Interactive Effects of Dietary Lipid and Phenotypic Feed Efficiency on the Expression of Nuclear and Mitochondrial Genes Involved in the Mitochondrial Electron Transport Chain in Rainbow Trout
Abstract
1. Introduction
2. Results
2.1. Gene Expression in the Liver
2.1.1. Mitochondrial Genes in the Liver
| Families 2 | Practical Diets 3 | Mitochondrial Gene Expression 4 | ||||
|---|---|---|---|---|---|---|
| Complex I: nd1 | Complex III: cytb | Complex IV: cox1 | Complex IV: cox2 | Complex V: atp6 | ||
| Individual treatment means | ||||||
| F120 | 40/10 | 0.000 d | 0.000 e | 0.000 cd | 0.000 d | 0.000 d |
| F120 | 40/20 | 0.455 ab | 0.777 a | 0.636 a | 0.937 a | 0.569 e |
| F120 | 40/30 | 0.435 ab | 0.418 c | 0.392 b | 0.601 b | 0.459 a |
| F136 | 40/10 | 0.564 a | 0.598 b | −0.292 e | −0.244 e | −0.557 e |
| F136 | 40/20 | 0.400 bc | 0.326 d | −0.090 d | 0.209 c | 0.339 b |
| F136 | 40/30 | 0.287 c | −0.177 f | 0.027 c | −0.198 e | 0.173 c |
| Pooled SEM | 0.133 | 0.025 | 0.031 | 0.022 | 0.036 | |
| Main effect means | ||||||
| F120 | 0.296 | 0.398 | 0.340 | 0.513 | 0.343 | |
| F136 | 0.417 | 0.249 | −0.118 | −0.077 | −0.015 | |
| 40/10 | 0.282 | 0.299 | −0.146 | −0.122 | −0.278 | |
| 40/20 | 0.427 | 0.552 | 0.270 | 0.572 | 0.554 | |
| 40/30 | 0.361 | 0.120 | 0.210 | 0.202 | 0.316 | |
| ANOVA: p values | ||||||
| Family (F) | 0.0043 | <0.0001 | <0.0001 | <0.0001 | <0.0001 | |
| F-value/df 5 | 13.31/1 | 51.77/1 | 331.62/1 | 1108.43/1 | 145.51/1 | |
| Diet (D) | 0.0159 | <0.0001 | <0.0001 | <0.0001 | <0.0001 | |
| F-value/df 5 | 5.96/2 | 146.35/2 | 106.16/2 | 512.26/2 | 229.51/2 | |
| Interaction (FxD) | <0.0001 | <0.0001 | <0.0001 | <0.0001 | <0.0016 | |
| F-value/df 5 | 42.25/2 | 329.41/2 | 28.09/2 | 96.83/2 | 11.56/2 | |
2.1.2. Nuclear Genes in the Liver
| Families 2 | Practical Diets 3 | Nuclear Gene Expression 4 | ||||
|---|---|---|---|---|---|---|
| ucp2α | ucp2β | pparα | pparβ | pgc-1α | ||
| Individual treatment means | ||||||
| F120 | 40/10 | 0.000 d | 0.000 e | 0.000 e | 0.000 c | 0.000 b |
| F120 | 40/20 | 0.912 a | 0.927 a | 0.527 b | 0.811 a | 0.336 a |
| F120 | 40/30 | 0.477 b | 0.319 d | 0.589 a | 0.722 a | −0.124 b |
| F136 | 40/10 | 0.371 c | 0.612 b | 0.282 c | −0.198 d | −0.416 cd |
| F136 | 40/20 | 0.585 b | 0.478 c | 0.159 d | 0.177 b | −0.339 c |
| F136 | 40/30 | 0.304 c | 0.304 d | 0.192 d | 0.106 bc | −0.533 d |
| Pooled SEM | 0.058 | 0.032 | 0.019 | 0.426 | 0.042 | |
| Main effect means | ||||||
| F120 | 0.463 | 0.415 | 0.372 | 0.511 | 0.071 | |
| F136 | 0.420 | 0.464 | 0.213 | 0.028 | −0.429 | |
| 40/10 | 0.185 | 0.306 | 0.141 | −0.099 | −0.208 | |
| 40/20 | 0.748 | 0.702 | 0.340 | 0.494 | −0.001 | |
| 40/30 | 0.390 | 0.312 | 0.393 | 0.414 | −0.328 | |
| ANOVA: p values | ||||||
| Family (F) | 0.3846 | 0.0888 | <0.0001 | <0.0001 | <0.0001 | |
| F-value/df 5 | 0.81/1 | 3.43/1 | 102.48/1 | 193.38/1 | 212.41/1 | |
| Diet (D) | <0.0001 | <0.0001 | <0.0001 | <0.0001 | <0.0001 | |
| F-value/df 5 | 47.85/2 | 98.92/2 | 96.77/2 | 114.71/2 | 30.95/2 | |
| Interaction (FxD) | 0.0002 | <0.0001 | <0.0001 | 0.0003 | 0.0124 | |
