Next Article in Journal
Correlates of Protective Motivation Theory (PMT) to Adolescents’ Drug Use Intention
Next Article in Special Issue
Investigating Environmental Determinants of Injury and Trauma in the Canadian North
Previous Article in Journal
Objective Indicators of Physical Activity and Sedentary Time and Associations with Subjective Well-Being in Adults Aged 70 and Over
Previous Article in Special Issue
Exploring the Mechanisms of Ecological Land Change Based on the Spatial Autoregressive Model: A Case Study of the Poyang Lake Eco-Economic Zone, China
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJERPH
Volume 11
Issue 1
10.3390/ijerph110100657
ijerph-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Analysis of the Toll-Like Receptor 2-2 (TLR2-2) and TLR4 mRNA Expression in the Intestinal Mucosal Immunity of Broilers Fed on Diets Supplemented with Nickel Chloride

by
Bangyuan Wu
,
Hengmin Cui
*,
Xi Peng
,
Jing Fang
,
Zhicai Zuo
,
Junliang Deng
and
Jianying Huang
Key Laboratory of Animal Diseases and Environmental Hazards of Sichuan Province, College of Veterinary Medicine, Sichuan Agricultural University, Ya'an 625014, China
*
Author to whom correspondence should be addressed.
Int. J. Environ. Res. Public Health 2014, 11(1), 657-670; https://doi.org/10.3390/ijerph110100657
Submission received: 22 October 2013 / Revised: 6 December 2013 / Accepted: 12 December 2013 / Published: 3 January 2014
(This article belongs to the Special Issue IJERPH: 10th Anniversary)
Browse Figures
Versions Notes

Abstract

Toll-like receptor (TLRs) are important innate immune receptors, and TLR2 and TLR4 play an important role in intestinal mucosal innate immunity. It has been found that nickel (Ni) can affect the immune system in broilers. The purpose of this study was to analyze changes in TLR2-2 and TLR4 mRNA expression levels in the intestinal mucosal immunity system of broilers induced by dietary nickel chloride (NiCl2) using quantitative real-time polymerase chain reaction (qRT-PCR) assays. Two hundred and forty one-day-old avian broilers were divided into four groups and fed on a corn-soybean basal diet as control diet or the same basal diet supplemented with 300, 600 and 900 mg/kg of NiCl2 for 42 days. Results showed that the TLR2-2 and TLR4 mRNA expression levels in the intestinal mucosa and the cecal tonsil were lower (p < 0.05 or p < 0.01) in the 300, 600 and 900 mg/kg groups than those in the control group. It was concluded that dietary NiCl2 in excess of 300 mg/kg could reduce TLR2-2 and TLR4 mRNA expression levels in the intestinal mucosa and cecal tonsil in broilers, implying that the innate immunity in intestinal mucosal immune system could be impaired by pathways involving injured surface epithelium cells or/and the inhibition of the TLR signal transduction.

1. Introduction

Nickel (Ni) is used in a wide variety of industrial and consumer applications [1], and it is known to be an essential element for animals [2,3]. As an important metal pollutant, Ni is of considerable concern because its concentration is rapidly increasing in soils of different parts of the World and it is ultimately taken up by plants. Thus, Ni or Ni compounds can enter the food chain and cause deleterious effects on animals [4]. Human exposure to Ni metal and/or Ni oxide may occur via the main exposure routes (inhalation, ingestion or dermal contact) at occupational settings. Exposure to Ni metal or Ni- containing alloys can also occur via coins [5,6,7]. Ionic Ni (Ni2+) is thought to be the actual carcinogenic species because it can bind to cellular components, including nuclear proteins and DNA [8]. Ni complexes with heterochromatin lead to manifold alterations such as condensation, DNA hypermethylation and gene slicing, which disturb gene expression [5,9,10]. As a toxic metal, Ni is responsible for both severe and health effects, allergic contact dermatitis and respiratory tract cancer [11]. Anke et al. studied the effects of dietary nickel on laying hens [12]. Ling and Leach also reported that diets supplemented with from 125 to 250 mg/kg nickel had no effect on feed consumption or egg production, and above 300 mg/kg, nickel has been shown to be toxic to 3-week-old male chicks [13]. Furthermore, research has clearly identified that Ni can induce the innate immune response and interact with the signal transduction of TLRs [14].
TLRs are a family of membrane proteins that play an important role in host defenses against microbial pathogens by triggering the innate immune response and by inducing signals that initiate an adaptive immune response [15]. Consistent with their roles in immune surveillance, TLR mRNA are expressed at higher levels in tissues and cells such as the lungs, gastrointestinal tract, spleen [16], several small intestinal epithelial cells, colon, gastric pit cells, fetal intestinal cells and so on [17]. Furthermore, numerous pro- and anti-inflammatory cytokines are produced in response to bacterial ligands via activation of TLRs, for example, IL-1, IL-6, IL-8, IL-10, IL-12, IFN and TNF-α [18,19,20,21,22]. In addition to the immune functions, invertebrate TLRs have been shown to act during development and in cell to cell interactions [23,24,25]. Further investigations have shown that some TLRs act as coreceptors can promote or inhibit cellular responsiveness to activating ligands [26,27]. TLR2 and TLR4 have been shown to play critical roles in the pattern recognition of the surface components of bacteria and yeasts and in the initiation of the innate immune responses to these microbes [28].
The intestine is an important component of the mucosal immune system and plays an important role in host defense. The cecal tonsil is an important component in the avian mucosal immune system and provides important and unique immune functions. The cecal tonsil produces antibodies, functions as a secondary lymphoid organ, and has a sentinel role [17] and more diffuse lymphoid tissue and unorganized lymphoid follicles are present both in the mucosa and submucosa of the cecal tonsil in the broiler [29]. The intestinal immunity can be divided into innate and specific (adaptive) defenses [30]. The innate immune system recognizes pathogens by means of certain conserved structural features (also called pathogen-associated molecular patterns) of the microbes such as lipopolysaccharides (LPSs), major components of the outer membrane of Gram-negative bacteria [31,32]. It is possible that bacterial products penetrate the epithelial barrier, either due to damage or via paracellular pathways, to directly stimulate the underlying constituents of the mucosal immune system [33]. A variety of studies have provided increasing evidence that the surface epithelium serves a critical function as the defensive front line of the mucosal innate immune system in the gastrointestinal tract [34]. The intestinal epithelial cells can produce a marked effect in the intestinal mucosal immune system, and influence antigen presentation to LPL, even without direct contact [35]. Also, it has been proven that various intestinal epithelial cell lines constitutively express several members of a novel family of transmembrane receptors designated Toll-Like Receptors (TLRs) which may serve as a major link between innate and adaptive mucosal immune responses [36].
The gastrointestinal tract is one of the main ways that metals (including Ni) are absorbed [37], since the tract is exposed to the highest concentrations of metals due to the daily food or water consumption. Some studies in experimental animals and humans have shown that Ni intake causes immune toxicity [5,38] and dietary nickel chloride (NiCl2) induces intestinal oxidative damage, inhibits the intestinal development and decreases the serum cytokine contents in broilers [39,40,41].
In view of the abovementioned references, there have been no studies on the effects of Ni or Ni compounds on the TLR2 (TLR2-2) and TLR4 mRNA expression levels in the intestinal mucosa of animals and human so far. The aims of the present study were therefore to investigate the changes of TLR2 and TLR4 mRNA expression levels in the intestinal mucosa and the cecal tonsil in broilers induced by dietary NiCl2 using quantitative real-time polymerase chain reaction (qRT-PCR) assays, and to provide new experimental evidences for understanding the mechanism of the effects of NiCl2 or Ni on the innate immune responses.

