Integrated Metabolomics and Transcriptomics Analysis of Flavonoid Biosynthesis Pathway in Polygonatum cyrtonema Hua
Abstract
1. Introduction
2. Results
2.1. Metabolic Profiling
2.2. Metabolite Analysis Based on PCA and OPLS-DA
2.3. Differentially Accumulated Metabolite Screening in Leaf, Stem, Rhizome, and Root Tissues
2.4. Functional Annotation and Enrichment Analysis of Differentially Accumulated Metabolites
2.5. Functional Annotation and Enrichment Analysis of Differential Flavonoid Genes
2.6. Combined Analysis of Transcriptome and Metabolome Analysis
2.7. Validation of Differentially Expressed Genes by Quantitative Real-Time PCR
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Metabolome Analysis Based on UPLC-ESI-MS/MS
4.3. Transcriptomic Analysis
4.4. Quantitative Real-Time PCR (qRT-PCR) Analysis
4.5. Data Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liu, R.; Lu, J.; Xing, J.Y.; Du, M.; Wang, M.X.; Zhang, L.; Li, Y.F.; Zhang, C.H.; Wu, Y. Transcriptome and metabolome analyses revealing the potential mechanism of seed germination in Polygonatum cyrtonema. Sci. Rep. 2021, 11, 12161. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.W.; Xia, L.; Peng, F.; Song, C.; Manzoor, M.A.; Cai, Y.; Jin, Q. Transcriptomics and metabolomics changes triggered by exogenous 6-benzylaminopurine in relieving epicotyl dormancy of Polygonatum cyrtonema Hua seeds. Front. Plant Sci. 2022, 13, 961899. [Google Scholar] [CrossRef] [Scilit]
- Ren, H.M.; Deng, Y.L.; Zhang, J.L.; Ye, X.W.; Xia, L.T.; Liu, M.M.; Liu, Y. Research progress on processing history evolution, chemical components and pharmacological effects of Polygonati Rhizoma. China J. Chin. Mater. Med. 2020, 45, 4163–4182. [Google Scholar] [CrossRef] [PubMed]
- Tao, A.E.; Zhang, X.C.; Du, Z.F.; Zhao, F.Y.; Xia, C.L.; Duan, B.Z. Research progress on flavonoids in plants of Polygonatum Mill. and their pharmacological activities. Chin. Tradi. Herb. Drugs 2018, 49, 2163–2171. [Google Scholar] [CrossRef]
- Jiao, J.; Huang, W.L.; Bai, Z.Q.; Liu, F.; Ma, C.D.; Liang, Z.S. DNA barcoding for the efficient and accurate identification of medicinal polygonati rhizoma in China. PLoS ONE 2018, 13, e0201015. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, C.F.; Liu, Y.X.; Li, Y.H.; Hao, Q.Q.; He, X.H.; Wang, J.G. Extraction and antioxidant activity of flavonoids from sea-buckthorn. J. Anhui Sci. Technol. Univ. 2024, 38, 88–96. [Google Scholar] [CrossRef]
- Liu, S.J.; Xing, Y.B.; Xing, P.; Chen, X.P. Characterization of the antibacterial activity of Perilla flavone. Food Res. Dev. 2021, 42, 163–168. [Google Scholar] [CrossRef]
- Chen, M.; Wang, J.T.; Gao, W.H.; Lei, S.P.; Zhu, Y.H. Total flavonoids in Scutellaria barbata prevents NLRP3 inflammasome expression in tumor cells by affecting autologous pathway. China J. Chin. Mater. Med. 2017, 42, 4841–4846. [Google Scholar] [CrossRef] [PubMed]
- Wei, J.; Huang, L.; Li, D.; He, J.H.; Li, Y.J.; He, F.; Fang, W.R.; Wei, G.N. Total flavonoids of Engelhardia roxburghiana Wall. leaves alleviated foam cells formation through AKT/mTOR-Mediated autophagy in the progression of atherosclerosis. Chem. Biodivers. 2021, 18, e2100308. [Google Scholar] [CrossRef] [Scilit]
- Lin, H.R. Two homoisoflavonoids act as peroxisome proliferator-activated receptor agonists. Med. Chem. Res. 2015, 24, 2898–2905. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.J.; Shi, X.; Qu, R.; Peng, W.S. Study on extraction process of flavonoids from Polygonatum kingianum Coll. et Hemsland antioxidative activities of flavonoids. Sci. Technol. Food Ind. 2013, 34, 222–225. [Google Scholar] [CrossRef]
- Ning, D.L.; Liu, J.; Li, M.; Li, W.J.; Li, l.; Zhang, H.L.; Sun, J.K. Anti-proliferation effect of homoisoflavonoids extracted from Polygonati odorati Rhizoma on A549 Cells. Chin. J. Exp. Tradit. Med. Form. 2017, 23, 174–179. [Google Scholar] [CrossRef]