| F-value/df 5 | 19.87/2 | 135.50/2 | 197.48/2 | 16.78/2 | 6.48/2 | |
2.2. Gene Expression in the Intestine
2.2.1. Mitochondrial Genes in the Intestine
2.2.2. Nuclear Genes in the Intestine
| Families 2 | Practical Diets 3 | Mitochondrial Gene Expression 4 | ||||
|---|---|---|---|---|---|---|
| Complex I: nd1 | Complex III: cytb | Complex IV: cox1 | Complex IV: cox2 | Complex V: atp6 | ||
| Individual treatment means | ||||||
| F120 | 40/10 | 0.000 b | 0.000 b | 0.000 b | 0.000 b | 0.000 c |
| F120 | 40/20 | −0.206 c | 0.001 d | −0.348 e | −0.454 b | 0.186 b |
| F120 | 40/30 | 0.415 b | 0.279 c | −0.278 d | −0.690 c | 0.556 a |
| F136 | 40/10 | −0.387 d | −0.669 e | −0.203 c | −0.525 b | −0.446 d |
| F136 | 40/20 | 0.544 b | 0.370 b | −0.620 f | −0.482 b | −0.085 c |
| F136 | 40/30 | 0.757 a | 0.503 a | 0.404 a | 0.941 a | 0.591 a |
| Pooled SEM | 0.063 | 0.021 | 0.020 | 0.024 | 0.016 | |
| Main effect means | ||||||
| F120 | 0.070 | 0.093 | −0.208 | −0.381 | 0.247 | |
| F136 | 0.305 | 0.068 | −0.140 | −0.022 | 0.020 | |
| 40/10 | −0.194 | −0.334 | −0.102 | −0.263 | −0.223 | |
| 40/20 | 0.169 | 0.185 | 0.484 | −0.468 | 0.050 | |
| 40/30 | 0.586 | 0.391 | 0.063 | 0.125 | 0.574 | |
| ANOVA: p values | ||||||
| Family (F) | 0.0007 | 0.1673 | 0.0011 | <0.0001 | <0.0001 | |
| F-value/df 5 | 20.68/1 | 2.16/1 | 18.01/1 | 330.04/1 | 308.61/1 | |
| Diet (D) | <0.0001 | <0.0001 | <0.0001 | <0.0001 | <0.0001 | |
| F-value/df 5 | 76.26/2 | 649.37/2 | 406.07/2 | 309.18/2 | 1305.84/2 | |
| Interaction (FxD) | <0.0001 | <0.0001 | <0.0001 | <0.0001 | <0.0001 | |
| F-value/df 5 | 41.54/2 | 367.00/2 | 363.47/2 | 1086.27/2 | 117.93/2 | |
| Families 2 | Practical Diets 3 | Nuclear Gene Expression 4 | ||||
|---|---|---|---|---|---|---|
| ucp2α | ucp2β | pparα | pparβ | pgc-1α | ||
| Individual treatment means | ||||||
| F120 | 40/10 | 0.000 c | 0.000 e | 0.000 c | 0.000 c | 0.000 c |
| F120 | 40/20 | −0.219 d | 0.364 | 0.349 b | 0.681 b | −0.313 d |
| F120 | 40/30 | −0.305 d | 0.231 d | −0.272 d | 0.894 a | −0.692 e |
| F136 | 40/10 | −0.618 e | −0.054 e | −0.537 e | −0.495 d | −0.610 e |
| F136 | 40/20 | 0.647 a | 0.915 a | −0.150 d | 0.824 ab | 0.504 b |
| F136 | 40/30 | 0.475 b | 0.668 b | 0.783 a | 0.940 a | 0.913 a |
| Pooled SEM | 0.018 | 0.036 | 0.046 | 0.062 | 0.088 | |
| Main effect means | ||||||
| F120 | −0.175 | 0.198 | 0.025 | 0.525 | −0.335 | |
| F136 | 0.168 | 0.510 | 0.032 | 0.423 | 0.269 | |
| 40/10 | −0.309 | −0.027 | −0.268 | −0.248 | −0.305 | |
| 40/20 | 0.214 | 0.639 | 0.100 | 0.752 | 0.095 | |
| 40/30 | 0.085 | 0.450 | 0.255 | 0.917 | 0.111 | |
| ANOVA: p values | ||||||
| Family (F) | <0.0001 | <0.0001 | 0.8623 | 0.0672 | <0.0001 | |
| F-value/df 5 | 529.63/1 | 109.98/1 | 0.03/1 | 4.05/1 | 70.23/1 | |
| Diet (D) | <0.0001 | <0.0001 | <0.0001 | <0.0001 | 0.0007 | |
| F-value/df 5 | 446.07/2 | 178.01/2 | 67.57/2 | 204.00/2 | 14.27/2 | |
| Interaction (FxD) | <0.0001 | <0.0001 | <0.0001 | <0.0005 | <0.0001 | |
| F-value/df 5 | 1042.60/2 | 39.13/2 | 192.78/2 | 15.14/2 | 80.92/2 | |
2.3. Gene Expression in the Muscle
2.3.1. Mitochondrial Genes in the Muscle