2. Materials and Methods

2.1. Chickens and Diets

Two hundred and forty one-day-old healthy avian broilers were randomly divided into four groups with 60 broilers in each group. Broilers were housed in cages with electrically heated units and were provided with water as well as undermentioned experimental diets ad libitum for 42 days. A corn-soybean basal diet formulated by the National Research Council [42] was the control diet. NiCl2·6H2O was mixed into the corn-soybean basal diet to produce experimental diets with 300, 600 and 900 mg/kg of NiCl2, respectively.

2.2. Detection of TLR2 and TLR4 mRNA Expression Levels in the Intestinal Mucosa and the Cecal Tonsil by qRT-PCR

At 14, 28, and 42 days of age during the experiment, five broilers in each group were humanely killed and the intestinal tract were immediately removed and chilled to 0 °C in 0.85% sodium chloride (NaCl) solution, and the small intestine was divided into duodenum, jejunum and ileum. An approximately 4 cm intestinal segment was collected from the middle section of each intestinal region, and then was dissected and thoroughly cleaned with 0.85% NaCl solution. The mucosa was carefully scraped from the luminal face of the taken intestinal segments and stored in liquid nitrogen prior to the measurement. The cecal tonsils from the same five broilers in each group were also stored in liquid nitrogen for measurement.
The duodenal, jejunal and ileac mucosa and the cecal tonsils were crushed with liquid nitrogen by pestle until they turned into a homogeneous powder. Total RNA was extracted from the powder of the mucosa and the cecal tonsils using RNAiso Plus (9108/9109, Takara, Kyoto, Japan). The mRNA was then reverse transcribed into cDNA using PrimScriptTM RT reagent Kit with gDNA Eraser (RR047A, Takara) [43]. The cDNA was used as a template for quantitative real-time PCR analysis. Sequences for primers of TLR2-2 and TLR4 were obtained from Genbank and NCBI. Primers were designed using Primer 5 and synthesized at BGI Tech (Shenzhen, China), as shown in Table 1.
Table 1. A list of oligonucleotides used as primers in qRT-PCR analysis of mRNA expression in the intestinal mucosa and the cecal tonsil.
Table 1. A list of oligonucleotides used as primers in qRT-PCR analysis of mRNA expression in the intestinal mucosa and the cecal tonsil.
Gene SymbolAccession NumberPrimerPrimer Sequence (5′ → 3′)
TLR2-2AB046533FAGGCACTTGAGATGGAGCAC
RCCTGTTATGGGCCAGGTTTA
TLR4AY064697FAGTCTGAAATTGCTGAGCTCAAAT
RGCGACGTTAAGCCATGGAAG
β-ActinL08165FTGCTGTGTTCCCATCTATCG
RTTGGTGACAATACCGTGTTCA
For qRT-PCR reactions, 25 µL mixtures were made by using SYBR® Premix Ex TaqTM II (DRR820A, Takara), containing 12.5 µL Tli RNaseH Plus, 1.0 µL of forward and 1.0 µL of reverse primer, 8.5 µL RNAase-free water and 2 µL cDNA. Reaction conditions were set to 3 min at 95 °C (first segment, one cycle), 10 s at 95 °C and 30 s at Tm of a specific primer pair (second segment, 44 cycles) followed by 10 s at 95 °C, and 72 °C for 10 s (dissociation curve segment) using Thermal Cycler (C1000, BioRad, Hercules, CA, USA). Gene expression was analyzed for 2 genes, and β-Actin was used as an internal control gene. Gene expression values at 14, 28 and 42 days of age were used for gene expression calibration, respectively. With 2−ΔΔCT assay, the results were analyzed.