- Khan, H.; Saeed, M.; Muhammad, N.; Gilani, A.H.; Muhammad, N.; Ur Rehman, N.; Mehmood, M.H.; Ashraf, N. Antispasmodic and antidiarrheal activities of rhizomes of Polygonatum verticillatum maneuvered predominately through activation of K+ channels: Components identification through TLC. Toxicol. Ind. Health 2016, 32, 677–685. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, L.H.; Ren, F.Z.; Zheng, Z.H.; Chen, S.H.; Gao, Y.Q.; Zhu, X.L. Studies on biological activity of homoisoflavanones from Polygonatum odratum (Mill.) Druce. J. Hebei Norm. Univ. 2012, 36, 134–137. [Google Scholar]
- Zhang, H.; Yang, F.; Qi, J.; Song, X.C.; Hu, Z.F.; Zhu, D.N.; Yu, B.Y. Homoisoflavonoids from the fibrous roots of Polygonatum odoratum with glucose uptake-stimulatory activity in 3T3-L1 adipocytes. J. Nat. Prod. 2010, 73, 548–552. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, X.L.; Zhang, Y.P.; Zhao, H.D.; Liang, J.S.; Zhang, Y.; Shi, S.Y. Antioxidant homoisoflavonoids from Polygonatum odoratum. Food Chem. 2015, 186, 63–68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, S.; Patial, V.; Singh, D.; Sharma, U.; Kumar, D. Antimicrobial homoisoflavonoids from the Rhizomes of Polygonatum verticillatum. Chem. Biodivers. 2018, 15, e1800430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Skrzypczakowa, L. C-glycosyls in Polygonatum multiflorum. Diss Pharm. Pharmacol. 1969, 21, 261–266. [Google Scholar]
- Li, J.; Yan, G.H.; Duan, X.W.; Zhang, K.C.; Zhang, X.M.; Zhou, Y.; Wu, C.B.; Zhang, X.; Tan, S.N.; Hua, X.; et al. Research progress and trends in metabolomics of fruit trees. Front. Plant Sci. 2022, 13, 13881856. [Google Scholar] [CrossRef] [Scilit]
- Lin, C.C.; Zhao, Y.; Liu, R.; Lu, Q. Research progress in the application of proteomics and metabolomics in bee products. Sci. Technol. Food Ind. 2023, 44, 377–386. [Google Scholar] [CrossRef]
- Han, Z.G.; Gong, Q.Q.; Huang, S.Y.; Meng, X.Y.; Xu, Y.; Li, L.G.; Shi, Y.; Lin, J.H.; Chen, X.L.; Li, C.; et al. Machine learning uncovers accumulation mechanism of flavonoid compounds in Polygonatum cyrtonema Hua. Plant Physiol. Biochem. 2023, 201, 107839. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, S.; Joshi, R.; Kumar, D. Metabolomics insights and bioprospection of Polygonatum verticillatum: An important dietary medicinal herb of alpine Himalaya. Food Res. Int. 2021, 148, 110619. [Google Scholar] [PubMed]
- Wu, K.J.; Wang, F.F.; Chang, H.; Liang, Z.S.; Yang, Q.W.; Ma, C.D.; Jia, Q.J. Effects of different cultivation methods on the accumulation of main chemical constituents of four-year-old Polygonatum sibiricum. Chin. Tradi. Patent Med. 2021, 43, 2433–2437. [Google Scholar] [CrossRef]
- Li, A.L.; Li, W.J.; Wu, W.; Zhang, T.Y.; Zhang, J.; Wu, Y.; Liu, R. Comparison of flavonoids, amino acids and phenolic acids in different Polygonatum rhizomes. Chin. J. Appl. Environ. Biol. 2023, 1–10. [Google Scholar] [CrossRef]
- Hui, F.; Liu, X.Y.; Li, Z.X.; Liu, F.S.; Yang, S.H. Application of transcriptome sequencing in study of medicinal plants. Chin. Tradi. Herb. Drugs 2019, 50, 6149–6155. [Google Scholar] [CrossRef]
- Liu, H.B.; ShangGuan, Y.N.; Pan, Y.C.; Zhao, Z.Q.; Li, L.; Xu, D.L. Applications of RNA-Seq technology on medicinal plants. Chin. Tradi. Herb. Drugs 2019, 50, 5346–5354. [Google Scholar] [CrossRef]
- Mao, R.J.; Bai, Z.Q.; Wu, J.W.; Han, R.L.; Zhang, X.M.; Chai, W.G.; Liang, Z.S. Transcriptome and HPLC analysis reveal the regulatory mechanisms of aurantio-obtusin in space environment-induced Senna obtusifolia Lines. Int. J. Environ. Res. Public Health 2022, 19, 898. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.; Wang, Y.T.; Guo, J.; Yang, J.; Zhang, X.D.; Wang, Z.X.; Cheng, Y.; Du, Z.W.; Qi, Z.C.; Huang, Y.B.; et al. Integrated transcriptomics and proteomics to reveal regulation mechanism and evolution of SmWRKY61 on tanshinone biosynthesis in Salvia miltiorrhiza and Salvia castanea. Front. Plant Sci. 2022, 12, 820582. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, T.; Guo, K.Y.; Liu, L.D.; Tian, W.; Xie, X.L.; Wen, S.Q.; Wen, C.X. Integrated transcriptomic and metabolomic data reveal the flavonoid biosynthesis metabolic pathway in Perilla frutescens (L.) leaves. Sci. Rep. 2020, 10, 16207. [Google Scholar] [CrossRef] [Scilit]
