Next Article in Journal
Molecular Mechanisms of Cardiotoxicity Induced by ErbB Receptor Inhibitor Cancer Therapeutics
Previous Article in Journal
Visible Light-Induced Degradation of Methylene Blue in the Presence of Photocatalytic ZnS and CdS Nanoparticles
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of 22 Polymorphic Microsatellite Loci for the Critically Endangered Morato’s Digger Toad, Proceratophrys moratoi

by
Maurício Papa Arruda
1,*,
William Pinheiro Costa
2,
Carla Cristina Silva
3 and
Shirlei Maria Recco Pimentel
1
1
Department of Structural and Functional Biology, Institute of Biology, University of Campinas-UNICAMP, Campinas, SP, CEP 13083-863, Brazil
2
Department of Zoology, Institute of Biosciences, State University of São Paulo-UNESP, Botucatu, SP, CEP 18618-970, Brazil
3
Center for Molecular Biology and Genetic Engineering, Institute of Biology, University of Campinas-NICAMP, Campinas, SP, CEP 13083-875, Brazil
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2012, 13(10), 12259-12267; https://doi.org/10.3390/ijms131012259
Submission received: 22 August 2012 / Revised: 29 August 2012 / Accepted: 3 September 2012 / Published: 25 September 2012
(This article belongs to the Section Biochemistry)

Abstract

The Morato’s digger toad (Proceratophrys moratoi) inhabits Brazilian moist savannas and is critically endangered due to its very limited geographic distribution, reduced number of isolated populations, and evidence of population decline and local extinctions. With the objective of providing tools for the genetic study of the species, 22 polymorphic microsatellite loci were isolated and screened using DNA extracted from samples of oral mucosa cells obtained from 113 individuals representing five remnant P. moratoi populations in the Brazilian state of São Paulo. These markers presented 2–18 alleles per locus, polymorphism information content (PIC) of 0.02–0.87, observed heterozygosity of 0.02–0.96 and expected heterozygosity of 0.02–0.87. Three of the loci deviated significantly from Hardy–Weinberg equilibrium in one of the populations, possibly due to the presence of null alleles. Significant linkage disequilibrium was also detected between three pairs of loci. The molecular markers developed in this study were able to discriminate each of the individuals sampled (identity analysis). This means that they will be extremely useful for future genetic studies applied to the conservation of P. moratoi, providing a baseline for estimating the levels of genetic diversity, pedigrees, inbreeding, and population structure, which will be essential for the development of effective genetic management programs.

1. Introduction

The class Amphibia has experienced a major global decline in recent decades, becoming more endangered than birds and mammals, due to a combination of factors [1]. Habitat destruction, climate change and infectious diseases are considered to be the primary cause of the decline of this group [2,3]. Ongoing anthropogenic impacts have contributed to the increasing deterioration of landscapes, which not only modifies aquatic and terrestrial habitats, but also reduces their connectivity, which are all factors that may affect amphibian populations adversely [4,5].
Proceratophrys moratoi is a digger toad of small size, typically with a snout-vent length of no more than 35 mm, which is endemic to the Cerrado savanna of the Brazilian state of São Paulo [6]. The species is found in campo sujo habitats (grassland dotted with small shrubs), invariably near the gallery forests associated with the headwaters of streams [6,7]. In São Paulo, the Cerrado biome has been modified intensively in recent decades, primarily for the planting of commercial crops such as sugarcane, but also for cattle ranching and urban development [8]. Currently, only about 6% of the original cover remains [9], which has drastically reduced the availability of potential habitat for the endemic P. moratoi. Due to its very restricted geographic distribution and the evidence of population decline and local extinctions [7,10], the species is currently listed as critically endangered by the International Union for Conservation of Nature [11], and is included in the official lists of endangered species of Brazil [12] and São Paulo [13].
The available genetic studies of P. moratoi include molecular analyses of mitochondrial and nuclear genes [14] and cytogenetics [15]. However, no population-level data—which may be essential for the development of effective management strategies—are available, due to the lack of appropriate molecular markers. In order to contribute to the development of these strategies, we have developed the first set of microsatellite markers for P. moratoi.