2.3. Statistical Analysis

Data of the control and three NiCl2 groups were statistically evaluated with the SPSS/16.0 software package for Windows. Hypothesis testing methods included one way analysis of variance (ANOVA) followed by least significant difference test. p < 0.05 was considered as statistical significance. All results were expressed as means ± standard deviation (x ± SD), representing five broilers in each group.

3. Results

3.1. Changes of the TLR2-2 mRNA Expression Levels

Figure 1, Figure 2, Figure 3 and Figure 4 show that the TLR2 mRNA expression levels in the duodenum and jejunum were significantly decreased (p < 0.05) in the 900 mg/kg group at 14 days of age and were significantly decreased (p < 0.05 or p < 0.01) in the 300, 600 and 900 mg/kg groups when compared with those of the control group at 28 days of age and 42 days of age. The TLR2 mRNA expression levels in the ileum were significantly decreased (p < 0.05 or p < 0.01) in the 300, 600 and 900 mg/kg groups from 14 days of age to 42 days of age.
Figure 1. The TLR2-2 mRNA expression levels in the duodenal mucosa in broilers.
Figure 1. The TLR2-2 mRNA expression levels in the duodenal mucosa in broilers.
Note: Data are presented with the means ± standard deviation (n = 5); * p < 0.05, compared with the control group; ** p < 0.01, compared with the control group.
Figure 2. The TLR2-2 mRNA expression levels in the jejunal mucosa in broiler.
Figure 2. The TLR2-2 mRNA expression levels in the jejunal mucosa in broiler.
Note: Data are presented with the means ± standard deviation (n = 5); * p < 0.05, compared with the control group; ** p < 0.01, compared with the control group.
Figure 3. The TLR2-2 mRNA expression levels in the ileac mucosa in broilers.
Figure 3. The TLR2-2 mRNA expression levels in the ileac mucosa in broilers.
Note: Data are presented with the means ± standard deviation (n = 5); * p < 0.05, compared with the control group; ** p < 0.01, compared with the control group.
Figure 4. The TLR2-2 mRNA expression levels in the cecal tonsil in broilers.
Figure 4. The TLR2-2 mRNA expression levels in the cecal tonsil in broilers.
Note: Data are presented with the means ± standard deviation (n = 5); * p < 0.05, compared with the control group; ** p < 0.01, compared with the control group.
The TLR2 mRNA expression levels in the cecal tonsil were lower (p < 0.05 or p < 0.01) in the 600 and 900 mg/kg groups at 14 days of age and were significantly lower (p < 0.01) in the 300 mg/kg, 600 mg/kg and 900 mg/kg groups at 28 days of age and 42 days of age than those in the control group.

3.2. Changes of the TLR4 mRNA Expression Levels

The TLR4 mRNA expression levels in the duodenum and jejunum were significantly decreased (p < 0.05 or p < 0.01) in the 900 mg/kg group at 14 days of age and were significantly decreased (p < 0.01) in the 300, 600 and 900 mg/kg groups when compared with those of the control group at 28 days of age and 42 days of age. The TLR4 mRNA expression levels in the ileum were significantly decreased (p < 0.01) in the 300, 600 and 900 mg/kg groups at 28 days of age and 42 days of age. The TLR4 mRNA expression levels in the cecal tonsil were lower (p < 0.05 or p < 0.01) in the 600 and 900 mg/kg groups at 14 days of age and were significantly lower (p < 0.01) in the 300, 600 and 900 mg/kg groups from 28 to 42 days of age than those in the control group. The results are shown in Figure 5, Figure 6, Figure 7 and Figure 8.
Figure 5. The TLR4 mRNA expression levels in the duodenal mucosa in broilers.
Figure 5. The TLR4 mRNA expression levels in the duodenal mucosa in broilers.
Note: Data are presented with the means ± standard deviation (n = 5); * p < 0.05, compared with the control group; ** p < 0.01, compared with the control group.
Figure 6. The TLR4 mRNA expression levels in the jejunal mucosa in broilers.
Figure 6. The TLR4 mRNA expression levels in the jejunal mucosa in broilers.
Note: Data are presented with the means ± standard deviation (n = 5); * p < 0.05, compared with the control group; ** p < 0.01, compared with the control group.
Figure 7. The TLR4 mRNA expression levels in the ileac mucosa in broilers.
Figure 7. The TLR4 mRNA expression levels in the ileac mucosa in broilers.
Note: Data are presented with the means ± standard deviation (n = 5); * p < 0.05, compared with the control group; ** p < 0.01, compared with the control group.
Figure 8. The TLR4 mRNA expression levels in the cecal tonsil in broilers.
Figure 8. The TLR4 mRNA expression levels in the cecal tonsil in broilers.
Note: Data are presented with the means ± standard deviation (n = 5); * p < 0.05, compared with the control group; ** p < 0.01, compared with the control group.

