wang, X.; Yao, W. Cdh1 inhibits reactive astrocyte proliferation after oxygen-glucose deprivation and reperfusion. Neurochem. Int. 2013, 63, 87–92. [Google Scholar] [CrossRef]
  29. Zhang, J.; Zhang, Y.; Sun, W.; Ren, H. Hypoxia-inducible factor-1α (HIF-1α) promotes lactate production and astrocyte survival under hypoxia by regulating LDHA expression. J. Mol. Neurosci. 2017, 63, 351–359. [Google Scholar]
  30. Samy, Z.A.; Al-Abdullah, L.; Turcani, M.; Craik, J.; Redzic, Z. Rat astrocytes during anoxia: Secretome profile of cytokines and chemokines. Brain Behav. 2018, 8, 13–27. [Google Scholar] [CrossRef]
  31. Hao, H.; Hou, Y.; Li, A.; Niu, L.; Li, S.; He, B.; Zhang, X.; Song, H.; Cai, R.; Zhou, Y.; et al. Astrocytic HIF-1α drives production of macrophage migration inhibitory factor (MIF) after spinal cord injury. CNS Neurosci. Ther. 2023, 29, 84–95. [Google Scholar] [CrossRef]
  32. Gougeon, P.; Lourenssen, S.; Han, T.Y.; Nair, D.G.; Ropeleski, M.J.; Blennerhassett, M.G. The pro-inflammatory cytokines IL-1β and TNFα are neurotrophic for enteric neurons. J. Neurosci. 2013, 33, 3339–3351. [Google Scholar] [CrossRef] [PubMed]
  33. Lau, L.T.; Yu, A.C. Astrocytes Produce and Release Interleukin-1, Interleukin-6, Tumor Necrosis Factor Alpha and Interferon-Gamma Following Traumatic and Metabolic Injury. J. Neurotrauma 2001, 18, 351–359. [Google Scholar] [CrossRef] [PubMed]
  34. Fontaine, R.H.; Massillon, L.; Margaill, I.; Garnier, P.; Kadota, S.; Gressens, P.; Baud, O. Tumor necrosis factor-α and ischemic injury: Mechanisms of protection and injury. Neurochem. Res. 2002, 27, 653–663. [Google Scholar]
  35. Diniz, L.P.; Tortelli, V.; Matias, I.; Morgado, J.; Bérgamo de Queiroz, S.; Melo, H.M.; Seixas da Silva, G.S.; Alves-Leon, S.V.; de Souza, J.M.; De Felice, F.G.; et al. Astrocyte-induced synaptogenesis is mediated by transforming growth factor β signaling through modulation of D-serine levels in cerebral cortex neurons. J. Biol. Chem. 2014, 289, 6834–6845. [Google Scholar] [CrossRef]
  36. Hur, Y.; Levison, S.W. Neuroprotective effects of delayed TGF-β1 receptor antagonist administration on perinatal hypoxic-ischemic brain injury. Dev. Neurosci. 2023, 46, 188–198. [Google Scholar]
  37. Li, C.; Cheng, Y.; Liu, C.; Xu, J.; Zheng, Z. TGF-β1 confers protection against mechanical injury-induced autophagy and apoptosis in cortical neurons. Front. Cell. Neurosci. 2024, 18, 1381279. [Google Scholar] [CrossRef]
  38. Alqawlaq, S.; Livine-Bar, I.; Chan, D.; Sivak, J.M. Retinal astrocytes protect neurons against metabolic stress by inducing the PI3K pathway. Invest. Ophthalmol. Vis. Sci. 2016, 57, 4213–4230. [Google Scholar]
  39. Li, Y.N.; Fang, Y.; Zhu, G.L.; Wang, X.T.; Huang, F.L.; Li, X. Astrocyte-conditioned medium containing VEGF increases autophagy marker LC3-II in primary neurons after oxygen–glucose deprivation, reducing cell death. J. Neurochem. 2022, 160, 321–334. [Google Scholar]
  40. Zhang, Y.H.; Chen, R.L.; Liu, Y.J.; Xu, X.L.; Sun, Y.; Li, Z.P. IL-10 and TGF-β from activated astrocytes cooperate to enhance autophagic clearance of damaged mitochondria in neurons, protecting against ischemic apoptosis. Neurosci. Lett. 2023, 789, 136–942. [Google Scholar]
  41. Kim, K.; Shin, D.; Kim, J.; Shin, Y.; Rajanikant, G.K.; Majid, A.; Baek, S.; Bae, O. Role of Autophagy in Endothelial Damage and Blood-Brain Barrier Disruption in Ischemic Stroke. Stroke 2018, 49, 1571–1579. [Google Scholar] [CrossRef] [PubMed]