- Zou, L.Q.; Wang, C.X.; Kuang, X.J.; Li, Y.; Sun, C. Advance in flavonoids biosynthetic pathway and synthetic biology. Chin. J. Chin. Mater. Medi. 2016, 41, 4124–4128. [Google Scholar] [CrossRef] [Scilit]
- Guo, J.N. Flavonoids Biosynthesis Pathway and Key Genes Function Analysis in Meconopsis horridula at Different Altitudes. Master’s Thesis, Tibet University, Tibet, China, 20 May 2023. [Google Scholar]
- Ma, J.; Cheng, T.L.; Sun, C.Y.; Deng, N.; Shi, S.Q.; Jiang, Z.P. Characterization of transcriptome reveals pathway of flavonoids in Ephedra sinica Stapf. Acta Agric. Zhejiangensis 2016, 28, 609–617. [Google Scholar]
- Zou, Y.H.; Liu, C.Y.; Lin, Z.Y.; Li, Z. Transcriptome sequencing and flavonoid biosynthesis related genes of Scutellaria barbata D. Don. Fujian J. Agric. Sci. 2018, 33, 1242–1250. [Google Scholar] [CrossRef]
- Pan, Y.; Chen, D.X.; Song, X.H.; Li, L.Y. Transcriptome analysis reveals candidate genes involved in flavonols biosyhthesis in Sophora japonica. Chin. J. Chin. Mater. Med. 2018, 43, 2682–2689. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.A.; Meng, Z.L.; Zhang, H.Y.; Chu, Y.X.; Qiu, Y.Y.; Jin, B.A.; Wang, L. Identification and characterization of thirteen gene families involved in flavonoid biosynthesis in Ginkgo biloba. Ind. Crop. Prod. 2022, 188, 115576. [Google Scholar] [CrossRef] [Scilit]
- Ye, B.H.; Yang, Y.; Zhu, L.J.; Shi, C.G.; Chen, Y.W.; Hu, C.J.; Song, Q.Y.; Li, H.B. Analysis of genes expression involved in flavonoids biosynthesis in Polygonatum cyrtonema based on comparative transcriptome. Food Sci. Biotech. 2022, 41, 84–92. [Google Scholar] [CrossRef]
- Xiao, Y.Z.; Han, S.M.; Qin, Z.; Li, C.Q. Analysis of transcriptome sequencing and related genes of flavonoids biosynthesis from Polygonatum kingianum. J. Henan Agric. Univ. 2020, 54, 931–940. [Google Scholar] [CrossRef]
- Xu, J.Q.; Li, L.; Wang, S.B.; Ma, X.W.; Wu, H.X.; Xu, W.T.; Liang, Q.Z.; Chen, J.Z. Review of integrated metabolome and transcriptome analysis used for disclosing physiological mechanism in fruit crops. J. Fruit Sci. 2020, 37, 1413–1424. [Google Scholar] [CrossRef]
- Li, J.W.; Ma, Y.C.; Yang, X.L.; Wang, M.; Cui, S.L.; Hou, M.Y.; Liu, L.F.; Hu, M.D.; Jiang, X.X.; Mu, G.J. Transcriptomics-metabolomics combined analysis highlight the mechanism of testa pigment formation in peanut (Arachis hypogaea L.). J. Plant Genet. Resour. 2022, 23, 240–254. [Google Scholar] [CrossRef]
- Wang, S.; Du, Z.; Yang, X.; Wang, L.; Xia, K.; Chen, Z. An integrated analysis of metabolomics and transcriptomics reveals significant differences in floral scents and related gene expression between two Varieties of Dendrobium loddigesii. Appl. Sci. 2022, 12, 1262. [Google Scholar] [CrossRef] [Scilit]
- Chai, J.H.; Wang, X.J.; Yi, C.; Zhou, J.B.; Liu, D.; Zhao, N.; He, T.T. Transcriptome analysis of Polygonatum sibiricum and identification of putative genes involved in main secondary metabolism pathway. Mol. Plant Breed. 2023, 1–12. [Google Scholar]
- Xu, F.; Liang, Z.S.; Han, R.L. Research progress of flavonoids in Tetrastigma hemsleyanum Diels et Gilg and their pharmacological activities. Genomics Appl. Biol. 2021, 40, 3704–3716. [Google Scholar] [CrossRef]
- Ren, L.C.C.; Liu, Z.H.; Dong, Q.; Wang, H.L.; Hu, N. Recent progress on the flavonoid components and pharmacological effects of Hippophae rhamnoides L. Chin. J. Med. Chem. 2023, 33, 598–617. [Google Scholar] [CrossRef]
- Li, B.J.; Yang, Y.G.; Song, Z.X.; Tang, Z.S. Research progress of flavonoids in Ziziphi Spinosae Semen. Cent. South Pharm. 2023, 21, 2690–2697. [Google Scholar]
- Gao, J.F.; Zhou, W.; Liu, N.; Yang, Y. Analysis of flavonoids in different tissues of Kadsura coccinea plant by widely-targeted metabolomics. Guihaia 2022, 42, 1193–1203. [Google Scholar] [CrossRef]
- Jiang, S.; Wan, L.; Xu, Z.X.; Yan, J.J.; Zheng, C.N. Research progress on flavonoids of Cannabis sativa L. Chin. Agric. Sci. Bull. 2021, 37, 120–128. [Google Scholar] [CrossRef]
- Zhao, H.Y.; Luo, Y.; Deng, X.K.; Gao, P. The main chemical constituents and antioxidant activities of Polygonatum cyrtonema Hua. J. Anhui Agric. Univ. 2020, 47, 793–797. [Google Scholar] [CrossRef]
