A New Species of Hydrozoan Jellyfish Eutima onahamaensis and New Record of Eutima diademata (Hydrozoa, Leptothecata) from Japan

Abstract

The family Eirenidae is one of the major taxa of the order Leptothecata, comprising approximately 80 species from ten genera. In this study, taxonomic investigations, including morphological observations and molecular 16S phylogenetic analyses, were conducted on unknown Eirenidae specimens collected off the coast of Iwaki, Fukushima Prefecture, eastern Japan, in June 2022. The specimens had the following morphological characteristics: marginal warts and tentacular bulbs with lateral cirri and without adaxial papillae, a mouth with simple lips, four simple radial canals, and eight statocysts common to the genus Eutima. However, this species can be distinguished from other species of Eutima by the number of tentacles, number and shape of marginal warts, position of the gonads, and gastric peduncle length. Moreover, the monophyly of the species was evident in the 16S rRNA phylogenetic tree (as indicated by the high bootstrap value of 100%), thereby supporting the validity of the new species. Based on these results, we describe it as a new species, Eutima onahamaensis, for taxonomic stabilization. We also made detailed observations of the morphology and molecular phylogenetic analyses of one of the species newly recorded in Japan: Eutima diademata. A comparative table of the primary diagnostic characteristics of Eutima has been provided. This study provided taxonomic keys for identifying species in the genus Eutima.

1. Introduction

The family Eirenidae is one of the major taxa in the order Leptothecata, comprising approximately 80 species in ten genera [1,2]. Eirenidae species are distributed in shallow waters in the Pacific and Atlantic Oceans [1,3,4,5,6]. These species have sexual planktonic medusae and asexual benthic polyps in their life cycle [7,8,9]. Polyps of certain species belonging to the genera Eugymnanthea and Eutima live in the soft parts of bivalve mollusks [10,11]. Inhabitation of polyps of Eutima japonica (Uchida, 1925) reduced shell length growth of the Japanese scallop Mizuhopecten yessoensis (Jay, 1857) by 43% and triglyceride accumulation in the digestive glands by 24–47% [12]. Eirene lacteoides (Kubota & Horita, 1992); Eirene menoni (Kramp, 1953); Eutonina indicans (Romanes, 1876), and Tima nigroannulata (Calder et al., 2021) are beautiful jellyfish and are popular for exhibitions in public aquaria in Japan [13,14].

The genus Eutima currently comprises 23 species [2,15]. Eutima was established by McCrady and described as two new species: Eutima mira (McCrady, 1859) and Eutima variabilis (McCrady, 1859) [16]. Eutima is classified in the family Eucopidae [3,16]; however, Kramp regarded it as a genus of the family Eutimidae [4]. Bouillon removed Eutima from the family Eirenidae [17]. Recent molecular analyses have suggested that Eutima belongs to the genus Eirenidae [18,19].

Eutima is characterized as follows: Medusa with distinct gastric peduncle; lateral cirri (difficult to observe and often destroyed after fixation); marginal swellings or warts; mouth with simple lips; four simple radial canals; “gonads” on radial canals, either beneath subumbrella or on gastric peduncle or both; with eight (exceptionally twelve) statocysts. Polyps are either single hydranths, erect colonies arising from creeping stolons, or epizootic naked polyps; in nonepizootic forms, hydrocaulus with smooth perisarc, young colonies with cylindrical hydrotheca with diaphragm and a folded pleated operculum formed by convergent flaps not demarcated from the hydrothecal rim (Campanulina type), in older colonies of this type, operculum generally lost and hydrotheca reduced to a perisarcal collar of the type; usually with intertentacular web [1].

To date, two Eutima species, Eutima japonica and Eutima cirrhifera (Kakinuma, 1964), have been reported in Japanese waters [2,20,21]. In this study, six specimens of unidentified Eirenidae species were collected off the coast of Iwaki, Fukushima Prefecture, eastern Japan, and off Itoman, Okinawa Prefecture, southern Japan. Our morphological and molecular phylogenetic analyses suggested that these Eirenidae species should be regarded as a new species and a new species record to Japan within the genus Eutima.

