Ezrin and Radixin Differentially Modulate Cell Surface Expression of Programmed Death Ligand-1 in Human Pancreatic Ductal Adenocarcinoma KP-2 Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Transfection of Cells with siRNAs
2.3. RNA Isolation and Real-Time Reverse Transcription (RT)-Polymerase Chain Reaction (PCR)
2.4. Confocal Laser Scanning Microscopy (CLSM) Analysis
2.5. Flow Cytometry Analysis
2.6. Protein Isolation
2.7. Western Blotting
2.8. Immunoprecipitation Assay
2.9. Statistical Analysis
3. Results
3.1. Gene and Protein Expression Pattern of PD-L1 and ERM in KP-2 Cells
3.2. Plasma Membrane Localization of PD-L1 and ERM in KP-2 Cells
3.3. Molecular Inteaction between PD-L1 and Ezrin and Radixin in KP-2 Cells
3.4. Effects of siRNAs for Ezrin and Radixin on the mRNA and Cell Surface Expression Levels of PD-L1 in KP-2 Cells
3.5. Gene Correlation Analysis of PD-L1 with Ezrin and Radixin in Human Pancreatic Ductal Adenocarcinoma Tissue
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, S.K.; Oh, C.M.; Kim, M.H.; Ha, E.; Choi, Y.S.; Ryoo, J.H. Metabolic syndrome, metabolic components, and their relation to the risk of pancreatic cancer. Cancer 2020, 126, 1979–1986. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nattress, C.B.; Hallden, G. Advances in oncolytic adenovirus therapy for pancreatic cancer. Cancer Lett. 2018, 434, 56–69. [Google Scholar] [CrossRef] [Scilit]
- McGuigan, A.; Kelly, P.; Turkington, R.C.; Jones, C.; Coleman, H.G.; McCain, R.S. Pancreatic cancer: A review of clinical diagnosis, epidemiology, treatment and outcomes. World J. Gastroenterol. 2018, 24, 4846–4861. [Google Scholar] [CrossRef] [Scilit]
- Ettrich, T.J.; Seufferlein, T. Systemic Therapy for Metastatic Pancreatic Cancer. Curr. Treat. Options Oncol. 2021, 22, 106. [Google Scholar] [CrossRef] [Scilit]
- Kibe, S.; Ohuchida, K.; Ando, Y.; Takesue, S.; Nakayama, H.; Abe, T.; Endo, S.; Koikawa, K.; Okumura, T.; Iwamoto, C.; et al. Cancer-associated acinar-to-ductal metaplasia within the invasive front of pancreatic cancer contributes to local invasion. Cancer Lett. 2019, 444, 70–81. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Zhu, Y.; Chen, J.; Yang, Y.; Zhu, L.; Zhao, J.; Yang, Y.; Cai, X.; Hu, C.; Rosell, R.; et al. Identification of a novel PAK1 inhibitor to treat pancreatic cancer. Acta Pharm. Sin. B 2020, 10, 603–614. [Google Scholar] [CrossRef] [Scilit]
- Yi, M.; Niu, M.; Xu, L.; Luo, S.; Wu, K. Regulation of PD-L1 expression in the tumor microenvironment. J. Hematol. Oncol. 2021, 14, 10. [Google Scholar] [CrossRef] [Scilit]
- Tu, X.; Qin, B.; Zhang, Y.; Zhang, C.; Kahila, M.; Nowsheen, S.; Yin, P.; Yuan, J.; Pei, H.; Li, H.; et al. PD-L1 (B7-H1) Competes with the RNA Exosome to Regulate the DNA Damage Response and Can Be Targeted to Sensitize to Radiation or Chemotherapy. Mol. Cell 2019, 74, 1215–1226. [Google Scholar] [CrossRef] [Scilit]
- Rossi, J.F.; Ceballos, P.; Lu, Z.Y. Immune precision medicine for cancer: A novel insight based on the efficiency of immune effector cells. Cancer Commun. 2019, 39, 34. [Google Scholar] [CrossRef] [Scilit]
- Qin, W.; Hu, L.; Zhang, X.; Jiang, S.; Li, J.; Zhang, Z.; Wang, X. The Diverse Function of PD-1/PD-L Pathway Beyond Cancer. Front. Immunol. 2019, 10, 2298. [Google Scholar] [CrossRef] [Scilit]
- Robert, C. A decade of immune-checkpoint inhibitors in cancer therapy. Nat. Commun. 2020, 11, 3801. [Google Scholar] [CrossRef] [Scilit]