4. Discussion

In the present study, TLR2-2 and TLR4 mRNA expression level changes induced by NiCl2 (Ni2+) were analyzed in the intestinal mucosa and cecal tonsil of broilers. It is reported that Ni2+ can directly trigger an innate immune response in resident skin cells that is necessary for mounting an allergic hypersensitivity reaction to Ni2+ [44], and Ni may interact with TLR signal transduction, a critical pathway involved in the sensing of pathogen-associated molecular patterns and the production of proinflammatory mediators, a process dependent on induction of NF-κB activation. NF-κB proteins are regulators of the immune, inflammatory, stress, proliferative and apoptotic responses of a cell to a very large number of different stimuli [15,45,46]. It seems that the down-regulation of the (TLR2-2) and TLR4 reflects the consequences of the interaction of intestinal cells (especially the epithelial cells) with NiCl2 and may be involved in mechanism of the effect of NiCl2 or Ni on the innate immune responses.
Upon recognition of microbes, dendritic cells (DCs)4 produce inflammatory cytokines that induce innate responses and up-regulate their costimulatory molecules to promote adaptive immunity [47]. Recognition of microbes is mediated by pattern recognition receptors (PRRs), including the TLR family [48]. In the chicken, TLR2 and TLR4 have been identified and characterised at the molecular and functional levels [49,50,51]. It is reported that TLR2 and TLR4 play important roles in the mucosal epithelial barrier function [52,53]. In the present study our attention was concentrated on the expression of TLR2 (TLR2-2) and TLR4 and its role in the innate immunity. Down-regulation of TLR2 (TLR2-2) and TLR4 mRNA expression levels in the intestinal mucosa and the cecal tonsil were observed in the 300, 600 and 900 mg/kg groups, indicating that the mucosal epithelial barrier function or immune function may be impaired by dietary NiCl2.
TLR2 as an important TLR that can control mucosal inflammation by regulating epithelial barrier function [52], and NiSO4 alters the pattern of TLR-2–dependent chemokine release from human lung fibroblasts (HLF) via a COX-2–mediated pathway [54]. TLR2 can also induce cell apoptosis through MyD88 via a pathway involving Fas-associated death domain protein (FADD) and caspase 8 [55]. The functional properties of type 2 TLR2 (TLR2-2) are similar to those of mouse and human TLR2 [50]. In the present study, TLR2-2 mRNA expression levels in the intestinal mucosa and the cecal tonsil were decreased in the 300, 600 and 900 mg/kg groups, which implied that dietary NiCl2 in excess of 300 mg/kg could impact the epithelial barrier function of the intestinal mucosa and decrease the ability of TLR2 in response to the antigens, and at last the innate immune system in the intestinal mucosa was impaired. Moreover, we found statistically significant down-regulation of TLR4 expression in the small intestine and the cecal tonsil in broilers. TLR4 has been genetically identified as an essential and nonredundant component of the LPS receptor signaling complex that controls innate immune responses in vivo [56,57,58]. TLR4 signaling has been divided into MyD88-dependent (responsible for proinflammatory cytokine expression) and MyD88-independent (TRIF-dependent) pathways (that mediate the induction of Type I interferons and interferon-inducible genes) [59,60]. LPS activates the MyD88/IRAK (IL-1 receptor-associated kinase) signaling cascade in monocytic and in endothelial cells [61]. Structurally, some findings suggest that Ni may directly bridge two adjacent TLR4 molecules, allowing a dimer formation similar to that induced by LPS, which is sufficient for signal transduction [62]. TLR4, as the receptor for the bacterial membrane component LPS, has been identified as the crucial mediator of the innate immune response to Ni2+, demonstrating that Ni2+ employs signaling components of the bacterial defense system to elicit its allergic reactions [44]. In the present study, TLR4 mRNA expression levels in the intestinal mucosa and the cecal tonsil were decreased in the 300, 600 and 900 mg/kg groups, demonstrating that dietary NiCl2 in excess of 300 mg/kg can impact the innate immune system in the intestinal mucosa, and it may related to the inhibition of the two signaling pathways of TLR4, and at last the signal transduction is inhibited by dietary NiCl2 (Ni2+).
Based on the results of our study, we can suggest that NiCl2 (Ni2+) can interact with TLR signal transduction through NF-κB activation, and it is reported that the common downstream signaling pathway of TLR2 and TLR4 leads to the activation of NF-kB through myeloid differentiation protein (MyD88) and IL-1 receptor-associated kinase in various cell types [63,64,65]. It seems that NF-κB activation or other related protein or receptors may be inhibited by NiCl2 (Ni2+). Furthermore, to our knowledge, the down-expression of TLR2-2 and TLR4 is possibility associated with the lesions of intestine and cecal tonsil and the cytokines secretion. Lesions in the small intestine and cecal tonsil induced by dietary NiCl2 have been observed in our recent research [39,40,66], including the oxidative stress and apoptosis induced by NiCl2. The lesions can cause decrease in epithelial cells or other cells in the small intestine and cecal tonsil, which leads down-regulation in the expression of TLR2-2 and TLR4. Meanwhile, the expression of TLR related to the cytokines. It was observed in the present study that dietary NiCl2 in excess of 300 mg/kg could inhibit certain cytokines secretion. Therefore, decreased cytokines contents could inhibit the activity of intestinal cells, and lead the expression of TLR2 and TLR4 down-regulation finally. Another pathway that is demonstrated to be influenced by Ni2+ is the death receptor-mediated or extrinsic apoptosis pathway [67] of the intestinal cells, which may related to the down-regulation in the expression of TLR2-2 and TLR4.