2. Results and Discussion

2.1. Characterization of the Enriched Microsatellite Library

A total of 384 clones were isolated and sequenced bidirectionally. The Codoncode Aligner 3.7.1 software (CodonCode Corporation: Centerville, MA, USA) revealed a redundancy of 17% in the library. Of the unique clones selected for analysis in Microsatellite Repeats Finder [16], 176 (46%) had at least one microsatellite. A predominance of dinucleotide repeats (56%) was found in the motifs that make up the library. The CAN/GTN repeats (130 motifs identified) were the most numerous, followed by CTN/GAN (48 motifs). This predominance of CAN/GTN repeats is typical of the eukaryote genome [17]. Considerable numbers of other types of motifs were also recorded, in particular the dinucleotide ATN/TAN (36 motifs), the trinucleotides CATN/GTAN (18 motifs), CTTN/GAAN (17), AATN/TTAN and CTCN/GAGN (6 motifs each), and the tetranucleotides CTATN/GATAN (13 motifs) and CATTN/GTAAN (6 motifs). These data provide a baseline that will support the development of additional probes for the isolation of new microsatellites in P. moratoi.

2.2. Development of Polymorphic Microsatellite Markers

A total of 29 pairs of primers were designed and optimized successfully for the PCR amplification of microsatellite loci (Table 1). Of the loci analyzed, Pmoratoiμ1 presented several nonspecific amplifications even after optimization (with varying concentrations of magnesium chloride and different annealing temperatures) and was excluded. Six loci—Pmoratoiμ2, Pmoratoiμ3, Pmoratoiμ4, Pmoratoiμ9, Pmoratoiμ20, and Pmoratoiμ22—were monomorphic. With the exception of Pmoratoiμ22, all these monomorphic loci represent interrupted or interrupted compound microsatellites characterized by a small number of repetitions, with predictably low polymorphism [18]. Twenty-two microsatellites were polymorphic (Table 2) in at least some populations (Pmoratoiμ7, Pmoratoiμ8, Pmoratoiμ10, Pmoratoiμ11, Pmoratoiμ14, Pmoratoiμ17, Pmoratoiμ18, and Pmoratoiμ21). The Pmoratoiμ5 locus was not amplified in some populations, possibly due to local mutations in the primer annealing site. The identity analysis calculated using Cervus 3.0.3 [19] detected four pairs of specimens with identical genotypes (exact match), suggesting the recapture of the same animal during fieldwork. In these cases, the duplicate genotype was excluded from the analyses.
The total number of alleles per locus (NA) varied between 2 and 18 (Table 2). Observed heterozygosity (HO) ranged from 0.02 to 0.96, expected heterozygosity (HE) from 0.02 to 0.87, and polymorphism information content (PIC) from 0.02 to 0.87. As might be expected from the relatively large number of markers developed for this study, evidence of linkage disequilibrium was found in three pairs of loci (Pmoratoiμ10-Pmoratoiμ25, Pmoratoiμ12-Pmoratoiμ15, and Pmoratoiμ15-Pmoratoiμ25) following Bonferroni correction (p < 0.002). Significant deviations from Hardy–Weinberg Equilibrium (HWE) were found in Pmoratoiμ24 and Pmoratoiμ27 from the São Carlos population and in Pmoratoiμ29 from Brotas, due to a deficit of heterozygotes. These deviations can be attributed to the presence of null alleles in these populations. The estimated null allele frequency for the Pmoratoiμ24 locus from São Carlos was 0.23, and that for Pmoratoiμ27 from this same population was 0.18. The estimated frequency for Pmoratoiμ29 from Brotas was 0.11.
In addition to the loci with deviations from HWE, null alleles were detected in the Pmoratoiμ13 (0.10), Pmoratoiμ23 (0.19), and Pmoratoiμ24 (0.10) loci from Bauru, and in Pmoratoiμ27 from Brotas (0.07). In all these cases, the evidence of the presence of null alleles was relatively weak and thus insufficient to confirm a significant departure from HWE following the Bonferroni correction. Micro-Checker 2.2.3 [20] did not detect small allele dominance, but found evidence of the presence of stutter bands in one locus, Pmoratoiμ13 from Bauru. The identity analysis indicated that the combination of all the loci would permit the individual identification of each of the specimens.