- Feng, M.; Xiong, G.; Cao, Z.; Yang, G.; Zheng, S.; Song, X.; You, L.; Zheng, L.; Zhang, T.; Zhao, Y. PD-1/PD-L1 and immunotherapy for pancreatic cancer. Cancer Lett. 2017, 407, 57–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Foley, K.; Kim, V.; Jaffee, E.; Zheng, L. Current progress in immunotherapy for pancreatic cancer. Cancer Lett. 2016, 381, 244–251. [Google Scholar] [CrossRef] [Scilit]
- Jain, T.; Dudeja, V. The war against pancreatic cancer in 2020—Advances on all fronts. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 99–100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cha, J.H.; Chan, L.C.; Li, C.W.; Hsu, J.L.; Hung, M.C. Mechanisms Controlling PD-L1 Expression in Cancer. Mol. Cell 2019, 76, 359–370. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.N.; Lee, H.H.; Hsu, J.L.; Yu, D.; Hung, M.C. The impact of PD-L1 N-linked glycosylation on cancer therapy and clinical diagnosis. J. Biomed. Sci. 2020, 27, 77. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, S.M.; Zhou, J.; Wang, Y.; Nie, R.C.; Chen, J.W.; Xie, D. Recent Findings in the Posttranslational Modifications of PD-L1. J. Oncol. 2020, 2020, 5497015. [Google Scholar] [CrossRef] [Scilit]
- Mezzadra, R.; Sun, C.; Jae, L.T.; Gomez-Eerland, R.; de Vries, E.; Wu, W.; Logtenberg, M.E.W.; Slagter, M.; Rozeman, E.A.; Hofland, I.; et al. Identification of CMTM6 and CMTM4 as PD-L1 protein regulators. Nature 2017, 549, 106–110. [Google Scholar] [CrossRef] [Scilit]
- Burr, M.L.; Sparbier, C.E.; Chan, Y.C.; Williamson, J.C.; Woods, K.; Beavis, P.A.; Lam, E.Y.N.; Henderson, M.A.; Bell, C.C.; Stolzenburg, S.; et al. CMTM6 maintains the expression of PD-L1 and regulates anti-tumour immunity. Nature 2017, 549, 101–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ogihara, T.; Mizoi, K.; Kamioka, H.; Yano, K. Physiological Roles of ERM Proteins and Transcriptional Regulators in Supporting Membrane Expression of Efflux Transporters as Factors of Drug Resistance in Cancer. Cancers 2020, 12, 3352. [Google Scholar] [CrossRef] [Scilit]
- Kobori, T.; Harada, S.; Nakamoto, K.; Tokuyama, S. Mechanisms of P-glycoprotein alteration during anticancer treatment: Role in the pharmacokinetic and pharmacological effects of various substrate drugs. J. Pharmacol. Sci. 2014, 125, 242–254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luciani, F.; Molinari, A.; Lozupone, F.; Calcabrini, A.; Lugini, L.; Stringaro, A.; Puddu, P.; Arancia, G.; Cianfriglia, M.; Fais, S. P-glycoprotein-actin association through ERM family proteins: A role in P-glycoprotein function in human cells of lymphoid origin. Blood 2002, 99, 641–648. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kawaguchi, K.; Yoshida, S.; Hatano, R.; Asano, S. Pathophysiological Roles of Ezrin/Radixin/Moesin Proteins. Biol. Pharm. Bull. 2017, 40, 381–390. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Asp, N.; Kvalvaag, A.; Sandvig, K.; Pust, S. Regulation of ErbB2 localization and function in breast cancer cells by ERM proteins. Oncotarget 2016, 7, 25443–25460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rudnicka, D.; Oszmiana, A.; Finch, D.K.; Strickland, I.; Schofield, D.J.; Lowe, D.C.; Sleeman, M.A.; Davis, D.M. Rituximab causes a polarization of B cells that augments its therapeutic function in NK-cell-mediated antibody-dependent cellular cytotoxicity. Blood 2013, 121, 4694–4702. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clucas, J.; Valderrama, F. ERM proteins in cancer progression. J. Cell Sci. 2014, 127, 267–275. [Google Scholar] [CrossRef] [Scilit]