5. Conclusions

According to the results described in the present study and the aforementioned discussion, it is concluded that dietary NiCl2 in excess of 300 mg/kg reduces TLR2-2 and TLR4 mRNA expression levels in the intestinal mucosal and cecal tonsil, which indicates that the function of the defensive front line of the mucosal innate immune system in the intestine, and the innate mucosal immune responses may be impaired in broilers. Decrease in mRNA expression levels of TLR2-2 and TLR4 of intestinal mucosa (duodenum, jejunum and ileum) and cecal tonsil induced by NiCl2 is closely related to the injured surface epithelium cells or/and the inhibition of the TLR signal transduction. Further studies are required to reach a more defined elucidation of the mechanisms involved in these complex processes.

Acknowledgments

Bangyuan Wu and Hengmin Cui designed the research; Bangyuan Wu, Xi Peng, Jing Fang, Zhicai Zuo, Junliang Deng and Jianying Huang performed the research; Bangyuan Wu analyzed the data; Bangyuan Wu wrote the paper. The study was supported by the program for Changjiang scholars and innovative research team in university (IRT 0848) and the Education Department (09ZZ017) and Scientific Department of Sichuan Province.

Conflicts of Interest

The authors declare no conflict of interest. Our experiments involving the use of broilers, and the use of chickens and all experimental procedures involving animals were approved by Sichuan Agricultural University Animal Care and Use Committee.