2. Materials and Methods

2.1. Collection and Fixation

Six medusae of Eirenidae specimens were collected from near the water surface (within about 10 m) at Onahama Port, Iwaki, Fukushima Prefecture, eastern Japan (36°56′23.84″ N, 140°54′26.40″ E); off Itoman, Okinawa Prefecture, southern Japan (26°7′6.41″ N, 127°35′53.36″ E) between 20 April 2022 and 4 June 2022. The medusae were captured using a plankton net (mesh size, approximately 0.1 mm, mouth diameter, 30 cm) and a plastic bottle by SCUBA. Four specimens were fixed in 3% formalin in seawater and deposited in the National Museum of Nature and Science, Tsukuba (NSMT). The three specimens (two whole medusa and one tentacle) were preserved in 99.5% ethanol until molecular analysis. Additionally, two specimens of Eutima japonica from Shonan Port, Fujisawa, Kanagawa Prefecture, eastern Japan (35°17′52.40″ N, 139°28′32.20″ E) were used in the molecular phylogenetic analyses (

Table 1. Taxa included in the phylogenetic analyses and GenBank accession numbers for the sequences. Sequences obtained in this study are in bold.

Species	Accessioned Name	Accession No.	Locality (Origin)	Reference
Eirene viridula	Eirene viridula	KY363937	France: Villefranche-sur-Mer, Ligurian Sea, Mediterranean	[22]
Eirene viridula	Eirene viridula	FJ550502	France: Luc-sur-mer	[23]
Eugymnanthea inquilina	Eugymnanthea inquilina	AY285163	Italy	[24]
Eugymnanthea inquilina	Eugymnanthea inquilina	AY285164	Italy	[24]
Eutima curva	Eutima curva	FJ550514	New Zealand: Devonport	[23]
Eutima gegenbauri	Eutima gegenbauri	FJ550515	France: Villefranche-sur-Mer	[23]
Eutima gegenbauri	Eutima gegenbauri	KY363964	Sweden: Kristineberg	[22]
Eutima gracilis	Eutima gracilis	KY363965	Sweden: Kristineberg	[22]
Eutima diademata	Eutima diademata	LC822406	Japan: off Itoman, Okinawa	This study
Eutima diademata	Eutima krampi	FJ418653	Unknown	Unpublished
Eutima diademata	Eutima krampi	JQ716003	Taiwan Strait	[18]
Eutima diademata	Eutima krampi	JQ716004	Taiwan Strait	[18]
Eutima japonica	Eutima japonica	LC822407	Japan: Shonan Port, Fujisawa, Kanagawa	This study
Eutima japonica	Eutima japonica	LC822408	Japan: Shonan Port, Fujisawa, Kanagawa	This study
Eutima japonica	Eutima sp.	MW066348	Unknown	Unpublished
Eutima levuka	Eutima levuka	FJ418654	Unknown	Unpublished
Eutima levuka	Eutima levuka	JQ716006	China: Xiamen Bay	[18]
Eutima levuka	Eutima levuka	JQ716007	China: Xiamen Bay	[18]
Eutima onahamaensis	Eutima onahamaensis n. sp.	LC822404	Japan: Onahama Port, Iwaki, Fukushima	This study
Eutima onahamaensis	Eutima onahamaensis n. sp.	LC822405	Japan: Onahama Port, Iwaki, Fukushima	This study
Eutonina indicans	Eutonina indicans	KY363938	USA: San Juan Island, Friday Harbor	[22]
Eutonina indicans	Eutonina indicans	KY363946	Norway: Fanafjord, Kinnar Osen	[22]
Tima nigroannulata	Tima formosa	JQ715991	China: Changjiang River Estuary	[18]
Tima nigroannulata	Tima formosa	JQ715992	China: Changjiang River Estuary	[18]
Aequorea coerulescens	Aequorea coerulescens	KT266599	Japan: Shirahama, Wakayama	Unpublished

) [18,22,23,24].