3. Experimental Section

3.1. Construction of Enriched Microsatellite Genomic Library

We constructed an enriched partial microsatellite genomic library using an approach based on the selective hybridization method of Kijas [21]. The library was constructed using DNA extracted from the muscle tissue of one specimen of P. moratoi using the procedure of Sambrook et al. [22] with modifications. Six micrograms of genomic DNA were digested with 50 units of Afa I (Invitrogen) and the fragments were then ligated to Rsa I linkers (Rsa21: 5′-CTCTTGCTTACGCGTGGACTA-3′/Rsa25: 5′-TAGTCCACGCGTAAGCAAGAGCACA-3′) using 2 units of T4 DNA ligase (Promega). The fragments were then amplified by polymerase chain reaction (PCR) with a reduced number of cycles (20 cycles) using the primer Rsa21. The PCR products were purified, denatured and hybridized with biotinylated microsatellite probes (GT8 and CT8) at room temperature for 20 min. The hybrid mixtures containing microsatellites were then collected by streptavidin-coated magnetic beads (Promega). The selected fragments were amplified via PCR and the products were ligated into a pGEM-T easy cloning vector (Promega). Escherichia coli XL1-Blue cells (Stratagene) were transformed with recombinant plasmids by electroporation and grown overnight in solid Luria-Bertani agar medium containing ampicillin, IPTG and X-Gal. The positive colonies were selected and grown in liquid medium with 2YT HMFM containing ampicillin. After growing for 16 h, they were stored at −80 °C.

3.2. Sequencing and Primer Design

Of the total of 596 clones obtained, 384 were sequenced bidirectionally in an ABI Prism 3100 automatic sequencer (Applied Biosystems: Foster City, CA, USA). The DNA sequences were exported into Codoncode Aligner 3.7.1 (CodonCode Corporation) which assembled the contigs and verified the redundancy of the library. The Bioedit program was used to check the quality of the sequences by chromatogram and to align them to form a consensus sequence. The repetitive elements were located using the Microsatellite Repeats Finder program [16]. After removal of the vector sequences, adapters, and restriction endonuclease sites by the Microsat software (version 1.0; CIRAD: Montpellier, France, 2005), the primers were designed using Primer 3 [23].

3.3. Genotyping

The polymorphic microsatellite markers were characterized by the amplification of the genomic DNA obtained from buccal epithelial cells (non-destructive method) following a modified version of the procedure described by Pidancier et al. [24]. Samples were obtained from five remnant P. moratoi populations in the Brazilian state of São Paulo: 41 samples were collected in the municipality of São Carlos (22°01′00.5″ S, 47°56′21.0″ W), 41 in Brotas (22°12′53″ S, 47°54′41″ W), 27 in Bauru (22°20′48.46″ S, 49°0′56″ W), 3 in Avaré (22°53.227′ S, 48°56.803′ W), and 1 in Lençóis Paulista (22°49′13.17″ S, 48°53′0.28″ W). The PCRs were prepared in a final volume of 15 μL containing 10 ng of the DNA template, 1× reaction buffer, 0.3 mM dNTP, 0.6–4.0 mM MgCl2 (Table 1), 0.6 μM of each primer, and 1 unit of Taq polymerase (Invitrogen). The reactions were conducted following the same cycling conditions: 5 min at 94 °C followed by 41 cycles of 30 s at 94 °C, 1 min at the locus-specific annealing temperature (Table 1), and 1 min at 72 °C, followed by a final extension of 30 min at 72 °C to minimize stutter bands. The PCR products were analyzed in a Dual Dedicated Height Sequencing Kit (CBS Scientific) vertical electrophoresis system in 6% denaturing polyacrylamide gel and stained with silver nitrate [25]. Allele size was estimated by comparison with a 10 bp DNA ladder (Invitrogen) and using the GelAnalyzer 2010a software [26].