References

  1. Grandjean, P. Human exposure to Ni. IARC Sci. Publ. 1984, 53, 469–485. [Google Scholar]
  2. Marzec, Z. Alimentary chromium, Ni, and selenium intake of adults in Poland estimated by analysis and calculations using the duplicate portion technique. Nahrung 2004, 48, 47–52. [Google Scholar] [CrossRef]
  3. Spears, J.W. Ni is a “newer trace element” in the nutrition of domestic animals. J. Anim. Sci. 1984, 59, 823–835. [Google Scholar]
  4. Samal, L.; Mishra, C. Significance of Ni in livestock health and production. IJAVMS 2011, 5, 349–361. [Google Scholar] [CrossRef]
  5. Kasprzak, K.S.; Sunderman, F.W., Jr.; Salnikow, K. Ni carcinogenesis. Mutat. Res. Fundam. Mol. Mech. Mutagen. 2003, 533, 67–97. [Google Scholar] [CrossRef]
  6. Lidén, C.; Carter, S. Ni release from coins. Contact Dermatitis 2001, 44, 160–165. [Google Scholar] [CrossRef]
  7. Lidén, C.; Skare, L.; Vahter, M. Release of Ni from coins and deposition onto skin from coin handling-comparing euro coins and SEK. Contact Dermatitis 2008, 59, 31–37. [Google Scholar] [CrossRef]
  8. Shen, H.M.; Zhang, Q.F. Risk assessment of Ni carcinogenicity and occupational lung cancer. Environ.Health Perspect. 1994, 102, 275–282. [Google Scholar] [CrossRef]
  9. Costa, M.; Zhuang, Z.X.; Huang, X.; Cosentino, S.; Klein, C.B.; Salnikow, K. Molecular mechanisms of Ni carcinogenesis. Sci. Total Environ. 1994, 148, 191–199. [Google Scholar] [CrossRef]
  10. Oller, A.R.; Costa, M.; Oberdorster, G. Carcinogenicity assessment of selected Ni compounds. Toxicol. Appl. Pharm. 1997, 143, 152–166. [Google Scholar] [CrossRef]
  11. Schaumloffel, D. Ni species: Analysis and toxic effects. J. Trace Elem. Med. Biol. 2012, 26, 1–6. [Google Scholar] [CrossRef]
  12. Anke, M.; Groppel, B.; Krause, U.; Langer, M. Further Data on the Biological Essentiality of Nickel. In Trace Elements in Man and Animals 6; Hurley, L.S., Keen, C.L., Lonnerdal, B., Rucker, R.B., Eds.; Plenum: New York, NY, USA, 1988. [Google Scholar]
  13. Ling, J.R.; Leach, M., Jr. Studies on nickel metabolism: Interaction with other elements. Poult. Sci. 1979, 58, 591–596. [Google Scholar] [CrossRef]
  14. Schmidt, M.; Raghavan, B.; Müller, V.; Vogl, T.; Fejer, G.; Tchaptchet, S.; Keck, S.; Kalis, C.; Nielsen, P.J.; Galanos, C.; et al. Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel. Nat. Immunol. 2010, 11, 814–819. [Google Scholar] [CrossRef]
  15. Kopp, E.B.; Medzhitov, R. The toll-receptor family and control of innate immunity. Curr. Opin. Immunol. 1999, 11, 13–18. [Google Scholar] [CrossRef]
  16. Zarember, K.A.; Godowski, P.J. Tissue expression of human toll-like receptors and differential regulation of toll-like receptor mRNAs in leukocytes in response to microbes, their products, and cytokine. J. Immunol. 2002, 168, 554–561. [Google Scholar]
  17. Humberd, J.; Boyd, K.; Webster, R.G. Emergence of influenza A virus variants after prolonged shedding from pheasants. J. Virol. 2007, 81, 4044–4051. [Google Scholar] [CrossRef]
  18. Chung, C.S.; Song, G.Y.; Moldawer, L.L.; Chaudry, I.H.; Ayala, A. Neither Fas ligand nor endotoxin is responsible for inducible peritoneal phagocyte apoptosis during sepsis/peritonitis. J. Surg. Res. 2000, 91, 147–153. [Google Scholar] [CrossRef]
  19. Medvedev, A.E.; Kopydlowski, K.M.; Vogel, S.N. Inhibition of lipopolysaccharide-induced signal transduction in endotoxin-tolerized mouse macrophages: Dysregulation of cytokine, chemokine, and toll-like receptor 2 and 4 gene expression. J. Immunol. 2000, 164, 5564–5574. [Google Scholar]
  20. Sato, S.; Nomura, F.; Kawai, T.; Takeuchi, O.; Mühlradt, P.F.; Takeda, K.; Akira, S. Synergy and cross-tolerance between toll-like receptor (TLR) 2-and TLR4-mediated signaling pathways. J. Immunol. 2000, 165, 7096–7101. [Google Scholar]
  21. Thoma-Uszynski, S.; Kiertscher, S.M.; Ochoa, M.T.; Bouis, D.A.; Norgard, M.V.; Miyake, K.; Godowski, P.J.; Roth, M.D.; Modlin, R.L. Activation of toll-like receptor 2 on human dendritic cells triggers induction of IL-12, but not IL-10. J. Immunol. 2000, 165, 3804–3810. [Google Scholar]
  22. Wang, Q.; Dziarski, R.; Kirschning, C.J.; Muzio, M.; Gupta, D. Micrococci and peptidoglycan activate TLR2→MyD88→IRAK→TRAF→NIK→IKK→NF-κB signal transduction pathway that induces transcription of interleukin-8. Infect. Immun. 2001, 69, 2270–2276. [Google Scholar] [CrossRef]
  23. Anderson, K.V.; Jurgens, G.; Nusslein-Volhard, C. Establishment of dorsal-ventral polarity in the Drosophila embryo: Genetic studies on the role of the Toll gene product. Cell 1985, 42, 779–789. [Google Scholar] [CrossRef]
  24. Halfon, M.S.; Hashimoto, C.; Keshishian, H. The Drosophila toll gene functions zygotically and is necessary for proper motoneuron and muscle development. Dev. Biol. 1995, 169, 151–167. [Google Scholar] [CrossRef]
  25. Keith, F.J.; Gay, N.J. The Drosophila membrane receptor Toll can function to promote cellular adhesion. EMBO J. 1990, 9, 4299–4306. [Google Scholar]
  26. Hajjar, A.M.; O’Mahony, D.S.; Ozinsky, A.; Underhill, D.M.; Aderem, A.; Klebanoff, S.J.; Wilson, C.B. Cutting edge: Functional interactions between Toll-like receptor (TLR) 2 and TLR1 or TLR6 in response to phenolsoluble modulin. J. Immunol. 2001, 166, 15–19. [Google Scholar]
  27. Ozinsky, A.; Underhill, D.M.; Fontenot, J.D.; Hajjar, A.M.; Smith, K.D.; Wilson, C.B.; Schroeder, L.; Aderem, A. The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation between Toll-like receptors. Proc. Natl. Acad. Sci. USA 2000, 97, 13766–13771. [Google Scholar] [CrossRef]
  28. Ulevitch, R.J. Immunology: Toll gates for pathogen selection. Nature 1999, 401, 755–756. [Google Scholar] [CrossRef]
  29. Akter, S.; Khan, M.Z.I.; Jahan, M.R.; Karim, M.R.; Islam, M.R. Histomorphological study of the lymphoid tissues of broiler chickens. Bangladesh J. Vet. Med. 2006, 4, 87–92. [Google Scholar]
  30. Jeurissen, S.H.M.; Veldman, B. The Interactions between Feed (Components) and Eimeria Infections in Poultry Health. In Nutrion and Health of the Gastrointestinal Tract; Blok, M.C., Vahl, H.A., de Lange, L., van de Braak, A.E., Hemke, G., Hessing, M., Eds.; Wageningen Academic Publishers: Haarlem, Netherlands, 2002; pp. 159–182. [Google Scholar]
  31. Rietschel, E.T.; Brade, H. Bacterial endotoxins. Sci. Amer. 1992, 267, 54–61. [Google Scholar] [CrossRef]
  32. Medzhitov, R.; Janaway, C.A. Innate immunity: The virtues of nonclonal system of recognition. Cell 1997, 91, 295–298. [Google Scholar] [CrossRef]
  33. Cario, E.; Podolsky, D.K. Differential alteration in intestinal epithelial cell expression of toll-like receptor 3 (TLR3) and TLR4 in inflammatory bowel disease. Infect. Immun. 2000, 68, 7010–7017. [Google Scholar] [CrossRef]
  34. Mayer, L.; Eisenhardt, D.; Salomon, P.; Bauer, W.; Plous, R.; Piccini, I. Expression of class II molecules on intestinal epithelial cells in humans: Differences between normal and inflammatory bowel disease. Gastroenterology 1991, 100, 3–12. [Google Scholar]