2.2. Morphological Investigation

Taxonomic observations and measurements were conducted on both live and preserved specimens (Figure 1). Medusae were placed and flattened on a glass dish (diameter 50 mm). The umbrella height was measured from the apex of the umbrella to the umbrella margin. The umbrella diameter was measured across the turnover of the exumbrella. Specimens were photographed under a compound microscope (SZ61, OLYMPUS, Tokyo, Japan) using an OLYMPUS OM-D E-M5 MarkII. Measurements were made using methods previously [6] with ImageJ software to the nearest 0.01 mm [25].

For nematocyst identification in medusae, squash prepared from fresh tissue was examined under a compound microscope (BX53, OLYMPUS, Tokyo, Japan). The nematocysts were identified using the method previously described by Kubota [10]. In total, 90 nematocysts were identified, measured, and counted to determine the abundance of nematocyst types in medusae. Measurements were made using ImageJ to the nearest 0.1 µm [25].

2.3. Molecular Phylogenetic Analysis

Near-complete sequences of the mitochondrial 16S rDNA gene (approximately 600 bp) were used for molecular phylogenetic analysis. Genomic DNA was extracted from the ethanol-preserved tissue of the cultured specimens using the DNeasy Blood and Tissue Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. The 16S rDNA was PCR-amplified and sequenced with the forward and reverse primer pair TCGACTGTTTACCAAAAACATAGC and ACGGAATGAACTCAAATCATGTAAG [26], using the following PCR profile: initial denaturation at 94 °C for 5 min; five cycles at 94 °C for 50 s, 45 °C for 50 s, and 72 °C for 60 s; 30 cycles at 94 °C for 50 s, 50 °C for 50 s, and 72 °C for 60 s; and final elongation at 72 °C for 5 min [27]. The PCR products were purified using a QIAquick PCR Purification Kit (Qiagen) and sequenced in both directions using an ABI 3730 automated sequencer (Applied Biosystems, Bedford, MA, USA). The new sequences were aligned using MEGAX with built-in ClustalW [28]. Phylogenetic analysis and pairwise distance measurements were performed using the maximum likelihood method based on the Kimura 2-parameter model [29], with 1000 bootstrap replications in MEGAX. Five sequences of the Eutima species were deposited in GenBank under the accession numbers LC822404-822408 (Table 1).

3. Results

3.1. Taxonomy

Phylum Cnidaria Verrill, 1865.

Subphylum Medusozoa Petersen 1979

Class: Hydrozoa Owen 1843.

Subclass Hydroidolina Collins, 2000

Order: Leptothecata Cornelius 1992.

Family: Eirenidae Haeckel, 1879

Genus Eutima McCrady, 1859

3.2. Species Description

Eutima onahamaensis sp. n

New Japanese name. Jangara-konoha-kurage

Material examined. Holotype: NSMT-Co1848; Onahama Port, Iwaki, Fukushima Prefecture, eastern Japan; 36°56′23.84″ N 140°54′26.40″ E; 4 June 2022; collector: Rintaro Ishii. Paratypes: NSMT-Co1846-Co1847. The locality, date, and collector are used for the holotype (

Table 2. Morphometrics (mm) of Eutima onahamaensis sp. n. and Eutima diademata. * The holotype. Nos. NSMT-Co1846-1847 are paratypes. UH, umbrella height; UD, umbrella diameter.

Species	Specimen Number	UH (mm)	UD (mm)	No. of Tentacles	No. of Marginal Warts	No. of Statocysts
Eutima onahamaensis n. sp.	NSMT-Co1846	2.7	4.6	4	44	8
Eutima onahamaensis n. sp.	NSMT-Co1847	2.1	3.7	4	39	8
Eutima onahamaensis n. sp.	NSMT-Co1848 *	4.1	7.9	4	55	8
Eutima diademata	NSMT-Co1849	8.7	10.4	9	96	8

).