- Li, H.M.; Gao, Y.; Shao, X.F.; Qin, J.K.; Wu, Y.C.; Zhao, M. Study on total flavonoids content and comparison of antioxidant activity in different parts of Bupleurum chinense DC. from different provenances. Chin. Food Addit. 2022, 33, 211–217. [Google Scholar] [CrossRef]
- Zhang, C.W.; Guo, J.Q.; Li, W.P.; Luo, Y.J.; Yao, Y.; Xu, C.Q.; Shen, G.A.; Suo, F.M.; Guo, B.L. Content correlation of eight phenolic acids and flavonoids in different medicinal parts of PA-type Perilla germplasms. Chin. J. Chin. Mater. Med. 2022, 47, 3447–3451. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, K. Comparison of total flavonoids content in different parts of Sea buckthorn. Heilongjiang Agric. Sci. 2022, 3, 64–67. [Google Scholar] [CrossRef]
- Lou, G.G.; Xia, J.; Yang, J.; Wang, H.P.; Liang, Z.S.; Xiao, Y.; Li, Z.D.; Zhang, Y.; Liu, Z.C.; Shi, W.L.; et al. Differences in the chemical composition of Dendrobium officinale Kimura et Migo and Dendrobium crepidatum Lindl based on UPLC-O-TOF-MS/MS and metabolomics. Acta Pharm. Sin. 2021, 56, 3331–3344. [Google Scholar] [CrossRef]
- Huang, J.; Wang, L.Y.; Tang, B.; Ren, R.R.; Shi, T.X.; Zhu, L.W.; Deng, J.; Liang, C.G.; Wang, Y.; Chen, Q.F. Integrated transcriptomics and widely targeted metabolomics analyses provide insights into flavonoid biosynthesis in the rhizomes of Golden Buckwheat (Fagopyrum cymosum). Front. Plant Sci. 2022, 13, 803472. [Google Scholar] [CrossRef] [Scilit]
- Huang, W.J.; Xiong, L.W.; Zhang, L.F.; Zhang, F.; Han, X.Y.; Zhang, Y.Q.; Zhang, L.; Yang, H.B. Study on content variation of flavonoids in different germplasm during development of Lonicerae Japonicae Flos. Chin. Tradi. Herb. Drugs 2022, 53, 3156–3164. [Google Scholar] [CrossRef]
- Wang, Y.C.; Liu, F.; Liang, Z.S.; Peng, L.; Wang, B.Q.; Yu, J.; Su, Y.Y.; Ma, C.D. Homoisoflavonoids and the antioxidant activity of Ophiopogon japonicus root. Iran J. Pharm. Res. 2017, 16, 357–365. [Google Scholar]
- Lin, L.G.; Liu, Q.Y.; Ye, Y. Naturally occurring homoisoflavonoids and their pharmacological activities. Planta Med. 2014, 80, 1053–1066. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.F.; Mu, T.H.; Chen, J.J.; Luo, S.D. Study on the chemical constituents of Polygonatum kingianum. China J. Chin. Mater. Med. 2003, 28, 524–527. [Google Scholar] [CrossRef]
- Liu, S.; Hu, S.T.; Jia, Q.J.; Liang, Z.S. Advances in chemical constituents and pharmacological effects of Polygonati Rhizoma. Nat. Prod. Res. Dev. 2021, 33, 1783–1796. [Google Scholar] [CrossRef]
- Yang, S.Y.; Song, J.Z.; Yang, S.J.; Li, J.Y.; Jiang, H.M.; Sui, F.Q.; Li, L.J. Research progress on pharmacological action and new dosage forms of rutin. Chin. J. Mod. Appl. Pharm. 2022, 39, 1360–1370. [Google Scholar] [CrossRef]
- Patel, D.K. Medicinal importance, pharmacological activities and analytical aspects of a flavonoid glycoside ‘Nicotiflorin’ in the medicine. Drug Metab. Bioanal. Lett. 2022, 15, 2–11. [Google Scholar] [CrossRef] [Scilit]
- Yuan, L.; Wang, X.; Li, Q.S.; Deng, H.; Li, J.K. Research progress of natural flavone isoorientin. Chin. J. Food Biotech. 2019, 39, 21–27. [Google Scholar] [CrossRef]
- Zheng, B.S.; Yang, W.H.; Xu, Q.X.; Liu, R.H. Antitumor activity of ferulic acid and its colonic metabolites. J. South China Univ. Technol. (Nat. Sci.) 2022, 50, 30–40. [Google Scholar]
- Zhang, H.B. Effects of sinapic acid on oxidative stress and mitochondrial function in skeletal muscles of rats with exercise injury. Mol. Plant Breed. 2023, 21, 8227–8233. [Google Scholar] [CrossRef]
- Shen, Y.J.; Hao, Y.Y.; Yang, J.Q. Observation of efficacy on supramolecular salicylic acid combined with doxycycline in treatment of moderate to severe acne. Int. J. Biomed. Eng. 2023, 38, 188–191. [Google Scholar] [CrossRef]
- He, X.; Fan, R.F.; Su, L.J.; Kang, X. Plant resource distribution and pharmacological action of orientin. J. Liaoning Univ. Tradi. Chin. Med. 2020, 22, 176–181. [Google Scholar] [CrossRef]
- Wang, L.; Yang, W.; Yao, Q.; Chen, J.; Hu, C.; Xia, Y.; Dong, X.P.; Shi, Q.; Chen, Z.B.; Chen, C. Inhibitory effect on PrPsc deposition and cell protection of vanillic acid in prion-infected cells. Chin. J. Virol. 2022, 38, 896–904. [Google Scholar] [CrossRef]