  35. Hecht, G.A. Microbial Pathogenesis and the Intestinal Epithelial Cell; ASM American Society for Microbiology: Washington, DC, USA, 2003; pp. 61–72. [Google Scholar]
  36. Cario, E.; Rosenberg, I.M.; Brandwein, S.L.; Beck, P.L.; Reinecker, H.C.; Podolsky, D.K. Lipopolysaccharide activates distinct signaling pathways in intestinal epithelial cell lines expressing Toll-like receptors. J. Immunol. 2000, 164, 966–972. [Google Scholar]
  37. Kostial, K.; Kargačin, B.; Landeka, M. Gut retention of metals in rats. Biol. Trace Elem. Res. 1989, 21, 213–218. [Google Scholar] [CrossRef]
  38. Denkhaus, E.; Salnikow, K. Ni essentiality, toxicity, and carcinogenicit. Crit. Rev. Oncol. Hematol. 2002, 42, 35–56. [Google Scholar] [CrossRef]
  39. Wu, B.Y.; Cui, H.M.; Peng, X.; Fang, J.; Zuo, Z.C.; Deng, J.L.; Huang, J.Y. Dietary Ni chloride induces oxidative intestinal damage in broilers. Int. J. Environ. Res. Public Health 2013, 10, 2109–2119. [Google Scholar] [CrossRef]
  40. Wu, B.Y.; Cui, H.M.; Peng, X.; Fang, J.; Zuo, Z.C.; Deng, J.L.; Huang, J.Y. Dietary nickel chloride restrains the development of small intestine in broilers. Biol. Trace Elem. Res. 2013, 155, 236–246. [Google Scholar] [CrossRef]
  41. Wu, B.Y.; Cui, H.M.; Peng, X.; Fang, J.; Zuo, Z.C.; Deng, J.L.; Huang, J.Y. Changes of the serum cytokine contents in broilers fed on diets supplemented with nickel chloride. Biol. Trace Elem. Res. 2013, 151, 234–239. [Google Scholar] [CrossRef]
  42. National Research Council (NRC). Nutrient Requirements of Poultry, 9th ed.; National Academy Press: Washington, DC, USA, 1994. [Google Scholar]
  43. Iqbal, M.; Philbin, V.J.; Smith, A.L. Expression patterns of the Toll-like receptor mRNA in tissues, immune cell subsets and cell lines. Vet. Immunol. Immunopathol. 2005, 104, 117–127. [Google Scholar] [CrossRef]
  44. Schmidt, M.; Goebeler, M. Ni allergies: Paying the toll for innate immunity. J. Mol. Med. 2011, 89, 961–970. [Google Scholar] [CrossRef]
  45. Roediger, B.; Weninger, W. How Ni turns on innate immune cells. Immunol. Cell Biol. 2010, 89, 1–2. [Google Scholar] [CrossRef]
  46. Campbell, K.; Perkins, N. Regulation of NF-κB function. Biochem. Soc. Symp. 2006, 73, 165–180. [Google Scholar]
  47. Banchereau, J.; Steinman, R.M. Dendritic cells and the control of immunity. Nature 1998, 392, 245–252. [Google Scholar] [CrossRef]
  48. Akira, S.; Takeda, K. Toll-like receptor signalling. Nat. Rev. Immunol. 2004, 4, 499–511. [Google Scholar] [CrossRef]
  49. Boyd, Y.; Goodchild, M.; Morroll, S.; Bumstead, N. Mapping of the chicken and mouse genes for toll-like receptor 2 (TLR2) to an evolutionarily conserved chromosomal segment. Immunogenetics 2001, 52, 294–298. [Google Scholar] [CrossRef]
  50. Fukui, A.; Inoue, N.; Matsumoto, M.; Nomura, M.; Yamada, K.; Matsuda, Y.; Toyoshima, K.; Seya, T. Molecular cloning and functional characterization of chicken toll-like receptors. A single chicken toll covers multiple molecular patterns. J. Biol. Chem. 2001, 276, 47143–47149. [Google Scholar]
  51. Leveque, G.; Forgetta, V.; Morroll, S.; Smith, A.L.; Bumstead, N.; Barrow, P.; Loredo-Osti, J.C.; Morgan, K.; Malo, D. Allelic variation in TLR4 is linked to susceptibility to Salmonella enterica serovar Typhimurium infection in chickens. Infect. Immun. 2003, 71, 1116–1124. [Google Scholar] [CrossRef]
  52. Cario, E.; Gerken, G.; Podolsky, D.K. Toll-like receptor 2 controls mucosal inflammation by regulating epithelial barrier function. Gastroenterology 2007, 132, 1359–1374. [Google Scholar] [CrossRef]
  53. Hausmann, M.; Kiessling, S.; Mestermann, S.; Webb, G.; Spöttl, T.; Andus, T.; Schölmerich, J.; Herfarth, H.; Ray, K.; Falk, W.; et al. Toll-like receptors 2 and 4 are up-regulated during intestinal inflammation. Gastroenterology 2002, 122, 1987–2000. [Google Scholar] [CrossRef]
  54. Brant, K.A.; Fabisiak, J.P. Ni Alterations of TLR2-dependent chemokine profiles in lung fibroblasts are mediated by COX-2. Am. J. Respir. Cell Mol. Biol. 2008, 38, 591–599. [Google Scholar] [CrossRef]
  55. Aliprants, A.O.; Yang, R.B.; Weiss, D.S.; Godowski, P.; Zychlinsky, A. The apoptotic signaling pathway activated by Toll-like receptor-2. EMBO J. 2000, 19, 3325–3336. [Google Scholar] [CrossRef]
  56. Hoshino, K.; Takeuchi, O.; Kawai, T.; Sanjo, H.; Ogawa, T.; Takeda, Y.; Takeda, K.; Akira, S. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: Evidence for TLR4 as the Lps gene product. J. Immunol. 1999, 162, 3749–3752. [Google Scholar]
  57. Poltorak, A.; He, X.; Smirnova, I.; Liu, M.Y.; van Huffel, C.; Du, X.; Birdwell, D.; Alejos, E.; Silva, M.; Galanos, C.; et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: Mutations in the Tlr4 gene. Science 1998, 282, 2085–2088. [Google Scholar] [CrossRef]
  58. Chow, J.C.; Young, D.W.; Golenbock, D.T.; Christ, W.J.; Gusovsky, F. Toll-like receptor-4 mediates lipopolysaccharide-induced signal transduction. J. Biol. Chem. 1999, 274, 10689–10692. [Google Scholar]
  59. Lu, Y.C.; Yeh, W.C.; Ohashi, P.S. LPS/TLR4 signal transduction pathway. Cytokine 2008, 42, 145–151. [Google Scholar] [CrossRef]
  60. Muzio, M.; Natoli, G.; Saccani, S.; Levrero, M.; Mantovani, A. The human Toll signaling pathway: Divergence of nuclear factor kB and JNK/SAPK activation upstream of tumor necrosis factor receptor-associated factor 6 (TRAF6). J. Exp. Med. 1998, 187, 2097–2101. [Google Scholar] [CrossRef]
  61. Zhang, F.X.; Kirscning, C.; Mancinelli, R.; Jin, Y.; Mantovani, A.; Faure, E.; Rothe, M.; Muzio, M.; Arditi, M. Bacterial lipopolysaccharide activates nuclear factor-kB through interleukin-1 signaling mediators in cultured human dermal endothelial cells and human mononuclear phagocytes. J. Biol. Chem. 1999, 274, 7611–7614. [Google Scholar] [CrossRef]
  62. Rothenberg, M.E. Innate sensing of Ni. Nat. Immunol. 2010, 11, 781–782. [Google Scholar] [CrossRef]
  63. Medzhitov, R.; Preston-Hurlburt, P.; Kopp, E.; Stadlen, A.; Chen, C.; Ghosh, S.; Janeway, C.A., Jr. MyD88 is an adaptor protein in the hToll/IL-1 receptor family signaling pathways. Mol. Cell 1998, 2, 253–258. [Google Scholar] [CrossRef]
  64. Medzhitov, R.; Janeway, C. Innate immunity. N. Engl. J. Med. 2000, 343, 338–344. [Google Scholar] [CrossRef]
  65. Anderson, K.V. Toll signaling pathways in the innate immune response. Curr. Opin. Immunol. 2000, 12, 13–19. [Google Scholar] [CrossRef]
  66. Wu, B.Y.; Cui, H.M.; Peng, X.; Fang, J.; Zuo, Z.C.; Deng, J.L.; Huang, J.Y. Dietary nickel chloride induces oxidative stress, apoptosis and alters Bax/Bcl-2 and caspase-3 mRNA expression in the cecal tonsil of broilers. Food Chem. Toxicol. 2014, 63, 18–29. [Google Scholar] [CrossRef]
  67. Fas, S.C.; Fritzsching, B.; Suri-Payer, E.; Krammer, P.H. Death receptor signaling and its function in the immune system. Curr. Dir. Autoimmun. 2006, 9, 1–17. [Google Scholar]