3.4. Characterization of Polymorphic Markers

The levels of polymorphism of the microsatellites were evaluated as the number of alleles per locus (NA), observed (HO) and expected (HE) heterozygosity calculated by Popgene 1.32 [27]. The polymorphism information content (PIC) was calculated with Cervus 3.0.3 [19], which was also used to conduct a test of individual discrimination (identity analysis). The Genepop 4.0.9 software [28] was used to detect an excess or deficiency of heterozygotes, linkage disequilibrium between pairs of loci, and deviations from the Hardy–Weinberg Equilibrium (HWE), for which significance levels were determined using the Markov chain algorithm [29], with 10,000 dememorization steps, 100 batches and 5000 iterations per batch. All significance levels were adjusted by the sequential Bonferroni correction for multiple tests [30]. Micro-Checker 2.2.3 software [20] was used to identify genotyping errors and verify the presence of null alleles using the Brookfield method [31].

4. Conclusions

These are the first microsatellite markers developed for Morato’s digger toad, and in fact, the first for any member of the genus Proceratophrys. These markers constitute a powerful tool for the study of P. moratoi populations, allowing the identification of untagged individuals and providing a database for the development of kinship studies for future ex situ conservation programs. It will also be possible to analyze inbreeding, genetic diversity and structure, and gene flow in natural populations, which will be vital for the development of effective in situ conservation measures.

Acknowledgments

We are grateful to the Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) for financial support (FAPESP Grants 2010/06915-2 and 2010/08291-6). We also thank Luiz Carlos de Almeida Neto, director of the Bauru Botanical Garden, Instituto Florestal de São Paulo (SMA 2.60108-012.611/2010), and Duratex S.A. for permission to carry out fieldwork. The capture of specimens and transportation of saliva samples was authorized by the Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis (IBAMA N° 25538-1).

