FokI-RYdCas9 Mediates Nearly PAM-Less and High-Precise Gene Editing in Human Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Plasmid Construction
2.2. Cell Culture, Transfection, and Genotyping
2.3. Lentiviral Vector Production and Transduction
2.4. Data Analysis for the PAM Library and Edited Window Library
2.5. Off-Target Detection by Whole Genome Sequencing (WGS)
2.6. fRYdCas9 Could Be Used in Mouse Embryo Editing
2.7. Statistical Analysis
3. Results
3.1. Increased Potential Target Sites for fRYdCas9
3.2. Validation of Spacer Length for fRYdCas9
3.3. fRYdCas9: A Nearly PAM-Less System
3.4. The fRYdCas9 Exhibits No Context-Dependent Preference in the Targeting Region
3.5. The fRYdCas9 Displays Reduced Off-Target Effects
3.6. fRYdCas9 Could Be Use in Mouse Embryos Editing
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hsu, P.D.; Lander, E.S.; Zhang, F. Development and Applications of CRISPR-Cas9 for Genome Engineering. Cell 2014, 157, 1262–1278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Doudna, J.A.; Charpentier, E. The New Frontier of Genome Engineering with CRISPR-Cas9. Science 2014, 346, 1258096. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cradick, T.J.; Fine, E.J.; Antico, C.J.; Bao, G. CRISPR/Cas9 Systems Targeting β-Globin and CCR5 Genes Have Substantial off-Target Activity. Nucleic Acids Res. 2013, 41, 9584–9592. [Google Scholar] [CrossRef] [Scilit]
- Lin, Y.; Cradick, T.J.; Brown, M.T.; Deshmukh, H.; Ranjan, P.; Sarode, N.; Wile, B.M.; Vertino, P.M.; Stewart, F.J.; Bao, G. CRISPR/Cas9 Systems Have off-Target Activity with Insertions or Deletions between Target DNA and Guide RNA Sequences. Nucleic Acids Res. 2014, 42, 7473–7485. [Google Scholar] [CrossRef] [Scilit]
- Fu, Y.; Foden, J.A.; Khayter, C.; Maeder, M.L.; Reyon, D.; Joung, J.K.; Sander, J.D. High-Frequency off-Target Mutagenesis Induced by CRISPR-Cas Nucleases in Human Cells. Nat. Biotechnol. 2013, 31, 822–826. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pattanayak, V.; Lin, S.; Guilinger, J.P.; Ma, E.; Doudna, J.A.; Liu, D.R. High-Throughput Profiling of off-Target DNA Cleavage Reveals RNA-Programmed Cas9 Nuclease Specificity. Nat. Biotechnol. 2013, 31, 839–843. [Google Scholar] [CrossRef] [Scilit]
- Hsu, P.D.; Scott, D.A.; Weinstein, J.A.; Ran, F.A.; Konermann, S.; Agarwala, V.; Li, Y.; Fine, E.J.; Wu, X.; Shalem, O.; et al. DNA Targeting Specificity of RNA-Guided Cas9 Nucleases. Nat. Biotechnol. 2013, 31, 827–832. [Google Scholar] [CrossRef] [Scilit]
- Vakulskas, C.A.; Dever, D.P.; Rettig, G.R.; Turk, R.; Jacobi, A.M.; Collingwood, M.A.; Bode, N.M.; McNeill, M.S.; Yan, S.; Camarena, J.; et al. A High-Fidelity Cas9 Mutant Delivered as a Ribonucleoprotein Complex Enables Efficient Gene Editing in Human Hematopoietic Stem and Progenitor Cells. Nat. Med. 2018, 24, 1216–1224. [Google Scholar] [CrossRef] [Scilit]
- Slaymaker, I.M.; Gao, L.; Zetsche, B.; Scott, D.A.; Yan, W.X.; Zhang, F. Rationally Engineered Cas9 Nucleases with Improved Specificity. Science 2016, 351, 84–88. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.S.; Dagdas, Y.S.; Kleinstiver, B.P.; Welch, M.M.; Sousa, A.A.; Harrington, L.B.; Sternberg, S.H.; Joung, J.K.; Yildiz, A.; Doudna, J.A. Enhanced Proofreading Governs CRISPR–Cas9 Targeting Accuracy. Nature 2017, 550, 407–410. [Google Scholar] [CrossRef] [Scilit]