| Families 2 | Practical Diets 3 | Mitochondrial Gene Expression 4 | ||||
|---|---|---|---|---|---|---|
| Complex I: nd1 | Complex III: cytb | Complex IV: cox1 | Complex IV: cox2 | Complex V: atp6 | ||
| Individual treatment means | ||||||
| F120 | 40/10 | 0.000 c | 0.000 c | 0.000 e | 0.000 d | 0.000 b |
| F120 | 40/20 | 0.638 a | 0.598 ab | 0.614 a | 0.510 b | 0.506 a |
| F120 | 40/30 | 0.401 b | 0.540 b | 0.589 a | 0.908 a | 0.475 a |
| F136 | 40/10 | −0.563 e | 0.691 a | 0.151 d | 0.689 b | 0.446 a |
| F136 | 40/20 | 0.620 a | 0.685 a | 0.373 b | 0.720 b | 0.370 a |
| F136 | 40/30 | −0.262 d | 0.650 ab | 0.246 c | −0.327 e | −0.176 b |
| Pooled SEM | 0.026 | 0.045 | 0.026 | 0.048 | 0.062 | |
| Main effect means | ||||||
| F120 | 0.346 | 0.379 | 0.401 | 0.473 | 0.227 | |
| F136 | −0.068 | 0.676 | 0.257 | 0.361 | 0.213 | |
| 40/10 | −0.281 | 0.346 | 0.076 | 0.345 | 0.223 | |
| 40/20 | 0.629 | 0.642 | 0.494 | 0.615 | 0.438 | |
| 40/30 | 0.070 | 0.595 | 0.418 | 0.291 | 0.150 | |
| ANOVA: p values | ||||||
| Family (F) | <0.0001 | <0.0001 | <0.0001 | 0.0154 | 0.0439 | |
| F-value/df 5 | 389.97/1 | 63.70/1 | 47.14/1 | 7.96/1 | 5.07/1 | |
| Diet (D) | <0.0001 | <0.0001 | <0.0001 | <0.0001 | 0.0015 | |
| F-value/df 5 | 638.31/2 | 24.52/2 | 149.77/2 | 25.76/2 | 11.67/2 | |
| Interaction (FxD) | <0.0001 | <0.0001 | <0.0001 | <0.0001 | <0.0001 | |
| F-value/df 5 | 91.30/2 | 28.30/2 | 51.38/2 | 213.61/2 | 39.27/2 | |
2.3.2. Nuclear Genes in the Muscle
| Families 2 | Practical Diets 3 | Nuclear gene expression 4 | ||||
|---|---|---|---|---|---|---|
| ucp2α | ucp2β | pparα | pparβ | pgc-1α | ||
| Individual treatment means | ||||||
| F120 | 40/10 | 0.000 a | 0.000 c | 0.000 d | 0.000 | 0.000 b |
| F120 | 40/20 | −0.798 c | 0.500 b | −0.349 e | 0.227 | 0.324 a |
| F120 | 40/30 | −0.854 c | 0.761 a | 0.153 c | 0.186 | 0.330 a |
| F136 | 40/10 | −0.926 d | −0.435 e | 0.250 b | 0.280 | 0.422 a |
| F136 | 40/20 | −0.929 d | 0.271 d | 0.741 a | 0.315 | 0.367 a |
| F136 | 40/30 | −0.661 b | 0.405 b | 0.326 b | 0.324 | 0.288 a |
| Pooled SEM | 0.037 | 0.048 | 0.051 | 0.045 | 0.062 | |
| Main effect means | ||||||
| F120 | −0.551 | 0.422 | −0.110 | 0.137 b | 0.218 | |
| F136 | −0.839 | −0.100 | 0.439 | 0.306 a | 0.359 | |
| 40/10 | −0.463 | −0.217 | 0.125 | 0.140 b | 0.211 | |
| 40/20 | −0.864 | 0.117 | 0.117 | 0.271 a | 0.345 | |
| 40/30 | −0.757 | 0.583 | 0.340 | 0.255 a | 0.308 | |
| ANOVA: p values | ||||||
| Family (F) | <0.0001 | <0.0001 | <0.0001 | 0.0006 | 0.0168 | |
| F-value/df 5 | 92.04/1 | 180.20/1 | 175.74/1 | 21.10/1 | 7.70/1 | |
| Diet (D) | <0.0001 | <0.0001 | 0.0606 | 0.0256 | 0.1241 | |
| F-value/df 5 | 63.61/2 | 142.96/2 | 3.57/2 | 5.05/2 | 2.50/2 | |
| Interaction (FxD) | <0.0001 | 0.0010 | <0.0001 | 0.1304 | 0.0065 | |
| F-value/df 5 | 122.49/2 | 10.99/2 | 67.98/2 | 2.43/2 | 7.88/2 | |
3. Discussion
4. Materials and Methods
4.1. Fish Husbandry and Feeding
| Ingredient (g/100 g Diet, as-Fed Basis) 2 | Experimental Diets 1 | ||
|---|---|---|---|
| Protein/lipid levels (%) | 40/10 | 40/20 | 40/30 |
| Menhaden fish meal (69% crude protein) | 30.00 | 30.00 | 30.00 |
