Regulatory B Lymphocytes Colonize the Respiratory Tract of Neonatal Mice and Modulate Immune Responses of Alveolar Macrophages to RSV Infection in IL-10-Dependant Manner
Abstract
:1. Introduction:
2. Materials and Methods
2.1. Reagents
2.2. Mice and Viral Infection
2.3. Sample Collection
2.4. Viral N-RSV RNA Load and Gene Expression by Quantitative RT-PCR (qRT-PCR)
2.5. Bioluminescence Measurements
2.6. Cellular Culture and Infection
2.7. Flow Cytometry
2.8. Measure of Cytokine Concentration by Multiplex Analysis
2.9. Statistical Analysis
3. Results
3.1. Regulatory CD5+ B Lymphocytes Colonize the Respiratory Tract of Neonatal Mice at a Very Early Stage
3.2. Neonatal Mice Are Highly Permissive to RSV Infection in Combination with Inadequate Type-I Interferon (IFN-I) Production
3.3. Neonatal Primary Alveolar Macrophages (AMs) Are Able to Mount Anti-Viral and Inflammatory Responses upon In Vitro RSV Infection
3.4. IFN-I Produced by Neonatal Primary AMs Enhance the Secretion of IL-10 by CD5+ nBreg upon Infection with RSV
3.5. IL-10 Exerts Strong Modulatory Effects on the Response of Neonatal AMs to RSV Infection
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Shi, T.; McAllister, D.A.; O’Brien, K.L.; Simoes, E.A.F.; Madhi, S.A.; Gessner, B.D.; Polack, F.P.; Balsells, E.; Acacio, S.; Aguayo, C.; et al. Global, regional, and national disease burden estimates of acute lower respiratory infections due to respiratory syncytial virus in young children in 2015: A systematic review and modelling study. Lancet 2017, 390, 946–958. [Google Scholar] [CrossRef] [Green Version]
- Backman, K.; Piippo-Savolainen, E.; Ollikainen, H.; Koskela, H.; Korppi, M. Adults face increased asthma risk after infant RSV bronchiolitis and reduced respiratory health-related quality of life after RSV pneumonia. Acta Paediatr. 2014, 103, 850–855. [Google Scholar] [CrossRef]
- Malinczak, C.A.; Lukacs, N.W.; Fonseca, W. Early-Life Respiratory Syncytial Virus Infection, Trained Immunity and Subsequent Pulmonary Diseases. Viruses 2020, 12, 505. [Google Scholar] [CrossRef]
- Drajac, C.; Laubreton, D.; Riffault, S.; Descamps, D. Pulmonary Susceptibility of Neonates to Respiratory Syncytial Virus Infection: A Problem of Innate Immunity? J. Immunol. Res. 2017, 2017, 8734504. [Google Scholar] [CrossRef] [PubMed]
- Hu, M.; Bogoyevitch, M.A.; Jans, D.A. Impact of Respiratory Syncytial Virus Infection on the Host Cell: Implications for Antiviral Strategies. Physiol. Rev. 2020, 100, 1527–1594. [Google Scholar] [CrossRef] [PubMed]
- Cormier, S.A.; You, D.; Honnegowda, S. The use of a neonatal mouse model to study respiratory syncytial virus infections. Expert Rev. Anti Infect. Ther. 2010, 8, 1371–1380. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Culley, F.J.; Pollott, J.; Openshaw, P.J. Age at first viral infection determines the pattern of T cell-mediated disease during reinfection in adulthood. J. Exp. Med. 2002, 196, 1381–1386. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cormier, S.A.; Shrestha, B.; Saravia, J.; Lee, G.I.; Shen, L.; DeVincenzo, J.P.; Kim, Y.I.; You, D. Limited type I interferons and plasmacytoid dendritic cells during neonatal respiratory syncytial virus infection permit immunopathogenesis upon reinfection. J. Virol. 2014, 88, 9350–9360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Remot, A.; Descamps, D.; Jouneau, L.; Laubreton, D.; Dubuquoy, C.; Bouet, S.; Lecardonnel, J.; Rebours, E.; Petit-Camurdan, A.; Riffault, S. Flt3 ligand improves the innate response to respiratory syncytial virus and limits lung disease upon RSV reexposure in neonate mice. Eur. J. Immunol. 2016, 46, 874–884. [Google Scholar] [CrossRef] [Green Version]
- Stephens, L.M.; Varga, S.M. Function and Modulation of Type I Interferons during Respiratory Syncytial Virus Infection. Vaccines (Basel) 2020, 8, 177. [Google Scholar] [CrossRef] [Green Version]