- Han, T.T. Research on the Mechanism about Narcissoside Relieves Insulin Resistance. Master’s Thesis, Liaoning University, Shenyang, China, 1 May 2023. [Google Scholar]
- Guo, T.T. Study on the Mechanism of Vanillin’s Preprotective Effect on LPS Induced Acute Lung Injury. Ph.D. Thesis, Jilin University, Changchun, China, 1 June 2020. [Google Scholar] [CrossRef]
- Glagoleva, A.Y.; Vikhorev, A.V.; Shmakov, N.A.; Morozov, S.V.; Chernyak, E.I.; Vasiliev, G.V.; Shatskaya, N.V.; Khlestkina, E.K.; Shoeva, O.Y. Features of activity of the phenylpropanoid biosynthesis pathway in melanin-accumulating Barley Grains. Front. Plant Sci. 2022, 3, 923717. [Google Scholar] [CrossRef] [Scilit]
- Shan, T.Y.; Xu, J.Y.; Zhong, X.X.; Zhang, J.J.; He, B.; Tao, Y.J.; Wu, J.W. Full-length transcriptome sequencing provides new insights into the complexity of flavonoid biosynthesis in Glechoma longituba. Physiol. Plant 2023, 175, e14104. [Google Scholar] [CrossRef] [Scilit]
- Wu, X.; Wang, C.K.; Zuo, H.Y.; Chen, Z.H.; Wu, S.B.; Zhou, M.Q. Identification of potential genes involved in biosynthesis of flavonoid and analysis of biosynthetic pathway in Fagopyrum dibotrys. Chin. J. Chin. Mater. Med. 2021, 46, 1084–1093. [Google Scholar] [CrossRef]
- Deshmukh, A.B.; Datir, S.S.; Bhonde, Y.; Kelkar, N.; Samdani, P.; Tamhane, V.A. De novo root transcriptome of a medicinally important rare tree Oroxylum indicum for characterization of the flavonoid biosynthesis pathway. Phytochemistry 2018, 156, 201–213. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Tan, F.Y.; Zhang, L.P.; He, Y.F.; Fan, J.H.; Li, W.; Peng, S.J.; Qiu, Q.H. Characteristic analysis of Polygonatum Sibiricum transcriptome and study of related functional genes. J. Sichuan Norm. Univ. (Nat. Sci.) 2022, 45, 103–109. [Google Scholar] [CrossRef]
- Yang, Z.Y.; Jiang, X.H. Cloning and sequence analysis of the LjFNS gene of honeysuckle flavonoid synthase. Jiangsu Agric. Sci. 2018, 46, 47–50. [Google Scholar] [CrossRef]
- Nong, Q.; Malviya, M.K.; Solanki, M.K.; Lin, L.; Xie, J.L.; Mo, Z.H.; Wang, Z.P.; Song, X.P.; Huang, X.; Li, C.N.; et al. Integrated metabolomic and transcriptomic study unveils the gene regulatory mechanisms of sugarcane growth promotion during interaction with an endophytic nitrogen-fixing bacteria. Plant Biol. 2023, 23, 54. [Google Scholar] [CrossRef] [Scilit]
- Kianersi, F.; Abdollahi, M.R.; Mirzaie-asl, A.; Dastan, D.; Rasheed, F. Identification and tissue-specific expression of rutin biosynthetic pathway genes in Capparis spinosa elicited with salicylic acid and methyl jasmonate. Sci. Rep. 2020, 10, 8884. [Google Scholar] [CrossRef] [Scilit]
- Rojas Rodas, F.; Rodriguez, T.O.; Murai, Y.; Iwashina, T.; Sugawara, S.; Suzuki, M.; Nakabayashi, R.; Yonekura-Sakakibara, K.; Saito, K.; Kitajima, J.; et al. Linkage mapping, molecular cloning and functional analysis of soybean gene Fg2 encoding flavonol 3-O-glucoside (1→6) rhamnosyltransferase. Plant Mol. Biol. 2014, 84, 287–300. [Google Scholar] [CrossRef] [Scilit]
- Yuan, Z.N.; Dong, F.; Pang, Z.Q.; Fallah, N.; Zhou, Y.M.; Li, Z.; Hu, C.H. Integrated metabolomics and transcriptome analyses unveil pathways involved in sugar content and rind color of two sugarcane varieties. Front. Plant Sci. 2022, 13, 921536. [Google Scholar] [CrossRef] [Scilit]
- Yan, H.L.; Zhang, X.X.; Li, X.; Wang, X.L.; Li, H.X.; Zhao, Q.S.; Yin, P.; Guo, R.X.; Pei, X.N.; Hu, X.Q.; et al. Integrated transcriptome and metabolome analyses reveal the anthocyanin biosynthesis pathway in AmRosea1 overexpression 84K poplar. Front. Bioeng. Biotechnol. 2022, 10, 911701. [Google Scholar] [CrossRef] [Scilit]
- Yin, D.J.; Ye, S.J.; Sun, X.Y.; Chen, Q.Y.; Min, T.; Wang, H.X.; Wang, L.M. Integrative analysis of the transcriptome and metabolome reveals genes involved in phenylpropanoid and flavonoid biosynthesis in the Trapa bispinosa Roxb. Front. Plant Sci. 2022, 13, 913265. [Google Scholar] [CrossRef] [Scilit]