| Soybean meal (47% crude protein) | 15.00 | 15.00 | 15.00 |
| Blood meal (88% crude protein) | 3.00 | 5.00 | 6.00 |
| Feather meal (84% crude protein) | 5.00 | 5.00 | 5.00 |
| Wheat flour (11% crude protein) | 9.00 | 9.00 | 9.00 |
| Brewe’s yeast (46% crude protein) | 2.00 | 2.00 | 2.00 |
| Wheat midds (15% crude protein) | 28.61 | 16.25 | 4.75 |
| Vitamin premix | 0.40 | 0.40 | 0.40 |
| Mineral premix | 0.10 | 0.10 | 0.10 |
| Stay-C | 0.14 | 0.14 | 0.14 |
| Choline chloride | 0.58 | 0.58 | 0.58 |
| Dicalcium Phosphate | 0.4 | 0.4 | 0.4 |
| Calcium propionate | 0.13 | 0.13 | 0.13 |
| Fish oil | 5.60 | 16.00 | 26.50 |
| Total | 100.00 | 100.00 | 100.00 |
| Proximate composition | |||
| Crude protein | 40.90 | 40.78 | 39.93 |
| Fat | 10.02 | 20.04 | 30.19 |
| Moisture | 7.85 | 5.29 | 7.03 |
| Ash | 8.45 | 7.58 | 7.55 |
| Gross energy (kJ/g) | 19.28 | 21.33 | 24.32 |
4.2. Sample Collection
4.3. Gene Expression Analysis
4.3.1. Extraction and Purification of Total RNA
4.3.2. DNase I Treatment and Quantification of Total RNA
4.3.3. cDNA Synthesis
4.3.4. Real-Time PCR Genes and Primers
4.3.5. Primer Optimization
| Genes | Origin | GenBank Accession No. | Primers | Sequence 5' to 3' |
|---|---|---|---|---|
| β-actin | nDNA | AJ438158 | Forward | gaagatgaaatcgccgcactgg |
| Reverse | ctttctggcccatcccaacca | |||
| Elongation factor 1-α | nDNA | AF498320 | Forward | agcgcaatcagcctgagaggta |
| Reverse | gctggacaagctgaaggctgag | |||
| NADH dehydrogenase subunit 1 | mtDNA | NP_008290 | Forward | tagcatacattgtacccgttctgttagcag |
| Reverse | aatagttttaggccgtctgcgatgg | |||
| Cytochrome c oxidase I | mtDNA | NP_008292 | Forward | ctcaaccaaccacaaagacattggc |
| Reverse | tcacgttatagatttggtcatccccc | |||
| Cytochrome c oxidase II | mtDNA | NP_008293 | Forward | gaggcaataaaggctgtttggt |
| Reverse | gaggccgttccttctttaggtgtaa | |||
| Cytochrome b | mtDNA | NC_001717 | Forward | tggccaacctccgaaaaac |
| Reverse | ggaggtcgactagtgcgtcatt | |||
| ATPase subunit 6 | mtDNA | NP_008295 | Forward | cttcttcgaccaatttatgagcccc |
| Reverse | Tcggttgatgaaccacccttgc | |||
| Uncoupling protein 2 alpha | nDNA | NM_001124654.1 | Forward | tccatgcctgcacgaattt |
| Reverse | tttagcagatgccccaagtga | |||
| Uncoupling protein 2 beta | nDNA | NM_001124571.1 | Forward | ggaaaaggtgcggcagcta |
| Reverse | accaaacacaccccgatacc | |||
| Peroxisome proliferator-activated receptor alpha | nDNA | NM_001197211.1 | Forward | gctggagctggatgacagtga |
| Reverse | gcggtctccacagcagat | |||
| Peroxisome proliferator-activated receptor beta | nDNA | NM_001197207.1 | Forward | cctggcgggagagaaagc |
| Reverse | cagggatttgagatccgagcta | |||
| Proliferator-activated receptor gamma coactivator 1 alpha | nDNA | FJ710605.1 | Forward | caaccaccttgccacttcct |
| Reverse | cggtgatcccttgtggtcat |
4.3.6. Quantitative Real-Time PCR
4.4. Statistical Methods
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Sargent, J.R.; Tocher, D.R.; Bell, J.G. The lipids. In Fish Nutrition, 3rd ed.; Halver, J.E., Hardy, R.W., Eds.; Academic Press: San Diego, CA, USA, 2002; pp. 181–257. [Google Scholar]