  42. Yang, J.; Zhang, X.; Chen, X.; Wang, L.; Yang, G. Exosome Mediated Delivery of miR-124 Promotes Neurogenesis after Ischemia. Mol. Ther. Nucleic Acids 2017, 7, 278–287. [Google Scholar] [CrossRef] [PubMed]
  43. Xu, L.; Cao, H.; Xie, Y.; Zhang, Y.; Du, M.; Xu, X.; Ye, R.; Liu, X. Exosome-shuttled miR-92b-3p from ischemic preconditioned astrocytes protects neurons against oxygen and glucose deprivation. Brain Res. 2019, 1717, 66–73. [Google Scholar] [CrossRef] [PubMed]
  44. Zhang, W.; Liang, C.; Guo, S.; Huang, Y.; Liang, G. Therapeutic potential of astrocyte-derived extracellular vesicles in ischemic stroke: Mechanisms and future prospects. Aging Dis. 2024, 15, 1227–1254. [Google Scholar]
  45. Díaz-Guerra, M.; Velasco, A.; Avila, J.; Hernández, F. Inflammatory response in preconditioning: A new approach to a classical mechanism. Int. J. Mol. Sci. 2020, 21, 556. [Google Scholar]
  46. Lee, H.; Yoon, Y.; Lee, M. Neuroprotective role of astrocyte-derived exosomes in oxygen-glucose deprivation-induced neuronal injury. Biochem. Biophys. Res. Commun. 2022, 606, 110–117. [Google Scholar]
  47. Liddelow, S.A.; Guttenplan, K.A.; Clarke, L.E.; Bennett, F.C.; Bohlen, C.J.; Schirmer, L.; Bennett, M.L.; Münch, A.E.; Chung, W.S.; Peterson, T.C.; et al. Neurotoxic reactive astrocytes are induced by activated microglia. Nature 2017, 541, 481–487. [Google Scholar] [CrossRef]
  48. Jha, M.K.; Morrison, B.M. Lactate transporters mediate glia-neuron metabolic crosstalk in homeostasis and disease. Front. Cell. Neurosci. 2020, 14, 589582. [Google Scholar] [CrossRef]
  49. Wu, Q.; Zhang, X.; Shao, M.; Zhang, C.; Sun, Y.; Liu, J.; Wang, Q.; Huang, Y.; Wang, T. Dysfunctional autophagy in astrocytes contributes to chronic stress-induced cognitive impairments. Cell Death Dis. 2021, 12, 760. [Google Scholar]
Neuroglia 06 00027 g001
Figure 1. Fluorescence micrograph of typical healthy pure primary rat cortical astrocytes. Representative double merged [FITC labelled GFAP immunostaining (green) and DAPI stained nuclei] of healthy primary astrocytes. A typical culture consisted of 94.12% ± 6.55% of GFAP+ nuclei.
Figure 1. Fluorescence micrograph of typical healthy pure primary rat cortical astrocytes. Representative double merged [FITC labelled GFAP immunostaining (green) and DAPI stained nuclei] of healthy primary astrocytes. A typical culture consisted of 94.12% ± 6.55% of GFAP+ nuclei.
Neuroglia 06 00027 g001
Neuroglia 06 00027 g002
Figure 2. Fluorescence micrographs of primary cortical astrocytes subjected to oxygen and glucose deprivation at 6 h, 24 h and 48 h compared to those in normoxia. (A) Representative merged immunofluorescence images showing primary astrocytes stained for GFAP (green, FITC) and nuclei counterstained with DAPI (blue) under normoxic (Nx) conditions and following 6 h, 24 h, and 48 h of oxygen–glucose deprivation (OGD). GFAP-positive astrocytes display extended processes, with morphology varying across time points. While GFAP is a cytoplasmic marker, colocalisation with DAPI confirms the presence of astrocytic nuclei. (B) Bar graph representing average GFAP intensity normalised to control (Nx). The GFAP intensity of five nuclei was obtained from each microscopic field. Compared to Nx (same time point), results revealed increased GFAP intensity at 24 h and 48 h OGD. (C) Bar graph representing GFAP+ nuclei/microscopic field (cell densities). Compared to Nx (same time point), results revealed a significant reduction in cell densities in 24 h and 48 h OGD. * represents p < 0.05 and ** represents p < 0.01 against Nx (same time point).