- Sheng, X.L.; Chen, H.W.; Wang, J.M.; Zheng, Y.L.; Li, Y.L.; Jin, Z.X.; Li, J.M. Joint transcriptomic and metabolic analysis of flavonoids in Cyclocarya paliurus leaves. ACS Omega 2021, 6, 9028–9038. [Google Scholar] [CrossRef] [Scilit]
- Liu, C.; Feng, T.T.; Liu, X.W.; Ding, J.X.; Shi, H.; Pan, J.; Zhou, Y. Transcriptome analysis and identification of related genes involved in secondary metabolism biosynthesis in Ardisia crispa. Chin. Tradi. Herb. Drugs 2021, 52, 1434–1447. [Google Scholar]
- Zhang, K.M.; Geng, G.G.; Qiao, F. Correlation analysis of enzyme activities, gene expression and flavonoid accumulation during fruit development in Lycium barbarum. Mol. Plant Breed. 2023, 1–13. [Google Scholar]
- Kang, Y.L.; Pei, J.; Cai, W.L.; Liu, W.; Luo, J.; Wu, Q.H. Research progress on flavonoid metabolic synthesis pathway and related function genes in medicinal plants. Chin. Tradi. Herb. Drugs 2014, 45, 336–1341. [Google Scholar]
- Su, J.M.; Peng, T.H.; Bai, M.; Bai, H.Y.; Li, H.S.; Pan, H.M.; He, H.J.; Liu, H.; Wu, H. Transcriptome and metabolome analyses provide insights into the flavonoid accumulation in peels of Citrus reticulata ‘Chachi’. Molecules 2022, 27, 6476. [Google Scholar] [CrossRef] [Scilit]
- Pu, Y.T.; Wang, C.; Jiang, Y.W.; Wang, X.J.; Ai, Y.J.; Zhuang, W.B. Metabolic profiling and transcriptome analysis provide insights into the accumulation of flavonoids in chayote fruit during storage. Front. Nutr. 2023, 10, 1029745. [Google Scholar] [CrossRef] [Scilit]
- Dick, C.A.; Buenrostro, J.; Butler, T.; Carlson, M.L.; Kliebenstein, D.J.; Whittall, J.B. Arctic mustard flower color polymorphism controlled by petal-specific down regulation at the threshold of the anthocyanin biosynthetic pathway. PLoS ONE 2011, 6, e18230. [Google Scholar] [CrossRef] [Scilit]
- Peng, J. Study on the Sex Differentiation of Flavonoids Content and Key Genes Screening in Wild Gender Broussonetia papyrifera Leaves under Heavy Metal Stress. Ph.D. Thesis, CSUFT, Changsha, China, 1 June 2022. [Google Scholar] [CrossRef]
- Wang, Y.J.; Li, H.H.; Fu, W.Y.; Gao, Y.; Wang, B.J.; Li, L. Flavonoids contents and expression analysis of related genes in red cell line of Saussurea medusa. Chin. J. Biotechnol. 2014, 30, 1225–1234. [Google Scholar] [CrossRef]
- Zhou, P.N.; Wan, Q.Y.; Zhang, X.Q.; Gong, L. Cloning and bioinformatics analysis of LAR gene from Ampelopsis megalophylla. Genomics Appl. Biol. 2019, 38, 3654–3660. [Google Scholar] [CrossRef]
- Li, X. Study on the Dynamic Changes of Flavonoids in Jujube Fruits and the Function of Related Genes. Master’s Thesis, Northwest Sci-Tech University Agriculture, Xianyang, China, 1 May 2020. [Google Scholar] [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114. [Google Scholar] [CrossRef] [Scilit]
- Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.; et al. Trinity: Reconstructing a full-length transcriptome without a genome from RNA-Seq data. Nat. Biotechnol. 2011, 29, 644–652. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Xu, S.; Qu, Z.Y.; Bi, J.L.; Li, T.T.; Gan, X.F.; Wei, G.L.; Du, J.F.; He, M.; Fan, B.L. Optimization of extraction by BP-ANN and determination of flavonoids in three varieties of polygonati rhizoma before and after irradiation by HPLC chromatographic fingerprint. Sci. Technol. Food Ind. 2021, 42, 257–264. [Google Scholar] [CrossRef]
- Jiang, L.Y.; Wu, P. Research progress on functional components and deep processing of Rhizoma polygonati. China Fruit Veg. 2022, 42, 14–20. [Google Scholar] [CrossRef]
- Wang, S.; Wang, L.L.; Fang, J.J.; Liu, K.L.; Wang, Y.Z.; Zhang, C. Correlation analysis between color and content changes of five components of wine-processed Polygonatum kingianum Rhizoma during processing. Chin. J. Exp. Tradit. Med. Form. 2022, 28, 56–162. [Google Scholar] [CrossRef]
- Liang, Z.H.; Pan, Y.J.; Qiu, L.Y.; Wu, X.Y.; Xu, X.Q.; Shu, W.Y.; Yuan, Q. Analysis on chemical components changes of Polygonati Rhizoma in processing of nine times steaming and nine times sunning by UPLC-O-TOF-MS/MS. Chin. Tradi. Herb. Drugs 2022, 53, 4948–4957. [Google Scholar] [CrossRef]