- Klinger, D.; Naylor, R. Searching for solutions in aquaculture: Charting a sustainable course. Annu. Rev. Environ. Resour. 2012, 37, 246–276. [Google Scholar] [CrossRef]
- Olivia-Teles, A. Nutrition and health of aquaculture fish. J. Fish Dis. 2012, 35, 83–108. [Google Scholar] [CrossRef] [PubMed]
- FAO (Food and Agriculture Organization of the United Nations). The State of World Fisheries and Aquaculture 2012; FAO Fisheries and Aquaculture Department: Rome, Italy, 2012. [Google Scholar]
- NRC (National Research Council). Nutrient Requirements of Fish and Shrimps; The National Academies Press: Washington, DC, USA, 2011.
- Bottje, W.G.; Carstens, G.E. Association of mitochondrial function and feed efficiency in poultry and livestock species. J. Anim. Sci. 2009, 87, E48–E63. [Google Scholar] [CrossRef] [PubMed]
- Li, M.H.; Manning, B.B.; Robinson, E.H.; Bosworth, B.G.; Wolters, W.R. Comparison of growth, processing yield, and body composition of USDA103 and Mississippi “normal” strains of channel catfish fed diets containing three concentrations of protein. J. World Aquac. Soc. 2001, 32, 402–408. [Google Scholar] [CrossRef]
- Henryon, M.; Jokumsen, A.; Berg, P.; Lund, I.; Pederson, P.B.; Olesen, N.J.; Slierendrecht, W.J. Genetic variation for growth, feed conversion efficiency, and disease resistance exists within a farmed population of rainbow trout. Aquaculture 2002, 209, 59–76. [Google Scholar] [CrossRef]
- Wolters, R.W.; Waldbieser, G.C.; Bosworth, B.G.; Silverstein, J.T.; Robinson, E.H. Genetically Distinct Strain of Channel Catfish Designated NWAC103, with Improved Growth Performance. USA Pat. Appl. No. US 2004/0055029 A1, 2004. [Google Scholar]
- Silverstein, J.T.; Hostuttler, M.; Blemings, K.P. Strain differences in feed efficiency measured as residual feed intake in individually reared rainbow trout, Oncorhynchus mykiss (Walbaum). Aquac. Res. 2005, 36, 704–711. [Google Scholar] [CrossRef]
- Peterson, B.; Bilodeau, L.; Bosworth, B. Evaluation of growth and disease resistance of USDA103, USDA303, USDA102, and USDA102 × USDA103 strains of channel catfish, Ictalurus punctatus. J. World Aquac. Soc. 2008, 39, 113–119. [Google Scholar] [CrossRef]
- Ojano-Dirain, C.; Iqbal, M.; Cawthon, D.; Swonger, S.; Wing, T.; Cooper, M.; Bottje, W. Site-specific defects in electron transport in duodenal mitochondria are associated with low feed efficiency in broiler breeder males. Poult. Sci. 2004, 83, 1394–1403. [Google Scholar] [CrossRef] [PubMed]
- Bottje, W.; Iqbal, M.; Tang, Z.X.; Cawthon, D.; Okimoto, R. Association of mitochondrial function and feed efficiency within a single genetic line of male broilers. Poult. Sci. 2002, 81, 546–555. [Google Scholar] [CrossRef] [PubMed]
- Bottje, W.; Pumford, N.R.; Ojano-Dirain, C.; Iqbal, M.; Lassiter, K. Feed efficiency and mitochondrial function. Poult. Sci. 2006, 85, 8–14. [Google Scholar] [CrossRef] [PubMed]
- Eya, J.C.; Ashame, M.F.; Pomeroy, C.F. Influence of diet on mitochondrial complex activity in channel catfish. N. Am. J. Aquac. 2010, 72, 225–236. [Google Scholar] [CrossRef]