Figure 2. Fluorescence micrographs of primary cortical astrocytes subjected to oxygen and glucose deprivation at 6 h, 24 h and 48 h compared to those in normoxia. (A) Representative merged immunofluorescence images showing primary astrocytes stained for GFAP (green, FITC) and nuclei counterstained with DAPI (blue) under normoxic (Nx) conditions and following 6 h, 24 h, and 48 h of oxygen–glucose deprivation (OGD). GFAP-positive astrocytes display extended processes, with morphology varying across time points. While GFAP is a cytoplasmic marker, colocalisation with DAPI confirms the presence of astrocytic nuclei. (B) Bar graph representing average GFAP intensity normalised to control (Nx). The GFAP intensity of five nuclei was obtained from each microscopic field. Compared to Nx (same time point), results revealed increased GFAP intensity at 24 h and 48 h OGD. (C) Bar graph representing GFAP+ nuclei/microscopic field (cell densities). Compared to Nx (same time point), results revealed a significant reduction in cell densities in 24 h and 48 h OGD. * represents p < 0.05 and ** represents p < 0.01 against Nx (same time point).
Neuroglia 06 00027 g002
Neuroglia 06 00027 g003
Figure 3. Responses of primary rat astrocytes to oxygen–glucose deprivation (OGD) for 6 h, 24 h and 48 h. (A) MTT assays revealed a significant reduction in mitochondrial activity by 24 h and 48 h OGD, but no significant change by 6 h OGD compared to normoxia (Nx) controls. (B) LDH assays revealed a significant increase in LDH release at 24 and 48 h OGD, but no significant change by 6 h OGD compared to Nx controls. ** represents p < 0.01 against Nx.
Figure 3. Responses of primary rat astrocytes to oxygen–glucose deprivation (OGD) for 6 h, 24 h and 48 h. (A) MTT assays revealed a significant reduction in mitochondrial activity by 24 h and 48 h OGD, but no significant change by 6 h OGD compared to normoxia (Nx) controls. (B) LDH assays revealed a significant increase in LDH release at 24 and 48 h OGD, but no significant change by 6 h OGD compared to Nx controls. ** represents p < 0.01 against Nx.
Neuroglia 06 00027 g003
Neuroglia 06 00027 g004
Figure 4. HIF-1α stabilisation in primary rat cortical astrocytes subject to oxygen–glucose deprivation for 6 h and 24 h. (A) Representative HIF-1α immunoblots were shown with those for β-actin of primary astrocytes treated with 6 h and 24 h oxygen–glucose deprivation (OGD), oxygen deprivation (OD) and normoxia (Nx) controls. (B) Bar graph representing the normalised HIF-1α expression. HIF1α was significantly upregulated by 6 h and 24 h OGD (versus Nx at the same time point). ** represents p < 0.01.
Figure 4. HIF-1α stabilisation in primary rat cortical astrocytes subject to oxygen–glucose deprivation for 6 h and 24 h. (A) Representative HIF-1α immunoblots were shown with those for β-actin of primary astrocytes treated with 6 h and 24 h oxygen–glucose deprivation (OGD), oxygen deprivation (OD) and normoxia (Nx) controls. (B) Bar graph representing the normalised HIF-1α expression. HIF1α was significantly upregulated by 6 h and 24 h OGD (versus Nx at the same time point). ** represents p < 0.01.
Neuroglia 06 00027 g004
Neuroglia 06 00027 g005
Figure 5. Hypoxic gene expression in response to oxygen–glucose deprivation in primary rat astrocytes. Bar graphs representing normalised gene expression in primary rat astrocytes in response to oxygen–glucose deprivation (OGD) for 6 h or 24 h. Compared to Nx (same time point), expression of Hif-1α, Hif-2α, and Pfkfb3 was not altered by OGD for 6 h and 24 h, while Phd2, Vegf, Glut1, and Pfkfb3 were significantly upregulated in response to 6 h and 24 h OGD compared to Nx (same time point). Epo and Bnip3 were upregulated by 24 h OGD but not 6 h OGD, however Ldha was upregulated by 6 h OGD but not 24 h OGD compared to Nx (same time point). The gene expression was measured against the housekeeping gene β-actin and normalised to Nx. ** represents p < 0.01 compared to Nx controls, while # represents p < 0.05 for gene expression at 6 h vs. at 24 h.