- Zhang, K. Comparative Study on Chemical Constituents of Plant from Polygonum. Master’s Thesis, Peking Union Medical College, Beijing, China, 1 June 2022. [Google Scholar] [CrossRef]
- Xu, J.X.; Liu, L.; Yang, S.X.; Kuang, Y. Chemical constituents from aerial part of Polygonatum cyrtonema. Chin. Tradi. Herb. Drugs 2016, 47, 3569–3572. [Google Scholar] [CrossRef]
- Song, Y.J.; Guo, T.; Wang, R.J.; Cui, C.L.; Aili, Y.E.; Qu, J.Q.; Xu, C. Effects of compatibility of different prepared products of Polygonati Rhizoma on the contents of six components in Huangjing pills. West China J. Pharm. Sci. 2019, 38, 75–78. [Google Scholar] [CrossRef]






| Tissues | Types of Metabolites | Number of Metabolites | Content of Metabolites (μg/g) |
|---|---|---|---|
| Leaf | Flavonols (11), Flavones (8), Flavanones (3), Dihydrochalcones (3), Isoflavones (1), Flavanol (1), Benzoic acid derivatives (9), Phenylpropanoids (6), Coumarins (4), Phenolic acids (2) | 48 | 767.1181 |
| Stem | Flavonols (8), Flavones (6), Flavanones (1), Dihydrochalcones (1), Anthocyanins (2), Isoflavones (1), Benzoic acid derivatives (7), Phenylpropanoids (6), Coumarins (3), Phenolic acids (2), Terpenoids (1) | 38 | 550.0510 |
| Rhizome | Flavonols (6), Flavones (8), Flavanones (2), Anthocyanins (1), Isoflavones 1), Benzoic acid derivatives (7), Phenylpropanoids (3) | 28 | 1.7974 |
| Root | Flavonols (9), Flavones (7), Flavanones (3), Dihydrochalcones (2), Anthocyanins (1), Isoflavones (2), Benzoic acid derivatives (9), Phenylpropanoids (4), Coumarins (1), Phenolic acids (2), Terpenoids (1) | 41 | 9.2970 |
| Metabolites | Class | KEGG ID | ID Annotation | Annotation |
|---|---|---|---|---|
| Astragalin | Flavonols | C12249 | ath00944 | Flavone and flavonol biosynthesis |
| Rutin | Flavonols | C05625 | ath00944 | Flavone and flavonol biosynthesis |
| Kaempferol | Flavonols | C05903 | ath00941; ath00944 | Flavonoid biosynthesis; Flavone and flavonol biosynthesis |
| Quercitrin | Flavonols | C01750 | ath00944 | Flavone and flavonol biosynthesis |
| Myricetin | Flavonols | C10107 | ath00941; ath00944 | Flavonoid biosynthesis; Flavone and flavonol biosynthesis |
| Quercetin | Flavones | C00389 | ath00941; ath00944 | Flavonoid biosynthesis; Flavone and flavonol biosynthesis |
| Luteolin | Flavones | C01514 | ath00941; ath00944 | Flavonoid biosynthesis; Flavone and flavonol biosynthesis |
| Cosmosiin | Flavones | C04608 | ath00944 | Flavone and flavonol biosynthesis |
| Naringenin | Flavanones | C00509 | ath00941 | Flavonoid biosynthesis |
| Naringin | Flavanones | C09789 | ath00941 | Flavonoid biosynthesis |
| Phlorizin | Dihydrochalcones | C01604 | ath00941 | Flavonoid biosynthesis |
| Phloretin | Dihydrochalcones | C00774 | ath00941 | Flavonoid biosynthesis |
| Catechin | Flavanols | C06562 | ath00941 | Flavonoid biosynthesis |
| 4-Hydroxycinnamic acid | Phenylpropanoids | C00811 | ath00940; ath00130; ath00998; ath00950; ath00350 | Phenylpropanoid biosynthesis; Ubiquinone and other terpenoid-quinone biosynthesis; Biosynthesis of various secondary metabolites-part 2; Isoquinoline alkaloid biosynthesis; Tyrosine metabolism |
| Chlorogenic acid | Phenylpropanoids | C00852 | ath00941; ath00940; ath00945 | Flavonoid biosynthesis; Phenylpropanoid biosynthesis; Stilbenoid, diarylheptanoid and gingerol biosynthesis |
| Coniferaldehyde | Phenylpropanoids | C02666 | ath00940 | Phenylpropanoid biosynthesis |
| Ferulic acid | Phenylpropanoids | C01494 | ath00940 | Phenylpropanoid biosynthesis |
| Sinapic acid | Phenylpropanoids | C00482 | ath00940 | Phenylpropanoid biosynthesis |
| Umbelliferone | Coumarins | C09315 | ath00940 | Phenylpropanoid biosynthesis |
| Number | Abbreviation | Name | Unigene Quantity | EC | Pathway | Source |
|---|---|---|---|---|---|---|
| 1 | — | Peroxidase | 60 | 1.11.1.7 | Ko00940 | P. kingianum [41] |
| 2 | Bgl | Beta-glucosidase | 34 | 3.2.1.21 | Ko00940 | P. kingianum [41] |
| 3 | katG | Catalase-peroxidase | 21 | 1.11.1.21 | Ko00940 | |
| 4 | TOGT1 | Scopoletin glucosyltransferase | 16 | 2.4.1.128 | Ko00940 | |
| 5 | HCT | Shikimate O-hydroxycinnamoyltransferase | 12 | 2.3.1.133 | Ko00940 Ko00941 | P. kingianum [41] P. cyrtonema [36] |