- Eya, J.C.; Ashame, M.F.; Pomeroy, C.F.; Manning, B.B.; Peterson, B.C. Genetic variation in feed consumption, growth, nutrient utilization efficiency and mitochondrial function within a farmed population of channel catfish (Ictalurus punctatus). Comp. Biochem. Phys. B 2012, 163, 211–220. [Google Scholar] [CrossRef]
- Eya, J.C.; Ashame, M.F.; Pomeroy, C.F. Association of mitochondrial function with feed efficiency in rainbow trout: Diets and family effects. Aquaculture 2011, 321, 71–84. [Google Scholar] [CrossRef]
- Lehninger, A.L.; Nelson, D.L.; Cox, M.M. Principles of Biochemistry, 2nd ed.; Worth Publishers: New York, NY, USA, 1993. [Google Scholar]
- Hatefi, Y. The mitochondrial electron transport and oxidative phosphorylation system. Annu. Rev. Biochem. 1985, 54, 1015–1069. [Google Scholar] [CrossRef] [PubMed]
- Benard, G.; Bellance, N.; Jose, C.; Rossignol, R. Relationship between Mitochondrial Dynamics and Bioenergetics. In Mitochondrial Dynamics and Neurodegeneration; Lu, B., Ed.; Springer Science + Business Media B.V.: Dordrecht, The Netherlands, 2011; pp. 47–68. [Google Scholar]
- Eya, J.C.; Yossa, R.; Ashame, M.F.; Pomeroy, C.F.; Gannam, A.L. Effects of dietary lipid levels on mitochondrial gene expression in low-and high-feed efficient families of rainbow trout Oncorhynchus mykiss. J. Fish Biol. 2014, 84, 1708–1720. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, M.T.; Cheon, Y.; Li, Y.; Nara, T.Y. Mechanisms of regulation of gene expression by fatty acids. Lipids 2004, 39, 1077–1083. [Google Scholar] [CrossRef] [PubMed]
- Cogburn, L.A.; Porter, T.E.; Duclos, M.J.; Simon, J.; Burgess, S.C.; Zhu, J.J.; Burnside, J. Functional genomics of the chicken—A model organism. Poult. Sci. 2007, 86, 2059–2094. [Google Scholar] [CrossRef] [PubMed]
- Leaver, M.; Bautista, J.M.; Björnsson, B.T.; Jönsson, E.; Krey, G.; Tocher, D.R.; Torstensen, B.E. Towards fish lipid nutrigenomics: Current state and prospects for fin-fish aquaculture. Rev. Fish. Sci. 2008, 16, 71–92. [Google Scholar] [CrossRef]
- Eya, J.C.; Ukwuaba, V.O.; Yossa, R.; Ashame, M.F.; Pomeroy, C.F.; Gannam, A.L. Growth performance and mitochondrial function in juvenile rainbow trout (Oncorhynchus mykiss) fed graded dietary lipid levels. Ann. Aquac. Res. 2015, 2, 1006. [Google Scholar]
- Kinghorn, B. Genetic variation in food conversion efficiency and growth in rainbow trout. Aquaculture 1983, 32, 141–155. [Google Scholar] [CrossRef]
- Quinton, C.D. Breeding salmonids for feed efficiency in current fishmeal and future plant-based diet environments. Genet. Select. Evol. 2007, 39, 431–446. [Google Scholar] [CrossRef]
- Cho, C.Y.; Kaushik, S.J. Effect of protein intake on metabolizable and net energy values of fish diets. In Nutrition and Feeding in Fish; Cowey, C.B., Mackie, A.M., Bell, J.G., Eds.; Academic Press: London, UK, 1985; pp. 95–117. [Google Scholar]
- Kaushik, S.J.; Médale, F. Energy requirements, utilization and dietary supply to salmonids. Aquaculture 1994, 124, 81–97. [Google Scholar] [CrossRef]
- Bureau, D.P.; Kaushik, S.J.; Cho, C.Y. Bioenergetics. In Fish Nutrition, 3rd ed.; Halver, J.E., Hardy, R.W., Eds.; Academic Press: San Diego, CA, USA, 2013; pp. 1–59. [Google Scholar]