Description. Mature medusae umbrella flat (Figure 2A), 2–4 mm high and 4–8 mm in diameter. Umbrella apex rounded and mesoglea thickened. Exumbrella smooth and nematocysts sparsely scattered (Figure 2A,B). Manubrium hanging in the umbrella cavity, tubular, reddish-brown in color (Figure 2A and Figure 3A). Gastric peduncle very short and indistinct. Manubrium length is about 1 mm, 1/5 of the length of the umbrella diameter, not extended beyond umbrella margin. Mouth cruciform, with four frilled lips (Figure 3B). Four radial canals and a circular canal (Figure 2B). Gonads linear, extending along almost the entire length of radial canals (Figure 2A). Tentacular bulbs four, swollen, dark brown in color (Figure 3D,E). Tentacles four, filiform, tapering to a tip, length about twice umbrella diameter (Figure 3F). Marginal warts 39–55, usually 7–15 between successive tentacles (Figure 3G). Statocysts eight. Marginal warts and tentacular bulbs with lateral cirri and without adaxial papillae (Figure 3H). Velum narrow, 1/5 of umbrella diameter.

Cnidome. Three different nematocyst types, artichous isorhizas, basitrichous isorhizas, and merotrichous isorhizas, were identified and measured in the adult medusae (

Table 3. Cnidomes of Eutima onahamaensis sp. n. D, L represent capsule diameter and length, respectively, in μm.

Type		Min	Max	Mean	SD	N
Artichous isorhiza	D	2.7	4.4	3.4	0.5	30
	L	4.8	7.1	6.1	0.5	30
Basitrichous isorhiza	D	3.7	6.4	5.3	0.7	30
	L	9.0	12.4	10.8	0.8	30
Merotrichous isorhiza	D	2.6	5.8	3.5	0.6	30
	L	7.1	12.8	9.0	1.1	30

, Figure 4A–C).

Habitat and ecology. Medusae of Eutima onahamaensis sp. n. appeared in shallow waters (5 m depth) in June in a range of cold-temperature localities on the coast of Onahama, Iwaki, Fukushima Prefecture, eastern Japan. The medusae swam by contracting their tentacles and relaxed with extended tentacles (Figure 2A,B). Seasonal occurrence and early life cycle, including embryogenesis, are unknown.

Etymology. The specific name “onahamaensis” refers to the Onahama, southern region of Iwaki City, Fukushima Prefecture, which includes the type locality in which the species was found.

Eutima diademata (Kramp, 1959)

New Japanese name. Enaga-konoha-kurage

Material examined. NSMT-Co1849; Off Itoman, Itoman, Okinawa Prefecture, western Japan; 26°7′6.41″ N, 127°35′53.36″ E; 20 April 2022; collector: Sho Toshino. Description. Mature medusae umbrella flat (Figure 5A), 8.7 mm high and 10.4 mm in diameter. Umbrella apex rounded and mesoglea thickened. Exumbrella smooth and nematocysts sparsely scattered (Figure 5A–C). Manubrium hanging in the umbrella cavity, tubular, and whitish in color (Figure 6A,B). Gastric peduncle very long and distinct. Gastric peduncle length about 25 mm, three times the length of umbrella diameter, extended beyond umbrella margin. Mouth cruciform, with four frilled lips. Four radial canals and a circular canal (Figure 6C). Gonads linear, extending along almost the entire length of radial canals and gastric peduncle (Figure 6A). Tentacular bulbs four, swollen, whitish in color (Figure 6D,E). Tentacles nine, filiform, tapering to a tip, length about three times the umbrella diameter (Figure 6F). The four tentacles are arranged perradially and four interradially, but an additional tentacle is included due to malformation. Marginal warts 96, usually 11–13 between successive tentacles (Figure 6G). Statocysts eight (Figure 6G,H). Marginal warts and tentacular bulbs with lateral cirri and without adaxial papillae (Figure 6H). Velum narrow, 1/5 of umbrella diameter.

Cnidome. Not examined in this study.

Habitat and ecology. Eutima diademata has been reported offshore in Mindanao, Philippines, the Nansha Islands region, the coast of the southeast China Sea, and the Taiwan Strait [30,31,32,33,34]. The medusa was abundant in the surface waters along the upwelling region of the southern part of the Taiwan Straits in June [34]. In this study, medusae of E. diademata appeared approximately 5 m below the surface in April in a range of subtropical-temperature localities off Itoman, Okinawa Prefecture, southern Japan. Developmental stages and structural details of medusae have been reported [34]. The early life cycle, including embryogenesis and polyp, is unknown.