Figure 5. Hypoxic gene expression in response to oxygen–glucose deprivation in primary rat astrocytes. Bar graphs representing normalised gene expression in primary rat astrocytes in response to oxygen–glucose deprivation (OGD) for 6 h or 24 h. Compared to Nx (same time point), expression of Hif-1α, Hif-2α, and Pfkfb3 was not altered by OGD for 6 h and 24 h, while Phd2, Vegf, Glut1, and Pfkfb3 were significantly upregulated in response to 6 h and 24 h OGD compared to Nx (same time point). Epo and Bnip3 were upregulated by 24 h OGD but not 6 h OGD, however Ldha was upregulated by 6 h OGD but not 24 h OGD compared to Nx (same time point). The gene expression was measured against the housekeeping gene β-actin and normalised to Nx. ** represents p < 0.01 compared to Nx controls, while # represents p < 0.05 for gene expression at 6 h vs. at 24 h.
Neuroglia 06 00027 g005
Neuroglia 06 00027 g006
Figure 6. Fluorescence micrographs of primary rat neurons preconditioned with astrocyte-conditioned media followed by 6 h oxygen–glucose deprivation and 24 h reperfusion. Representative merged immunofluorescence micrographs of neuronal cultures stained with MAP2 (green, FITC) to label dendrites and DAPI (blue) to label nuclei. Neurons were preconditioned with either complete media (sham) or whole astrocyte-conditioned media (ACM). The ACM was derived from primary rat astrocyte cultures subjected to normoxic (Nx), 6 h, or 24 h oxygen–glucose deprivation (OGD). Untreated control neurons maintained in complete media under normoxia exhibited robust MAP2 expression with extensive dendritic arborisation. Images illustrate differences in neuronal morphology following exposure to ACM generated under varying astrocytic stress conditions. For 24 h OGD-ACM (whole) preconditioned cultures, the subsequent 6 h OGD and 24 h reperfusion resulted in degradation of dendrites. The 6 h OGD-ACM (whole) preconditioned cultures protected the neurons from the OGD and reperfusion treatments, and consisted of healthier neurons, similar to untreated control.
Figure 6. Fluorescence micrographs of primary rat neurons preconditioned with astrocyte-conditioned media followed by 6 h oxygen–glucose deprivation and 24 h reperfusion. Representative merged immunofluorescence micrographs of neuronal cultures stained with MAP2 (green, FITC) to label dendrites and DAPI (blue) to label nuclei. Neurons were preconditioned with either complete media (sham) or whole astrocyte-conditioned media (ACM). The ACM was derived from primary rat astrocyte cultures subjected to normoxic (Nx), 6 h, or 24 h oxygen–glucose deprivation (OGD). Untreated control neurons maintained in complete media under normoxia exhibited robust MAP2 expression with extensive dendritic arborisation. Images illustrate differences in neuronal morphology following exposure to ACM generated under varying astrocytic stress conditions. For 24 h OGD-ACM (whole) preconditioned cultures, the subsequent 6 h OGD and 24 h reperfusion resulted in degradation of dendrites. The 6 h OGD-ACM (whole) preconditioned cultures protected the neurons from the OGD and reperfusion treatments, and consisted of healthier neurons, similar to untreated control.
Neuroglia 06 00027 g006
Neuroglia 06 00027 g007
Figure 7. Effect of preconditioning with primary rat astrocyte-conditioned media on primary rat neurons subject to 6 h oxygen–glucose deprivation followed by 24 h reperfusion. Primary neurons were preconditioned with complete media (sham) or whole astrocyte-conditioned media (ACM) which was obtained from primary rat astrocyte cultures subjected to normoxia (Nx), 6 h or 24 h oxygen–glucose deprivation (OGD) treatments. Untreated control was maintained in normoxia throughout. (A) Bar graph representing MTT assay results. For all preconditioning treatments, 6 h OGD and 24 h reperfusion resulted in significantly reduced mitochondrial activity compared to untreated control. The reductions in mitochondrial activity were significantly lower in 6 h OGD-ACM preconditioned cells compared to sham-preconditioning. (B) Bar graph representing LDH assay results. For all preconditioning treatments, 6 h OGD and 24 h reperfusion resulted in significantly increased LDH release compared to untreated control, with the sole exception of 6 h OGD-ACM (whole) preconditioned cells. The increase in LDH release was significantly lower in 6 h OGD-ACM (whole) preconditioned cells compared to sham-preconditioning. ** represents p < 0.01 against sham-preconditioning.