References

  1. Stuart, S.N.; Chanson, J.S.; Cox, N.A.; Young, B.E.; Rodrigues, A.S.L.; Fischman, D.L.; Waller, R.W. Status and trends of amphibian declines and extinctions worldwide. Science 2004, 306, 1783–1786. [Google Scholar]
  2. Cushman, S.A. Effects of habitat loss and fragmentation on amphibians: A review and prospectus. Biol. Conserv 2006, 128, 231–240. [Google Scholar]
  3. Hof, C.; Araújo, M.B.; Jetz, W.; Rahbek, C. Additive threats from pathogens, climate and land-use change for global amphibian diversity. Nature 2011, 480, 516–519. [Google Scholar]
  4. Semlitsch, R.D. Conservation of Pond-Breeding Amphibians. In Amphibian Conservation; Semlitsch, R.D., Ed.; Smithsonian Institution: Washington DC, USA, 2003; pp. 8–23. [Google Scholar]
  5. Denoël, M.; Ficetola, G.F. Conservation of newt guilds in an agricultural landscape of Belgium: The importance of aquatic and terrestrial habitats. Aquat. Conserv. Mar. Freshw. Ecosyst 2008, 18, 714–728. [Google Scholar]
  6. Jim, J.; Caramaschi, U. Uma nova espécie de Odontophrynus da região de Botucatu, São Paulo, Brasil (Amphibia, Anura). Rev. Bras. Biol 1980, 40, 357–360. [Google Scholar]
  7. Brasileiro, C.A.; Martins, I.A.; Jim, J. Amphibia, Anura, Cycloramphidae, Odontophrynus moratoi: Distribution extension and advertisement call. Check List 2008, 4, 382–385. [Google Scholar]
  8. Instituto Florestal de São Paulo, Inventário Florestal da Vegetação Natural do Estado de São Paulo; Secretaria do Meio Ambiente, Seção de Manejo e Inventário Florestal: São Paulo, Brazil, 2005.
  9. Secretaria de Estado do Meio Ambiente, Cerrado: Bases Para Conservação e uso Sustentável das Áreas de Cerrado do Estado de São Paulo; Secretaria do Meio Ambiente: São Paulo, Brazil, 1997.
  10. Rolim, D.C. Bioecologia de Odontophrynus moratoi (Amphibia, Anura, Cycloramphidae). Master Dissertation, State University of São Paulo—UNESP, Botucatu, SP, Brazil, February 2009. [Google Scholar]
  11. Cruz, C.A.G.; Caramaschi, U. Odontophrynus moratoi. IUCN 2010. IUCN Red List of Threatened Species. Version 2010.1. Available online: http://www.iucnredlist.org accessed on 18 March 2012.
  12. Ministério do Meio Ambiente, Livro Vermelho da Fauna Brasileira Ameaçada de Extinção, 1st ed; Ministério do Meio Ambiente: Brasília, Brazil; Fundação Biodiversitas: Belo Horizonte, Brazil, 2008; pp. 311–312.
  13. Secretaria do Meio Ambiente, Fauna Ameaçada de Extinção no Estado de São Paulo: Vertebrados, 1st ed; Secretaria do Meio Ambiente, Fundação Parque Zoológico de São Paulo: São Paulo, Brazil, 2009; pp. 331–337.
  14. Amaro, R.C.; Pavan, D.; Rodrigues, M.T. On the generic identity of Odontophrynus moratoi Jim & Caramaschi, 1980 (Anura, Cycloramphidae). Zootaxa 2009, 2071, 61–68. [Google Scholar]
  15. Soma, M.; Jim, J.; Ruiz, I.R.G.; Batistic, R.F. Determination of karyotypes and nuclear DNA content in frogs on the Family Leptodactyldiae. Biol. Gen. Exper 2006, 6, 14–23. [Google Scholar]
  16. Bikandi, J. Microsatellite Repeats Finder. 2006. Available online: http://biophp.org/minitools/microsatellite_repeats_finder/demo.php accessed on 10 March 2011.
  17. Tóth, G.; Gáspári, Z.; Jurka, J. Microsatellites in different eukaryotic genomes: Survey and analysis. Genome Res 2000, 10, 967–981. [Google Scholar]
  18. Brandstrom, M.; Ellegren, H. Genome-Wide analysis of microsatellite polymorphism circumventing the ascertainment bias. Genome Res 2008, 18, 881–887. [Google Scholar]
  19. Marshall, T.C.; Slate, J.; Kruuk, L.E.B.; Pemberton, J.M. Statistical confidence for likelihood-based paternity inference in natural populations. Mol. Ecol 1998, 7, 639–655. [Google Scholar]
  20. Oosterhout, C.V.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. Micro-Checker software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
  21. Kijas, J.M.H.; Fowler, J.C.S.; Garbett, C.A.; Thomas, M.R. Enrichment of microsatellites from the citrus genome using biotinylated oligonucleotide sequences bound to streptavidin-coated magnetic particles. Biotechniques 1994, 16, 656–662. [Google Scholar]
  22. Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning—A Laboratory Manual, 2nd ed; Cold Spring Harbor Laboratory Press: New York, NY, USA, 1989. [Google Scholar]
  23. Rozen, S.; Skaletsky, H.J. Primer 3 on the WWW for General Users and for Biologist Programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology, 1st ed; Krawetz, S., Misener, S., Eds.; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
  24. Pidancier, N.; Miguel, C.; Miaud, C. Buccal swabs as a non-destructive tissue sampling method for DNA analysis in amphibians. Herpetol. J 2003, 13, 175–178. [Google Scholar]
  25. Creste, S.; Tulmann Neto, A.; Figueira, A. Detection of simple sequence repeat polymorphism in denaturing polyacrylamide sequencing gels by silver staining. Plant. Mol. Biol. Rep 2001, 19, 299–306. [Google Scholar]
  26. Lazar, I.; Lazar, I. Gel Analyzer 2010a: Freeware 1D gel electrophoresis image analysis software. 2010. Available online: http://www.gelanalyzer.com accessed on 10 March 2011.