Etymology. The specific name “diademata” is taken from the Latin word ‘diadema’, meaning ‘crown’. The name may reflect the shape of a medusa, similar to a crown.

3.3. Molecular Phylogenetics

We sequenced Eutima onahamaensis, E. diademata, E. japonica, and the nine Leptothecata taxa for statistical analyses using the 16S rDNA fragments. The maximum likelihood tree constructed for the family Eirenidae based on the 16S rDNA sequences (Figure 7) comprised five major clades formed by the family Eirenidae: (1) Tima, (2) Eugymnanthea, (3) Eutima, (4) Eutonina, and (5) Eirene. Eutima onahamaensis clustered in the subclade Eutima curva (Browne, 1905) and E. gracilis (Forbes & Goodsir, 1853). The monophyly of Eutima onahamaensis was evident in the 16S phylogenetic tree (as indicated by the high bootstrap value of 99%), thereby supporting the validity of this new species. Eutima diademata from Japan clustered with E. diademata from China (FJ418653, JQ716003, JQ716004). Eutima japonica from Japan clustered with E. japonica (MW066348).

The Kimura two-parameter distance was 0.064–0.167 between Eutima onahamaensis n. sp. and other Eutima, 0.124–0.205 between E. onahamaensis and other Eirenidae genera (Eirene, Eugymnanthea, Eutonina and Tima), 0.009–0.011 between Eutima diademata from Japan and E. diademata from Taiwan, and 0.000 between Eutima japonica from Japan and E. japonica (MW066348) (Table S1).

4. Discussion

4.1. Morphological Investigation

A comparison of the key features of species in the genus Eutima (two and four tentacled species) is presented in

Table 4. Morphology of Eutima in previous and present studies.