- Faure, C.; Djerbi-Bouillie, R.; Domingot, A.; Bouzinba-Segard, H.; Taouji, S.; Saidi, Y.; Bernard, S.; Carallis, F.; Rothe-Walther, R.; Lenormand, J.L.; et al. Allosteric Inhibition of HER2 by Moesin-Mimicking Compounds Targets HER2-Positive Cancers and Brain Metastases. Cancer Res. 2021, 81, 5464–5476. [Google Scholar] [CrossRef] [Scilit]
- Tameishi, M.; Kobori, T.; Tanaka, C.; Urashima, Y.; Ito, T.; Obata, T. Contribution of Ezrin on the Cell Surface Plasma Membrane Localization of Programmed Cell Death Ligand-1 in Human Choriocarcinoma JEG-3 Cells. Pharmaceuticals 2021, 14, 963. [Google Scholar] [CrossRef] [Scilit]
- Tanaka, C.; Kobori, T.; Tameishi, M.; Urashima, Y.; Ito, T.; Obata, T. Ezrin Modulates the Cell Surface Expression of Programmed Cell Death Ligand-1 in Human Cervical Adenocarcinoma Cells. Molecules 2021, 26, 5648. [Google Scholar] [CrossRef] [Scilit]
- Kobori, T.; Tanaka, C.; Tameishi, M.; Urashima, Y.; Ito, T.; Obata, T. Role of Ezrin/Radixin/Moesin in the Surface Localization of Programmed Cell Death Ligand-1 in Human Colon Adenocarcinoma LS180 Cells. Pharmaceuticals 2021, 14, 864. [Google Scholar] [CrossRef] [Scilit]
- Barretina, J.; Caponigro, G.; Stransky, N.; Venkatesan, K.; Margolin, A.A.; Kim, S.; Wilson, C.J.; Lehar, J.; Kryukov, G.V.; Sonkin, D.; et al. The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity. Nature 2012, 483, 603–607. [Google Scholar] [CrossRef] [Scilit]
- Meyers, R.M.; Bryan, J.G.; McFarland, J.M.; Weir, B.A.; Sizemore, A.E.; Xu, H.; Dharia, N.V.; Montgomery, P.G.; Cowley, G.S.; Pantel, S.; et al. Computational correction of copy number effect improves specificity of CRISPR-Cas9 essentiality screens in cancer cells. Nat. Genet. 2017, 49, 1779–1784. [Google Scholar] [CrossRef] [Scilit]
- Tsherniak, A.; Vazquez, F.; Montgomery, P.G.; Weir, B.A.; Kryukov, G.; Cowley, G.S.; Gill, S.; Harrington, W.F.; Pantel, S.; Krill-Burger, J.M.; et al. Defining a Cancer Dependency Map. Cell 2017, 170, 564–576.e516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferreira, E.R.; Bonfim-Melo, A.; Cordero, E.M.; Mortara, R.A. ERM Proteins Play Distinct Roles in Cell Invasion by Extracellular Amastigotes of Trypanosoma cruzi. Front. Microbiol. 2017, 8, 2230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zaman, R.; Lombardo, A.; Sauvanet, C.; Viswanatha, R.; Awad, V.; Bonomo, L.E.; McDermitt, D.; Bretscher, A. Effector-mediated ERM activation locally inhibits RhoA activity to shape the apical cell domain. J. Cell Biol. 2021, 220, e202007146. [Google Scholar] [CrossRef] [Scilit]
- Piao, J.; Liu, S.; Xu, Y.; Wang, C.; Lin, Z.; Qin, Y.; Liu, S. Ezrin protein overexpression predicts the poor prognosis of pancreatic ductal adenocarcinomas. Exp. Mol. Pathol. 2015, 98, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Xu, J.; Zhang, W. EZR promotes pancreatic cancer proliferation and metastasis by activating FAK/AKT signaling pathway. Cancer Cell Int. 2021, 21, 521. [Google Scholar] [CrossRef] [Scilit]
- Abiatari, I.; Esposito, I.; Oliveira, T.D.; Felix, K.; Xin, H.; Penzel, R.; Giese, T.; Friess, H.; Kleeff, J. Moesin-dependent cytoskeleton remodelling is associated with an anaplastic phenotype of pancreatic cancer. J. Cell. Mol. Med. 2010, 14, 1166–1179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, S.D.; Song, M.M.; Zhong, Z.Q.; Li, N.; Wang, P.L.; Cheng, S.; Bai, R.X.; Yuan, H.S. Knockdown of radixin by RNA interference suppresses the growth of human pancreatic cancer cells in vitro and in vivo. Asian Pac. J. Cancer Prev. 2012, 13, 753–759. [Google Scholar] [CrossRef] [Scilit]