| 6 | CAD | Cinnamyl-alcohol dehydrogenase | 11 | 1.1.1.195 | Ko00940 | P. kingianum [41] |
| 7 | 4CL | 4-coumarate-CoA ligase | 10 | 6.2.1.12 | Ko00940 | P. kingianum [41] P. cyrtonema [36] |
| 8 | CCOMT | Caffeoyl-CoA O-methyltransferase | 5 | 2.1.1.104 | Ko00940 Ko00941 | P. kingianum [37,41] P. cyrtonema [36] |
| 9 | CYP73A(C4H) | Trans-cinnamate 4-monooxygenase | 5 | 1.14.14.91 | Ko00940 Ko00941 | P. kingianum [37,41] P. cyrtonema [36] |
| 10 | CCR | Cinnamoyl-CoA reductase | 4 | 1.2.1.44 | Ko00940 | P. kingianum [41] |
| 11 | PAL | Phenylalanine ammonia-lyase | 4 | 4.3.1.24 | Ko00940 | P. kingianum [41] P. cyrtonema [36] |
| 12 | REF1 | Coniferyl-aldehyde dehydrogenase | 4 | 1.2.1.68 | Ko00940 | P. kingianum [41] |
| 13 | COMT | Caffeic acid 3-O-methyltransferase | 4 | 2.1.1.68 | Ko00940 | P. kingianum [41] P. cyrtonema [36] |
| 14 | C3′H | 5-O-(4-coumaroyl)-d-quinate 3′-monooxygenase | 2 | 1.14.14.96 | Ko00940 Ko00941 | P. kingianum [37] P. cyrtonema [36] |
| 15 | CSE | Caffeoylshikimate esterase | 1 | 3.1.1.- | Ko00940 | |
| 16 | PRDX6 | Peroxiredoxin 6, 1-Cys peroxiredoxin | 1 | 1.11.1.7 | Ko00940 | |
| 17 | CHI | Chalcone isomerase | 4 | 5.5.1.6 | Ko00941 | P. kingianum [37,41] P. cyrtonema [36] |
| 18 | PGT1 | Phlorizin synthase | 4 | 2.4.1.357 | Ko00941 | |
| 19 | FLS | Flavonol synthase | 2 | 1.14.20.6 | Ko00941 | P. kingianum [37] P. cyrtonema [36] |
| 20 | F3′H | Flavonoid 3′-monooxygenase | 2 | 1.14.14.82 | Ko00941 Ko00944 | P. kingianum [37] P. cyrtonema [36] |
| 21 | CHS | Chalcone synthase | 6 | 2.3.1.74 | Ko00941 | P. kingianum [37,41] P. cyrtonema [36] |
| 22 | ANR | Anthocyanidin reductase | 1 | 1.3.1.77 | Ko00941 | P. kingianum [37] |
| 23 | FNS | Flavone synthase II | 1 | 1.14.19.76 | Ko00941 | |
| 24 | F3H | Naringenin 3-dioxygenase | 1 | 1.14.11.9 | Ko00941 | P. cyrtonema [36] |
| 25 | DFR | Bifunctional dihydroflavonol 4-reductase | 2 | 1.1.1.219 | Ko00941 | P. kingianum [37] P. cyrtonema [36] |
| 26 | LAR | Leucoanthocyanidin reductase | 1 | 1.17.1.3 | Ko00941 | P. kingianum [37] P. cyrtonema [36] |
| 27 | UGT73C6 | Flavonol-3-O-l-rhamnoside-7-O-glucosyltransferase | 3 | 2.4.1.- | Ko00944 | P. cyrtonema [37] |
| 28 | FG2 | Flavonol-3-O-glucoside l-rhamnosyltransferase | 1 | 2.4.1.159 | Ko00944 |
| Gene Name | ForwardPrimer Sequence (5′-3′) | ReversePrimer Sequence (5′-3′) |
| 18srRNA | CGAGTCTATAGCCTTGGCCG | ATCCGAACACTTCACCGGAC |
| PAL3 | AACGGAAATGGAGTGCACGG | GATATCTTCAGATCCGCTCCCC |
| C4H2 | ACCCTCGAGTCCAAGAAAGG | CTCAGCCTCTTCCAGGTTCA |
| CHS1 | GTAGGCCTGACTTTCCACCT | CCTCCACCTGGTCCAGTATC |
| CHS4 | ATCGAACATACCGGAGGCAT | TTCCTCAGCACTTGTCTCGT |
| CHS5 | CCGCTAAGGATCTTGCTGAG | CAATGGACGCTCGATAGCAA |
| CHI1 | CAGTCTCAGCAACCAAGCTC | GATGCCGATGGCAGTAAAGG |
| F3H | ACTGCACCAGAGCTAGTGTT | ACACGTTGTAGGCCACCTTA |
| DFR1 | CACCGATCCTGAGAACGAGA | CTCCAGCAGCTCTCATCGTA |
| LAR | GTCCAGGGTCTTGTTACGGA | GCCTTGTCGATGTCATGTCC |
| ANR | TGCTCAAGAAGGGCTATGCT | ACTGGTGTAGCGACATGGAA |
| FNS | GTGTGATTTTGGACTTTTT | CGTCTTCTATTTCTTGTTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, L.; Yang, Q.; Zhang, L.; Ren, F.; Zhang, Z.; Jia, Q. Integrated Metabolomics and Transcriptomics Analysis of Flavonoid Biosynthesis Pathway in Polygonatum cyrtonema Hua. Molecules 2024, 29, 2248. https://doi.org/10.3390/molecules29102248
Yang L, Yang Q, Zhang L, Ren F, Zhang Z, Jia Q. Integrated Metabolomics and Transcriptomics Analysis of Flavonoid Biosynthesis Pathway in Polygonatum cyrtonema Hua. Molecules. 2024; 29(10):2248. https://doi.org/10.3390/molecules29102248
Chicago/Turabian StyleYang, Luyun, Qingwen Yang, Luping Zhang, Fengxiao Ren, Zhouyao Zhang, and Qiaojun Jia. 2024. "Integrated Metabolomics and Transcriptomics Analysis of Flavonoid Biosynthesis Pathway in Polygonatum cyrtonema Hua" Molecules 29, no. 10: 2248. https://doi.org/10.3390/molecules29102248
APA StyleYang, L., Yang, Q., Zhang, L., Ren, F., Zhang, Z., & Jia, Q. (2024). Integrated Metabolomics and Transcriptomics Analysis of Flavonoid Biosynthesis Pathway in Polygonatum cyrtonema Hua. Molecules, 29(10), 2248. https://doi.org/10.3390/molecules29102248