- Takeuchi, T.; Yokoyama, M.; Ogino, C. Optimum ratio of dietary energy to protein for rainbow trout. Bull. Jpn. Soc. Sci. Fish. 1978, 44, 729–732. [Google Scholar] [CrossRef]
- Schothorst, E.M.; Flachs, P.; Franssen-van Hall, N.L.W.; Kuda, O.; Bunschoten, A.; Molthoff, J.; Vink, C.; Hooiveld, G.J.E.J.; Kopecky, J.; Keijer, J. Induction of lipid oxidation by polyunsaturated fatty acids of marine origin in small intestine of mice fed a high-fat diet. BMC Genomics 2009, 10, 110–121. [Google Scholar] [CrossRef] [PubMed]
- Mori, T.; Kondo, H.; Hase, T.; Tokimitsu, I.; Murase, T. Dietary fish oil upregulates intestinal lipid metabolism and reduces body weight gain in C57BL/6J mice. J. Nutr. 2007, 137, 2629–2634. [Google Scholar] [PubMed]
- Oster, M.; Murani, E.; Metges, C.C.; Ponsuksili, S.; Wimmers, K. A high protein diet during pregnancy affect hepatic gene expression of energy sensing pathways along ontogenesis in a porcine model. PLoS ONE 2011, 6, e21691. [Google Scholar] [CrossRef] [PubMed]
- Nisoli, E.; Clementi, E.; Paolucci, C.; Cozzi, V.; Tonello, C.; Sciorati, C.; Bracale, R.; Valerio, A.; Francolini, M.; Moncada, S.; et al. Mitochondrial biogenesis in mammals: The role of endogenous nitric oxide. Science 2003, 299, 896–899. [Google Scholar] [CrossRef] [PubMed]
- Leone, T.C.; Weinheimer, C.J.; Kelly, D.P. A critical role for the peroxisome proliferator-activated receptor α (PPARα) in the cellular fasting response: The PPARα-null mouse as a model of fatty acid oxidation disorders. Proc. Natl. Acad. Sci. USA 1999, 96, 7473–7478. [Google Scholar] [CrossRef] [PubMed]
- Hashimoto, T.; Cook, W.S.; Qi, C.; Yeldandi, A.V.; Reddy, J.K.; Rao, M.S. Defect in peroxisome proliferator-activated receptor α-inducible fatty acid oxidation determines the severity of hepatic steatosis in response to fasting. J. Biol. Chem. 2000, 275, 28918–28928. [Google Scholar] [CrossRef] [PubMed]
- Le May, C.; Pineau, T.; Bigot, K.; Kolh, C.; Girard, J.; Pégorier, J.P. Reduced hepatic fatty acid oxidation in fasting PPARα-null mice is due to impaired mitochondrial hydroxymethylglutaryl-CoA synthase gene expression. FEBS Lett. 2000, 475, 163–166. [Google Scholar] [CrossRef] [PubMed]
- Ojano-Dirain, C.; Toyomizu, M.; Wing, T.; Cooper, M.; Bottje, W.G. Gene expression in breast muscle and duodenum from low and high feed efficient broilers. Poult. Sci. 2007, 86, 372–381. [Google Scholar] [CrossRef] [PubMed]
- Miwa, S.; St-Pierre, J.; Partridge, L.; Brand, M.D. Superoxide and hydrogen peroxide production in Drosophila mitochondria. Free Radic. Biol. Med. 2003, 35, 938–948. [Google Scholar] [CrossRef] [PubMed]
- Salin, K.; Luquet, E.; Rey, B.; Roussel, D.; Voituron, Y. Alteration of mitochondrial efficiency affects oxidative balance, development and growth in frog (Rana temporaria) tadpoles. J. Exp. Biol. 2012, 215, 863–869. [Google Scholar] [CrossRef] [PubMed]
- UFRC (Uses of Fishes in Research Committee). Guidelines for the Use of Fishes in Research. American Fisheries Society, Bethesda. Available online: http://fisheries.org/docs/policy_useoffishes.pdf (accessed on 3 January 2007).