  27. Yeh, F.C.; Yang, R.; Boylet, T. POPGENE Version 1.32: Software Microsoft Window-Based Freeware for Population Genetic Analysis; University of Alberta: Edmonton, Canada, 1997. [Google Scholar]
  28. Rousset, F. GENEPOP’007: A complete re-implementation of the GENEPOP software for Windows and Linux. Mol. Ecol. Resour 2008, 8, 103–106. [Google Scholar]
  29. Guo, S.W.; Thompson, E.A. Performing the exact test of Hardy–Weinberg proportion for multiple alleles. Biometrics 1992, 48, 361–372. [Google Scholar]
  30. Rice, W.R. Analyzing tables of statistical tests. Evolution 1989, 43, 223–225. [Google Scholar]
  31. Brookfield, J.F.Y. A simple new method for estimating null allele frequency from heterozygote deficiency. Mol. Ecol 1996, 5, 453–456. [Google Scholar]
Table 1. Microsatellites isolated in the present study with their respective primers and the optimal amplification conditions determined following visualization of the polymerase chain reaction (PCR) products in a polyacrylamide gel.
Table 1. Microsatellites isolated in the present study with their respective primers and the optimal amplification conditions determined following visualization of the polymerase chain reaction (PCR) products in a polyacrylamide gel.
Genbank Accession n°LocusRepeat MotifPrimer Sequence (5′→3′)TAMgCl2 (mM)
JX441952Pmoratoiμ1(TTTC)9Forward: GGTGAACATCCTTTTCGTAGC50 °C0.6
Reverse: CACTCCTTCCCTAATCCAGTTT
JX441953Pmoratoiμ2(AC)4AT(AC)7 (AC)4Forward: ACACATCGTTCTGCACTACACAC63 °C1.0
Reverse: GCTCCCTTGTCTTGCTGTCT
JX441954Pmoratoiμ3(TA)8CACA CAT(AC)8Forward: CTAACCGTCCAATAGCCTGTGT63 °C0.6
Reverse: CCTCTTTCCCCTTGTGTGTCT
JX441955Pmoratoiμ4(AC)6G(CA)5Forward: AAATGAGGTGGCTGTGCTAAAT60 °C3.5
Reverse: ATGCATTAGTGGTCATCACTGG
JX441956Pmoratoiμ5(CA)8Forward: TATCTGTATTGCCTGCTCCACAC68 °C3.5
Reverse: CCTAGTGAGCTAAAAGTTGTGCTTGT
JX441957Pmoratoiμ6(ACAT)4 (AC)15Forward: CTGCACCACCCCTTGAATAA46 °C0.8
Reverse: TGCACAGCAGGATCAATCTAAC
JX441958Pmoratoiμ7(AC)8Forward: ACTTCCAGGTGCCATATCTTCA51 °C1.0
Reverse: AATTCTTGGTCTGCCATACTGTG
JX441959Pmoratoiμ8(AC)6Forward: GCGAATAATTGGAAAGCACAG68 °C3.5
Reverse: GCCTGAGCCAGAGTTGAATAGTA
JX441960Pmoratoiμ9(ATT)4…(TAT)4Forward: GATAATTGACCGTTTCCGTCAT63 °C4.0
Reverse: CATGGAACAAACTGAAGAGAACC
JX441961Pmoratoiμ10(TA)4(CA)7Forward: CTAATAAAGTGGCCGGTGAGTG50 °C0.8
Reverse: ATAGGACTACATTGTGCCCTTGA
JX441962Pmoratoiμ11(CA)8Forward: TCCAAAGTTCTAGCCTTGTTAG57 °C4.0
Reverse: CGCTACACATACCTTGAGAAA
JX441963Pmoratoiμ12(ATCT)7 (CA)5…(CA)4Forward: CCTTCCCACCTTCCCTCTC66 °C2.5
Reverse: CGATCAACCTCCTCTTCTGTCTAC
JX441964Pmoratoiμ13(CA)7Forward: CTGTTTGGACTGCGATTCTT50 °C1.0
Reverse: GCATTTGTGTGTGAGAGTGAA
JX441965Pmoratoiμ14(ACAT)8Forward: GTCAAATGAGGCGGCTGTG63 °C1.5
Reverse: GCCATTATTGCTTGTATTGCTTCAG
JX441966Pmoratoiμ15(GATA)12 (CA)8Forward: CTTTAGGGCAGTCCAAGATTA50 °C1.5
Reverse: TGAAGGGGACACATTTTAAG
JX441967Pmoratoiμ16(TCA)8Forward: CTACACTAAAACGTCTCAATCAATG66 °C2.5
Reverse: ATGATGAAGAACTGGAGGAAGA
JX441968Pmoratoiμ17(CAC)7Forward: CCCAAAGAGTGCCAAGAAAATA60 °C0.8
Reverse: GGTAACAAACAACAAACCAGTATCAAC
JX441969Pmoratoiμ18(CA)7Forward: GTGTAATCCTGGGGTTCAGGTA57 °C1.0
Reverse: TCCCACCTTGGTCAGATATTGT
JX441970Pmoratoiμ19(CA)8Forward: TATAGTCCAGGCAGCCCCTTTA68 °C1.0
Reverse: GTCCGTGAGTGACGCAAAGT
JX441971Pmoratoiμ20(CA)5AG(CA)6Forward: GATTCCCAGCAGAACATCAC63 °C0.8
Reverse: GGACTATGGAGCAATGAAAGAA
JX441972Pmoratoiμ21(CA)4…(CA)4… (CA)5…(CA)7Forward: GGGGCACAGTGTATATGTCAGT66 °C3.0
Reverse: TTGAGCTGGTGAGGCAGTT
JX441973Pmoratoiμ22(TTTC)17Forward: AAAATTCCGCTCAGTCATTA42 °C4.0
Reverse: ACTCCTTCCCTAATCCAGTTT
JX441974Pmoratoiμ23(TA)4(CA)11Forward: ACCTGGTCTAACCCTTTGGAAAT70 °C3.0
Reverse: CAGCGTTACCAGACATTTTATGTTC
JX441975Pmoratoiμ24(AT)7Forward: GCTATTTGTCTACCTATCTATCTTTCAT40 °C4.0
Reverse: CAATAAAACTCTGGACCTTGAAC
JX441976Pmoratoiμ25(ACT)11Forward: TCTAATGTCCACACTGCTACTACT70 °C4.0
Reverse: GCTAATGGCCGAGTTATTG
JX441977Pmoratoiμ26(CA)7Forward: ATTTGGCTGTCTGACCTGTCTTA63 °C4.0
Reverse: CCCATATTAGTTCGGATCACAAG
JX441978Pmoratoiμ27(TCTA)17Forward: CTCTATCTAACCCTTTCATA57 °C2.0
Reverse: AAGATGGATAGATGTGAGA
JX441979Pmoratoiμ28(CA)8Forward: GAAATGAGAGGCGTGAGAGAT51 °C1.0
Reverse: GCTGTCCGTCAATGGGTAT
JX441980Pmoratoiμ29(CA)16Forward: GAGGAAAAGTCAAGGAACTAAATGTC46 °C0.8
Reverse: ACAGTCTTCTCAATCTGCATGTCT
TA: annealing temperature; MgCl2: magnesium chloride.
Table 2. Descriptive analysis of the genetic diversity in 22 polymorphic microsatellite loci obtained from five populations of P. moratoi. Significant deviations (p < 0.002) from Hardy–Weinberg Equilibrium (HWE) following the Bonferroni correction are indicated by an asterisk (*). Heterozyogosity and HWE were not estimated for the populations with small sample size (Avaré and Lençóis Paulista).
Table 2. Descriptive analysis of the genetic diversity in 22 polymorphic microsatellite loci obtained from five populations of P. moratoi. Significant deviations (p < 0.002) from Hardy–Weinberg Equilibrium (HWE) following the Bonferroni correction are indicated by an asterisk (*). Heterozyogosity and HWE were not estimated for the populations with small sample size (Avaré and Lençóis Paulista).
Population LocusSão Carlos (n = 41)Bauru (n = 27)Brotas (n = 41)Avaré (n = 1)LP (n = 3)Total