- Kulcsár, P.I.; Tálas, A.; Ligeti, Z.; Krausz, S.L.; Welker, E. SuperFi-Cas9 Exhibits Remarkable Fidelity but Severely Reduced Activity yet Works Effectively with ABE8e. Nat. Commun. 2022, 13, 6858. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kulcsár, P.I.; Tálas, A.; Tóth, E.; Nyeste, A.; Ligeti, Z.; Welker, Z.; Welker, E. Blackjack Mutations Improve the On-Target Activities of Increased Fidelity Variants of SpCas9 with 5’G-Extended sgRNAs. Nat. Commun. 2020, 11, 1223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jones, S.K.; Hawkins, J.A.; Johnson, N.V.; Jung, C.; Hu, K.; Rybarski, J.R.; Chen, J.S.; Doudna, J.A.; Press, W.H.; Finkelstein, I.J. Massively Parallel Kinetic Profiling of Natural and Engineered CRISPR Nucleases. Nat. Biotechnol. 2021, 39, 84–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ran, F.A.; Hsu, P.D.; Lin, C.-Y.; Gootenberg, J.S.; Konermann, S.; Trevino, A.E.; Scott, D.A.; Inoue, A.; Matoba, S.; Zhang, Y.; et al. Double Nicking by RNA-Guided CRISPR Cas9 for Enhanced Genome Editing Specificity. Cell 2013, 154, 1380–1389. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsai, S.Q.; Wyvekens, N.; Khayter, C.; Foden, J.A.; Thapar, V.; Reyon, D.; Goodwin, M.J.; Aryee, M.J.; Joung, J.K. Dimeric CRISPR RNA-Guided FokI Nucleases for Highly Specific Genome Editing. Nat. Biotechnol. 2014, 32, 569–576. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guilinger, J.P.; Thompson, D.B.; Liu, D.R. Fusion of Catalytically Inactive Cas9 to FokI Nuclease Improves the Specificity of Genome Modification. Nat. Biotechnol. 2014, 32, 577–582. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vanamee, É.S.; Santagata, S.; Aggarwal, A.K. FokI Requires Two Specific DNA Sites for Cleavage. J. Mol. Biol. 2001, 309, 69–78. [Google Scholar] [CrossRef] [Scilit]
- Hu, J.H.; Miller, S.M.; Geurts, M.H.; Tang, W.; Chen, L.; Sun, N.; Zeina, C.M.; Gao, X.; Rees, H.A.; Lin, Z.; et al. Evolved Cas9 Variants with Broad PAM Compatibility and High DNA Specificity. Nature 2018, 556, 57–63. [Google Scholar] [CrossRef] [Scilit]
- Walton, R.T.; Christie, K.A.; Whittaker, M.N.; Kleinstiver, B.P. Unconstrained Genome Targeting with Near-PAMless Engineered CRISPR-Cas9 Variants. Science 2020, 368, 290–296. [Google Scholar] [CrossRef] [Scilit]
- Cheng, Y.; Sretenovic, S.; Zhang, Y.; Pan, C.; Huang, J.; Qi, Y. Expanding the Targeting Scope of FokI-dCas Nuclease Systems with SpRY and Mb2Cas12a. Biotechnol. J. 2022, 17, 2100571. [Google Scholar] [CrossRef] [Scilit]
- Jiang, W.; Bikard, D.; Cox, D.; Zhang, F.; Marraffini, L.A. RNA-Guided Editing of Bacterial Genomes Using CRISPR-Cas Systems. Nat. Biotechnol. 2013, 31, 233–239. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Ge, X.; Yang, F.; Zhang, L.; Zheng, J.; Tan, X.; Jin, Z.-B.; Qu, J.; Gu, F. Comparison of Non-Canonical PAMs for CRISPR/Cas9-Mediated DNA Cleavage in Human Cells. Sci. Rep. 2014, 4, 5405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsai, S.Q.; Joung, J.K. Defining and Improving the Genome-Wide Specificities of CRISPR–Cas9 Nucleases. Nat. Rev. Genet. 2016, 17, 300–312. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Name | Sequence (5′–3′) |
|---|---|
| Tyr-L IVT F | TAATACGACTCACTATAGGgcttagaggaggcacaggctcGTTTTA GAGCTAGAAATAG |
| Tyr-R IVT F | TAATACGACTCACTATAGGgaatgctgcccaccatggatgGTTTTA GAGCTAGAAATAG |
| sgRNA IVT R | TCTAGCTCTAAAACAAAAAAGCACC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, D.; Cao, Y.; Xie, L.; He, C.; Jiao, D.; Ma, M.; Zuo, Z.; Zuo, E.; Yang, X. FokI-RYdCas9 Mediates Nearly PAM-Less and High-Precise Gene Editing in Human Cells. Curr. Issues Mol. Biol. 2024, 46, 4021-4034. https://doi.org/10.3390/cimb46050248
Li D, Cao Y, Xie L, He C, Jiao D, Ma M, Zuo Z, Zuo E, Yang X. FokI-RYdCas9 Mediates Nearly PAM-Less and High-Precise Gene Editing in Human Cells. Current Issues in Molecular Biology. 2024; 46(5):4021-4034. https://doi.org/10.3390/cimb46050248
Chicago/Turabian StyleLi, Di, Yaqi Cao, Long Xie, Chenfei He, Danrong Jiao, Mengxue Ma, Zhenrui Zuo, Erwei Zuo, and Xiaogan Yang. 2024. "FokI-RYdCas9 Mediates Nearly PAM-Less and High-Precise Gene Editing in Human Cells" Current Issues in Molecular Biology 46, no. 5: 4021-4034. https://doi.org/10.3390/cimb46050248
APA StyleLi, D., Cao, Y., Xie, L., He, C., Jiao, D., Ma, M., Zuo, Z., Zuo, E., & Yang, X. (2024). FokI-RYdCas9 Mediates Nearly PAM-Less and High-Precise Gene Editing in Human Cells. Current Issues in Molecular Biology, 46(5), 4021-4034. https://doi.org/10.3390/cimb46050248