- Chomczynski, P.; Sacchi, N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 1987, 162, 156–159. [Google Scholar] [CrossRef] [PubMed]
- Olsvik, P.A.; Lie, K.K.; Jordal, A.E.O.; Nilsen, T.O.; Hordvik, I. Evaluation of potential reference genes in real-time RT-PCR studies of Atlantic salmon. BMC Mol. Biol. 2005. [Google Scholar] [CrossRef]
- O’Dowd, C.; Mothersill, C.E.; Cairns, M.T.; Austin, B.; Lyng, F.M.; McClean, B.; Talbot, A.; Murphy, J.E.J. Gene expression and enzyme activity of mitochondrial proteins in irradiated rainbow trout (Oncorhynchus mykiss, Walbaum) tissues in vitro. Radiat. Res. 2009, 171, 464–473. [Google Scholar] [CrossRef] [PubMed]
- Hook, S.E.; Skillman, A.D.; Small, J.A.; Schultz, I.R. Temporal changes in gene expression in rainbow trout exposed to ethynyl estradiol. Comp. Biochem. Phys. C 2007, 145, 73–85. [Google Scholar]
- Bobe, J.; Montfort, J.; Nguyen, T.; Fostier, A. Identification of new participants in the rainbow trout (Oncorhynchus mykiss) oocyte maturation and ovulation processes using cDNA microarrays. Reprod. Biol. Endocrinol. 2006, 4, 39–54. [Google Scholar] [CrossRef] [PubMed]
- Wong, M.L.; Medrano, J.F. Real-time PCR for mRNA quantitation. BioTechniques 2005, 39, 75–85. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Steel, R.G.; Torrie, J.H. Principles and Procedures of Statistics, a Biometric Approach, 2nd ed.; McGraw-Hill: New York, NY, USA, 1980. [Google Scholar]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Eya, J.C.; Ukwuaba, V.O.; Yossa, R.; Gannam, A.L. Interactive Effects of Dietary Lipid and Phenotypic Feed Efficiency on the Expression of Nuclear and Mitochondrial Genes Involved in the Mitochondrial Electron Transport Chain in Rainbow Trout. Int. J. Mol. Sci. 2015, 16, 7682-7706. https://doi.org/10.3390/ijms16047682
Eya JC, Ukwuaba VO, Yossa R, Gannam AL. Interactive Effects of Dietary Lipid and Phenotypic Feed Efficiency on the Expression of Nuclear and Mitochondrial Genes Involved in the Mitochondrial Electron Transport Chain in Rainbow Trout. International Journal of Molecular Sciences. 2015; 16(4):7682-7706. https://doi.org/10.3390/ijms16047682
Chicago/Turabian StyleEya, Jonathan C., Vitalis O. Ukwuaba, Rodrigue Yossa, and Ann L. Gannam. 2015. "Interactive Effects of Dietary Lipid and Phenotypic Feed Efficiency on the Expression of Nuclear and Mitochondrial Genes Involved in the Mitochondrial Electron Transport Chain in Rainbow Trout" International Journal of Molecular Sciences 16, no. 4: 7682-7706. https://doi.org/10.3390/ijms16047682
APA StyleEya, J. C., Ukwuaba, V. O., Yossa, R., & Gannam, A. L. (2015). Interactive Effects of Dietary Lipid and Phenotypic Feed Efficiency on the Expression of Nuclear and Mitochondrial Genes Involved in the Mitochondrial Electron Transport Chain in Rainbow Trout. International Journal of Molecular Sciences, 16(4), 7682-7706. https://doi.org/10.3390/ijms16047682