- Cancer Genome Atlas Network. Comprehensive molecular characterization of human colon and rectal cancer. Nature 2012, 487, 330–337. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chandrashekar, D.S.; Bashel, B.; Balasubramanya, S.A.H.; Creighton, C.J.; Ponce-Rodriguez, I.; Chakravarthi, B.; Varambally, S. UALCAN: A Portal for Facilitating Tumor Subgroup Gene Expression and Survival Analyses. Neoplasia 2017, 19, 649–658. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ashizawa, T.; Iizuka, A.; Maeda, C.; Tanaka, E.; Kondou, R.; Miyata, H.; Sugino, T.; Kawata, T.; Deguchi, S.; Mitsuya, K.; et al. Impact of combination therapy with anti-PD-1 blockade and a STAT3 inhibitor on the tumor-infiltrating lymphocyte status. Immunol. Lett. 2019, 216, 43–50. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; Li, X.; Zhang, L.; Chen, Y.; Dong, R.; Zhang, J.; Zhao, J.; Guo, X.; Yang, G.; Li, Y.; et al. miR-194-5p down-regulates tumor cell PD-L1 expression and promotes anti-tumor immunity in pancreatic cancer. Int. Immunopharmacol. 2021, 97, 107822. [Google Scholar] [CrossRef] [Scilit]
- Yin, H.; Pu, N.; Chen, Q.; Zhang, J.; Zhao, G.; Xu, X.; Wang, D.; Kuang, T.; Jin, D.; Lou, W.; et al. Gut-derived lipopolysaccharide remodels tumoral microenvironment and synergizes with PD-L1 checkpoint blockade via TLR4/MyD88/AKT/NF-kappaB pathway in pancreatic cancer. Cell Death Dis. 2021, 12, 1033. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, X.; Lin, Z.; Wang, Z.; Zhou, Q. Emerging role of PD-L1 modification in cancer immunotherapy. Am. J. Cancer Res. 2021, 11, 3832–3840. [Google Scholar]
- Meng, F.; Su, Y.; Xu, B. Rho-associated protein kinase-dependent moesin phosphorylation is required for PD-L1 stabilization in breast cancer. Mol. Oncol. 2020, 14, 2701–2712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kawase, A.; Inoue, Y.; Nakazaki, S.; Koizumi, E.; Iwaki, M. Radixin knockdown improves the accumulation and efficiency of methotrexate in tumor cells. Oncol. Rep. 2019, 42, 283–290. [Google Scholar] [CrossRef] [Scilit]
- Kawase, A.; Sakata, M.; Yada, N.; Nakasaka, M.; Shimizu, T.; Kato, Y.; Iwaki, M. Decreased radixin function for ATP-binding cassette transporters in liver in adjuvant-induced arthritis rats. J. Pharm. Sci. 2014, 103, 4058–4065. [Google Scholar] [CrossRef] [Scilit]
- Kojima, H.; Sakurai, S.; Uemura, M.; Kitamura, K.; Kanno, H.; Nakai, Y.; Fukui, H. Disturbed colocalization of multidrug resistance protein 2 and radixin in human cholestatic liver diseases. J. Gastroenterol. Hepatol. 2008, 23, e120–e128. [Google Scholar] [CrossRef] [Scilit]
- Kojima, H.; Nies, A.T.; Konig, J.; Hagmann, W.; Spring, H.; Uemura, M.; Fukui, H.; Keppler, D. Changes in the expression and localization of hepatocellular transporters and radixin in primary biliary cirrhosis. J. Hepatol. 2003, 39, 693–702. [Google Scholar] [CrossRef] [Scilit]