NAHOHENAHOHENAHOHENANASNAPIC
Pmoratoiμ550.290.35---30.060.06--201–23960.47
Pmoratoiμ680.700.7150.620.6890.590.6821208–240100.78
Pmoratoiμ710.000.0010.000.0020.460.4811185–18720.28
Pmoratoiμ820.170.1610.000.0020.020.0211209–21120.06
Pmoratoiμ1030.300.3110.000.0030.120.1211109–11330.15
Pmoratoiμ1120.050.0510.000.0030.120.1411125–12930.07
Pmoratoiμ1260.800.7780.520.64130.850.8732144–196140.82
Pmoratoiμ1320.120.1630.420.5920.050.0521162–16840.34
Pmoratoiμ1470.750.7610.000.0050.680.7112190–21880.71
Pmoratoiμ15100.670.8090.830.79120.730.8522177–241180.84
Pmoratoiμ1630.620.5530.750.6420.100.1021146–15840.48
Pmoratoiμ1730.080.0820.040.0410.000.0011092–09830.09
Pmoratoiμ1810.000.0010.000.0010.000.0021163–16520.02
Pmoratoiμ1920.500.5120.460.4920.360.4321167–16920.40
Pmoratoiμ2110.000.0020.400.4720.170.1611242–24630.25
Pmoratoiμ2390.720.8640.290.6170.760.8131225–251120.87
Pmoratoiμ2430.260.66 *20.300.4720.100.0912148–17480.72
Pmoratoiμ2530.600.5530.570.5820.540.5112246–25230.53
Pmoratoiμ2620.130.1220.420.3820.410.4611119–13340.38
Pmoratoiμ2780.450.77 *80.870.8490.690.8542196–244120.86
Pmoratoiμ2820.450.4930.580.5830.610.6211195–20330.48
Pmoratoiμ2980.900.8470.960.7760.470.64 *31154–198110.80
LP: Lençóis Paulista; 0.00: monomorphic locus; -: locus not amplified; NA: number of alleles; HO: observed heterozygosity; HE: expected heterozygosity; S: size range; PIC: polymorphic information content.