Share and Cite

MDPI and ACS Style

Wu, B.; Cui, H.; Peng, X.; Fang, J.; Zuo, Z.; Deng, J.; Huang, J. Analysis of the Toll-Like Receptor 2-2 (TLR2-2) and TLR4 mRNA Expression in the Intestinal Mucosal Immunity of Broilers Fed on Diets Supplemented with Nickel Chloride. Int. J. Environ. Res. Public Health 2014, 11, 657-670. https://doi.org/10.3390/ijerph110100657

AMA Style

Wu B, Cui H, Peng X, Fang J, Zuo Z, Deng J, Huang J. Analysis of the Toll-Like Receptor 2-2 (TLR2-2) and TLR4 mRNA Expression in the Intestinal Mucosal Immunity of Broilers Fed on Diets Supplemented with Nickel Chloride. International Journal of Environmental Research and Public Health. 2014; 11(1):657-670. https://doi.org/10.3390/ijerph110100657

Chicago/Turabian Style

Wu, Bangyuan, Hengmin Cui, Xi Peng, Jing Fang, Zhicai Zuo, Junliang Deng, and Jianying Huang. 2014. "Analysis of the Toll-Like Receptor 2-2 (TLR2-2) and TLR4 mRNA Expression in the Intestinal Mucosal Immunity of Broilers Fed on Diets Supplemented with Nickel Chloride" International Journal of Environmental Research and Public Health 11, no. 1: 657-670. https://doi.org/10.3390/ijerph110100657

APA Style

Wu, B., Cui, H., Peng, X., Fang, J., Zuo, Z., Deng, J., & Huang, J. (2014). Analysis of the Toll-Like Receptor 2-2 (TLR2-2) and TLR4 mRNA Expression in the Intestinal Mucosal Immunity of Broilers Fed on Diets Supplemented with Nickel Chloride. International Journal of Environmental Research and Public Health, 11(1), 657-670. https://doi.org/10.3390/ijerph110100657

Article Metrics

Back to TopTop