Species	Umbrella (mm)	No. of Tentacle	Marginal Warts	Gonads	Adaxial Papillae	Gastric Peduncle	Distribution	Reference
Eutima onahamaensis sp. n.	4–8	4	39–55	4 on radial canals	Absent	Very short, indistinct	Japan: Fukushima	This study
Eutima cirrhifera (Kakinuma, 1964)	8–10	8	24–49	Subumbrella	Absent	Short	Japan: Hokkaido	[17,20]
Eutima coerulea (Agassiz, 1862)	10	32	96	Restricted to peduncle	Absent	1/2 of umbrella diameter, tapering	Bahamas, Florida, Tortuga	[4,35]
Eutima commensalis Santhakumari, 1970	6	8	48–80	Subumbrella	Absent	Short	Indian, Arabian Sea	[7,17]
Eutima curva Browne, 1905	25	4	120–140	Restricted to peduncle	Absent	Long, pyramidal above	Indo-Pacific, China Sea	[4,36]
Eutima diademata (Kramp, 1959)	15	8	50–80	8:4 on radial canals, 4 on peduncle	Absent	Long	Indo-Pacific	([30,34], This study)
Eutima gegenbauri (Haeckel, 1864)	20	8–16	60–81	8:4 on radial canals, 4 on peduncle	Present	Very long	Mediterranean, European Atlantic, Australia, China Sea	[4,17]
Eutima gentiana (Haeckel, 1879)	8	8	16	Restricted to peduncle	Absent	Very long	Canary Islands, China Sea	[4,17]
Eutima gracilis (Forbes & Goodsir, 1853)	13	2 or 4	40–80	Restricted to peduncle	Absent	Long and narrow, with conical base	Mediterranean, European Atlantic, West Africa	[4,36]
Eutima hartlaubi Kramp, 1958	15	12–14	32	8:4 on radial canals, 4 on peduncle	Absent	1/2 of umbrella diameter	Djibouti, Nicobar, Aden Gulf, Indian Ocean	[17,37]
Eutima japonica Uchida, 1925 (northern form)	5–11	8	16–45	4 on radial canals	Absent	Short	Japan, North Pacific	[38]
Eutima japonica Uchida, 1925 (southern form)	9–12	8	47–67	4 on radial canals	Absent	Short	Japan, the Seto Inland Sea, Kochi Prefecture	[38]
Eutima japonica Uchida, 1925 (intermediate form)	2–3	4	8–24	4 on radial canals	Absent	Very short, indistinct	Japan, Mie Prefecture, Tsushima Island	[38,39,40]
Eutima japonica Uchida, 1925 (transitional form)	5–7	4 or 8	16–45	4 on radial canals	Absent	Short	Japan, Miyazaki Prefecture	[38]
Eutima levuka (Agassiz & Mayer, 1899)	15	8	100	8:4 on radial canals, 4 on peduncle	Absent	1/2 of umbrella diameter	Indo-Pacific, China Sea	[4,17]
Eutima longigonia Bouillon, 1984	88	8	64–80	Restricted to peduncle	Absent	1× umbrella diameter	Papua New Guinea	[17]
Eutima marajoara Tosetto, Neumann-Leitão & Nogueira, 2020	10	40	48	Subumbrella	Present	1/4 of umbrella diameter	North Brazil	[2]
Eutima mira McCrady, 1859	30	4	<100	4 on radial canals, 4 on peduncle	Absent	Long, tapering	Indo-Pacific, Brazil, Northeast Atlantic, China Sea	[4,35]
Eutima modesta (Hartlaub, 1909)	8	16	16<	Subumbrella	Absent	1× umbrella diameter	Djibouti, Aden Gulf	[4,17]
Eutima mucosa Bouillon, 1984	15	8	56–80	Subumbrella	Absent	1/2 of umbrella diameter	Papua New Guinea	[17]
Eutima neucaledonia Uchida, 1964	9	8	48–56	Subumbrella	Absent	1× umbrella diameter	New Caledonia	[17,41]
Eutima orientalis (Browne, 1905)	6	4	60–80	4 on radial canals, 4 on peduncle	Absent	2× umbrella diameter	Sri Lanka	[31]
Eutima ostrearum (Mattox & Crowell, 1951)	3	4	12	4 on radial canals	Absent	Long, simple, extendng to velar opening	Puerto Rico	[42]
Eutima sapinhoa Narchi & Hebling, 1975	4	4	28	Subumbrella	Absent	1× umbrella diameter	Brazil	[17,43]
Eutima suzannae Allwein, 1967	6	8	32	Subumbrella	Present	1/2 of umbrella diameter	North Carolina	[17,44]
Eutima variabilis McCrady, 1859	-	20	36	4 on radial canals, 4 on peduncle	Absent	1–1.5 of umbrella height	East USA, China Sea	[4,17]
Eutima taiwanensis Xu, Huang and Guo, 2019	12	12–16	80–120	4 on radial canals, 4 on peduncle	Absent	Long	Taiwan Strait	[45]

[2,4,7,17,20,30,31,34,35,36,37,38,39,40,41,42,43,44,45]. All species of Eutima have a gastric peduncle, lateral cirri, marginal swellings or warts, a mouth with simple lips, four simple radial canals, gonads on radial canals, either beneath the subumbrella or on the gastric peduncle, or both, with eight (exceptionally twelve) statocysts [1]. Eutima onahamaensis can be distinguished from other Eutima species by the number of tentacles, number, and shape of warts, gonad position, and peduncle length. Most Eutima species have more than eight tentacles; however, E. onahamaensis, E. curva, E. gracilis, E. japonica (intermediate and transitional forms), E. mira, Eutima orientalis (Browne, 1905), Eutima ostrearum (Mattox & Crowell, 1951), and Eutima sapinhoa (Narchi & Hebling, 1975) have only four tentacles. The number of marginal warts is lower in E. onahamaensis (39–55) and higher in E. curva (120–140) and E. mira (over 100). Four gonads are present in the radial canals of E. onahamaensis and E. japonica (intermediate and transitional forms), restricted to the peduncle in E. curva and E. gracilis, four on the radial canals and four on peduncles in E. mira and E. orientalis, and the subumbrella in E. sapinhoa. The gastric peduncle is very short and indistinct in E. onahamaensis, E. japonica (intermediate form), and E. sapinhoa, whereas it is long in E. curva, E. gracilis, E. mira, E. orientalis, and E. ostrearum. Based on these morphological differences, the present species is identified as a new species.