Share and Cite

MDPI and ACS Style

Arruda, M.P.; Costa, W.P.; Silva, C.C.; Pimentel, S.M.R. Development of 22 Polymorphic Microsatellite Loci for the Critically Endangered Morato’s Digger Toad, Proceratophrys moratoi. Int. J. Mol. Sci. 2012, 13, 12259-12267. https://doi.org/10.3390/ijms131012259

AMA Style

Arruda MP, Costa WP, Silva CC, Pimentel SMR. Development of 22 Polymorphic Microsatellite Loci for the Critically Endangered Morato’s Digger Toad, Proceratophrys moratoi. International Journal of Molecular Sciences. 2012; 13(10):12259-12267. https://doi.org/10.3390/ijms131012259

Chicago/Turabian Style

Arruda, Maurício Papa, William Pinheiro Costa, Carla Cristina Silva, and Shirlei Maria Recco Pimentel. 2012. "Development of 22 Polymorphic Microsatellite Loci for the Critically Endangered Morato’s Digger Toad, Proceratophrys moratoi" International Journal of Molecular Sciences 13, no. 10: 12259-12267. https://doi.org/10.3390/ijms131012259

APA Style

Arruda, M. P., Costa, W. P., Silva, C. C., & Pimentel, S. M. R. (2012). Development of 22 Polymorphic Microsatellite Loci for the Critically Endangered Morato’s Digger Toad, Proceratophrys moratoi. International Journal of Molecular Sciences, 13(10), 12259-12267. https://doi.org/10.3390/ijms131012259

Article Metrics

Back to TopTop