Figure 7. Effect of preconditioning with primary rat astrocyte-conditioned media on primary rat neurons subject to 6 h oxygen–glucose deprivation followed by 24 h reperfusion. Primary neurons were preconditioned with complete media (sham) or whole astrocyte-conditioned media (ACM) which was obtained from primary rat astrocyte cultures subjected to normoxia (Nx), 6 h or 24 h oxygen–glucose deprivation (OGD) treatments. Untreated control was maintained in normoxia throughout. (A) Bar graph representing MTT assay results. For all preconditioning treatments, 6 h OGD and 24 h reperfusion resulted in significantly reduced mitochondrial activity compared to untreated control. The reductions in mitochondrial activity were significantly lower in 6 h OGD-ACM preconditioned cells compared to sham-preconditioning. (B) Bar graph representing LDH assay results. For all preconditioning treatments, 6 h OGD and 24 h reperfusion resulted in significantly increased LDH release compared to untreated control, with the sole exception of 6 h OGD-ACM (whole) preconditioned cells. The increase in LDH release was significantly lower in 6 h OGD-ACM (whole) preconditioned cells compared to sham-preconditioning. ** represents p < 0.01 against sham-preconditioning.
Neuroglia 06 00027 g007
Neuroglia 06 00027 g008
Figure 8. Effect of astrocyte-conditioned media on autophagic markers in primary rat neurons. (A) Representative Lc3b and p62 Western blots alongside β-actin of primary neurons treated with untreated control, normoxia (Nx)- astrocyte-conditioned media (ACM), 6 h OGD-ACM, and 24 h OGD-ACM. (B) Compared to untreated control, Lc3b-II was significantly upregulated by 6 h and 24 h OGD-ACM. (C) Bar graph representing normalised p62 expression. Compared to untreated control, p62 was significantly lower in 6 h and 24 h OGD-ACM treated cells. ** represents p < 0.01 against Nx-ACM treatment.
Figure 8. Effect of astrocyte-conditioned media on autophagic markers in primary rat neurons. (A) Representative Lc3b and p62 Western blots alongside β-actin of primary neurons treated with untreated control, normoxia (Nx)- astrocyte-conditioned media (ACM), 6 h OGD-ACM, and 24 h OGD-ACM. (B) Compared to untreated control, Lc3b-II was significantly upregulated by 6 h and 24 h OGD-ACM. (C) Bar graph representing normalised p62 expression. Compared to untreated control, p62 was significantly lower in 6 h and 24 h OGD-ACM treated cells. ** represents p < 0.01 against Nx-ACM treatment.
Neuroglia 06 00027 g008
Table 1. List of primers used for qRT-PCR studies and their forward (FW)/reverse (RV) sequences.
Table 1. List of primers used for qRT-PCR studies and their forward (FW)/reverse (RV) sequences.
HIF1αFW TCAAGTCAGCAACGTGGAAG
RV TATCGAGGCTGTGTCGACTG
Glut1FW GGTGTGCAGCAGCCTGTGTA
RV GACGAAC AGCGACACCACAGT
Bnip3FW TTTAAACACCCGAAGCGCACAG
RV GTTGTCAGACGCCTTCCAATGTAGA
Phd2FW TGCATACGCCACAAGGTACG
RV GTAGGTGACGCGGGTACTGC
VegfFW TTACTGCTGTACCTCCAC
RV ACAGGACGGCTTGAAGATA
Bnip3FW TTTAAACACCCGAAGCGCACAG
RV TTGTCAGACGCCTTCCAATGTAGA
Pfkfb1FW AACCGCAACATGACCTTCCT
RV CAACACAGAGGCCCAGCTTA
Pfkfb3FW CTGTCCAGCAGAGGCAAGAA
RV CGCGGTCTGGATGGTACTTT
Ldh-aFW AAGGTTATGGCTCCCTTGGC
RV TAGTGACGTGTGACAGTGCC
ActinFW TGCCCTAGACTTCGAGCAAGA
RV CATGGATGCCACAGGATTCCATAC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Singh, A.; Chen, R. Astrocyte-Conditioned Medium Induces Protection Against Ischaemic Injury in Primary Rat Neurons. Neuroglia 2025, 6, 27. https://doi.org/10.3390/neuroglia6030027

AMA Style

Singh A, Chen R. Astrocyte-Conditioned Medium Induces Protection Against Ischaemic Injury in Primary Rat Neurons. Neuroglia. 2025; 6(3):27. https://doi.org/10.3390/neuroglia6030027

Chicago/Turabian Style

Singh, Ayesha, and Ruoli Chen. 2025. "Astrocyte-Conditioned Medium Induces Protection Against Ischaemic Injury in Primary Rat Neurons" Neuroglia 6, no. 3: 27. https://doi.org/10.3390/neuroglia6030027

APA Style

Singh, A., & Chen, R. (2025). Astrocyte-Conditioned Medium Induces Protection Against Ischaemic Injury in Primary Rat Neurons. Neuroglia, 6(3), 27. https://doi.org/10.3390/neuroglia6030027

Article Metrics

Back to TopTop