Prior to our study, two Eutima species, Eutima japonica and E. cirrhifera, were reported in Japanese waters [2,20,21]. Additionally, Eutima japonica is classified into four types, northern, southern, intermediate, and transitional, based on the following morphological characteristics: number of tentacles, length of manubrium, and presence of lateral cirri [10]. Eutima onahamaensis tends to resemble those of the intermediate form of Eutima japonica. The intermediate form of the species was originally described by Kubota as Eucheilota intermedia (Kubota, 1984) based on specimens from Zagashima Island, Ago Bay, Mie Prefecture, Japan [39]. This form has been reported on Tsushima and Okinawa Islands [39,40,46]. Eutima onahamaensis and the intermediate form of E. japonica have short, indistinct peduncles on the manubrium and cruciform oral lips. However, E. onahamaensis has a larger number of marginal warts (39–55 vs. 20–24) and long gonads (half the length of the gonads in E. japonica). The distributions of the two species did not overlap.

Eutima diademata was described as Eucheilota diademata by Kramp from Candos Bay, Mindanao, Philippines, based on a single immature specimen [30]. Additionally, Guo et al. described Eutima krampi by observing developmental stages and structural details of medusae from the southern part of the Taiwan Strait [34]. Guo et al. regarded that E. diademata is the young medusa of E. krampi because of the following morphological characters: absence of gonads; 2 opposite, perradial tentacles with 1 pair of lateral cirri and without black spot; 29 marginal warts with 1 pair of cirri and each with a distinct black spot on the extreme tip; with 8 statocysts; without gastric peduncle. Given the result of morphological observation, Eutima krampi is regarded as a junior synonym of E. diademata [2]. The morphological inspection of E. diademata from Japan agrees well with the morphological description of the mature stage by Guo et al. [34].

Cnidomes are important for their identification. Three types of nematocysts, i.e., atrichous, basitrichous, and merotrichous isorhizas, have been examined in E. cirrhifera, E. japonica, and Eutima onahamaensis sp. n. ([47,48], this study). Eutima gegenbauri and E. gracilis bear merotrichous haplonemes [49].

4.2. Molecular Phylogenetic Analysis

The paraphyly of Eutima, including Eutima onahamaensis and seven species (E. curva, E. diademata, E. gegenbauri, E. gracilis, E. japonica, E. levuka, and E. viridula), was evident in the 16S rDNA phylogenetic tree with high bootstrap values, which supports the validity of the new species.

The Kimura two-parameter distance was 0.064–0.167 between different Eutima and other Eirenidae genera and Aequoreidae (Aequorea coerulescens). In the genus Eutima, the intrageneric variability was 0.185–0.190 [18]. Given the results of the K2P distances in this study, E. onahamaensis was considered a genetically independent species in Eutima. The distance was 0.009–0.011 between E. diademata from Japan and E. diademata from Taiwan, and 0.000 between E. japonica from Japan and E. japonica (MW066348), which is considered to represent intraspecific variability [18,50,51,52].

5. Conclusions

Our morphological and molecular phylogenetic analyses suggested that the specimens collected off the coast of Iwaki, Fukushima Prefecture, eastern Japan, are new species belonging to the genus Eutima. Additionally, we first reported Eutima diademata from Japan. The medusae of Eutima onahamaensis sp. n. appeared in the shallow waters of Japan in June. However, polyps of the species have not been detected in the wild. Polyps of Eutima species have been found inside bivalve molluscs, Barbatia virescens (Reeve, 1844), Dendostrea sandvichensis (G. B. Sowerby II, 1871), Magallana gigas (Thunberg, 1793), Mytilus edulis Linnaeus, 1758, Mytilus galloprovincialis Lamarck, 1819, Mizuhopecten yessoensis [12,46,47,53]. Further investigations, including polyps and their life cycles, are necessary to gain insight into the ecology of the new species.