- Kikuchi, S.; Hata, M.; Fukumoto, K.; Yamane, Y.; Matsui, T.; Tamura, A.; Yonemura, S.; Yamagishi, H.; Keppler, D.; Tsukita, S. Radixin deficiency causes conjugated hyperbilirubinemia with loss of Mrp2 from bile canalicular membranes. Nat. Genet. 2002, 31, 320–325. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kano, T.; Wada, S.; Morimoto, K.; Kato, Y.; Ogihara, T. Effect of knockdown of ezrin, radixin, and moesin on P-glycoprotein function in HepG2 cells. J. Pharm. Sci. 2011, 100, 5308–5314. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chan, L.C.; Li, C.W.; Xia, W.; Hsu, J.M.; Lee, H.H.; Cha, J.H.; Wang, H.L.; Yang, W.H.; Yen, E.Y.; Chang, W.C.; et al. IL-6/JAK1 pathway drives PD-L1 Y112 phosphorylation to promote cancer immune evasion. J. Clin. Investig. 2019, 129, 3324–3338. [Google Scholar] [CrossRef] [Scilit]
- Xu, L.; Chen, X.; Shen, M.; Yang, D.R.; Fang, L.; Weng, G.; Tsai, Y.; Keng, P.C.; Chen, Y.; Lee, S.O. Inhibition of IL-6-JAK/Stat3 signaling in castration-resistant prostate cancer cells enhances the NK cell-mediated cytotoxicity via alteration of PD-L1/NKG2D ligand levels. Mol. Oncol. 2018, 12, 269–286. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghaffari, A.; Hoskin, V.; Szeto, A.; Hum, M.; Liaghati, N.; Nakatsu, K.; LeBrun, D.; Madarnas, Y.; Sengupta, S.; Elliott, B.E. A novel role for ezrin in breast cancer angio/lymphangiogenesis. Breast Cancer Res. 2014, 16, 438. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Gene | Primer Sequence (5′→3′) |
|---|---|
| h-β-Actin (forward) | TGGCACCCAGCACAATGAA |
| h-β-Actin (reverse) | CTAAGTCATAGTCCGCCTAGAAGCA |
| h-PD-L1 (forward) | CAATGTGACCAGCACACTGAGAA |
| h-PD-L1 (reverse) | GGCATAATAAGATGGCTCCCAGAA |
| h-Ezrin (forward) | ACCATGGATGCAGAGCTGGAG |
| h-Ezrin (reverse) | CATAGTGGAGGCCAAAGTACCACA |
| h-Radixin (forward) | GAATTTGCCATTCAGCCCAATA |
| h-Radixin (reverse) | GCCATGTAGAATAACCTTTGCTGTC |
| h-Moesin (forward) | CCGAATCCAAGCCGTGTGTA |
| h-Moesin (reverse) | GGCAAACTCCAGCTCTGCATC |
| h-IFN-ɤ (forward) | CTTTAAAGATGACCAGAGCATCCAA |
| h-IFN-ɤ (reverse) | GGCGACAGTTCAGCCATCAC |
| h-TNF (forward) | ACAACCCTCAGACGCCACAT |
| h-TNF (reverse) | GTGGAGCCGTGGGTCAGTAT |
| h-IL-6 (forward) | AAGCCAGAGCTGTGCAGATGAGTA |
| h-IL-6 (reverse) | TGTCCTGCAGCCACTGGTTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kobori, T.; Doukuni, R.; Ishikawa, H.; Ito, Y.; Okada, R.; Tanaka, C.; Tameishi, M.; Urashima, Y.; Ito, T.; Obata, T. Ezrin and Radixin Differentially Modulate Cell Surface Expression of Programmed Death Ligand-1 in Human Pancreatic Ductal Adenocarcinoma KP-2 Cells. Immuno 2022, 2, 68-84. https://doi.org/10.3390/immuno2010006
Kobori T, Doukuni R, Ishikawa H, Ito Y, Okada R, Tanaka C, Tameishi M, Urashima Y, Ito T, Obata T. Ezrin and Radixin Differentially Modulate Cell Surface Expression of Programmed Death Ligand-1 in Human Pancreatic Ductal Adenocarcinoma KP-2 Cells. Immuno. 2022; 2(1):68-84. https://doi.org/10.3390/immuno2010006
Chicago/Turabian StyleKobori, Takuro, Rina Doukuni, Honami Ishikawa, Yui Ito, Rie Okada, Chihiro Tanaka, Mayuka Tameishi, Yoko Urashima, Takuya Ito, and Tokio Obata. 2022. "Ezrin and Radixin Differentially Modulate Cell Surface Expression of Programmed Death Ligand-1 in Human Pancreatic Ductal Adenocarcinoma KP-2 Cells" Immuno 2, no. 1: 68-84. https://doi.org/10.3390/immuno2010006
APA StyleKobori, T., Doukuni, R., Ishikawa, H., Ito, Y., Okada, R., Tanaka, C., Tameishi, M., Urashima, Y., Ito, T., & Obata, T. (2022). Ezrin and Radixin Differentially Modulate Cell Surface Expression of Programmed Death Ligand-1 in Human Pancreatic Ductal Adenocarcinoma KP-2 Cells. Immuno, 2(1), 68-84. https://doi.org/10.3390/immuno2010006