- Hijano, D.R.; Vu, L.D.; Kauvar, L.M.; Tripp, R.A.; Polack, F.P.; Cormier, S.A. Role of Type I Interferon (IFN) in the Respiratory Syncytial Virus (RSV) Immune Response and Disease Severity. Front. Immunol. 2019, 10, 566. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goritzka, M.; Makris, S.; Kausar, F.; Durant, L.R.; Pereira, C.; Kumagai, Y.; Culley, F.J.; Mack, M.; Akira, S.; Johansson, C. Alveolar macrophage-derived type I interferons orchestrate innate immunity to RSV through recruitment of antiviral monocytes. J. Exp. Med. 2015, 212, 699–714. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saravia, J.; You, D.; Shrestha, B.; Jaligama, S.; Siefker, D.; Lee, G.I.; Harding, J.N.; Jones, T.L.; Rovnaghi, C.; Bagga, B.; et al. Respiratory Syncytial Virus Disease Is Mediated by Age-Variable IL-33. PLoS Pathog 2015, 11, e1005217. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Norlander, A.E.; Peebles, R.S., Jr. Innate Type 2 Responses to Respiratory Syncytial Virus Infection. Viruses 2020, 12, 521. [Google Scholar] [CrossRef] [PubMed]
- Roux, X.; Remot, A.; Petit-Camurdan, A.; Nahori, M.A.; Kiefer-Biasizzo, H.; Marchal, G.; Lagranderie, M.; Riffault, S. Neonatal lung immune responses show a shift of cytokines and transcription factors toward Th2 and a deficit in conventional and plasmacytoid dendritic cells. Eur. J. Immunol. 2011, 41, 2852–2861. [Google Scholar] [CrossRef] [PubMed]
- Sun, C.M.; Deriaud, E.; Leclerc, C.; Lo-Man, R. Upon TLR9 signaling, CD5+ B cells control the IL-12-dependent Th1-priming capacity of neonatal DCs. Immunity 2005, 22, 467–477. [Google Scholar] [CrossRef] [Green Version]
- Lo-Man, R. Regulatory B cells control dendritic cell functions. Immunotherapy 2011, 3 (Suppl. 4), 19–20. [Google Scholar] [CrossRef]
- Dai, Y.C.; Zhong, J.; Xu, J.F. Regulatory B cells in infectious disease (Review). Mol. Med. Rep. 2017, 16, 3–10. [Google Scholar] [CrossRef] [Green Version]
- Hardy, R.R. B-cell commitment: Deciding on the players. Curr. Opin. Immunol. 2003, 15, 158–165. [Google Scholar] [CrossRef]
- Zhivaki, D.; Lemoine, S.; Lim, A.; Morva, A.; Vidalain, P.O.; Schandene, L.; Casartelli, N.; Rameix-Welti, M.A.; Herve, P.L.; Deriaud, E.; et al. Respiratory Syncytial Virus Infects Regulatory B Cells in Human Neonates via Chemokine Receptor CX3CR1 and Promotes Lung Disease Severity. Immunity 2017, 46, 301–314. [Google Scholar] [CrossRef] [Green Version]
- Reed, J.L.; Welliver, T.P.; Sims, G.P.; McKinney, L.; Velozo, L.; Avendano, L.; Hintz, K.; Luma, J.; Coyle, A.J.; Welliver, R.C. Innate immune signals modulate antiviral and polyreactive antibody responses during severe respiratory syncytial virus infection. J. Infect. Dis. 2009, 199, 1128–1138. [Google Scholar] [CrossRef] [PubMed]
- Rameix-Welti, M.A.; Le Goffic, R.; Herve, P.L.; Sourimant, J.; Remot, A.; Riffault, S.; Yu, Q.; Galloux, M.; Gault, E.; Eleouet, J.F. Visualizing the replication of respiratory syncytial virus in cells and in living mice. Nat. Commun. 2014, 5, 5104. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Janus, C.; Golde, T. The effect of brief neonatal cryoanesthesia on physical development and adult cognitive function in mice. Behav. Brain Res. 2014, 259, 253–260. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Descamps, D.; Le Gars, M.; Balloy, V.; Barbier, D.; Maschalidi, S.; Tohme, M.; Chignard, M.; Ramphal, R.; Manoury, B.; Sallenave, J.M. Toll-like receptor 5 (TLR5), IL-1beta secretion, and asparagine endopeptidase are critical factors for alveolar macrophage phagocytosis and bacterial killing. Proc. Natl. Acad. Sci. USA 2012, 109, 1619–1624. [Google Scholar] [CrossRef] [Green Version]
- Panuska, J.R.; Merolla, R.; Rebert, N.A.; Hoffmann, S.P.; Tsivitse, P.; Cirino, N.M.; Silverman, R.H.; Rankin, J.A. Respiratory syncytial virus induces interleukin-10 by human alveolar macrophages. Suppression of early cytokine production and implications for incomplete immunity. J. Clin. Investig. 1995, 96, 2445–2453. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, X.; Deriaud, E.; Jiao, X.; Braun, D.; Leclerc, C.; Lo-Man, R. Type I interferons protect neonates from acute inflammation through interleukin 10-producing B cells. J. Exp. Med. 2007, 204, 1107–1118. [Google Scholar] [CrossRef] [Green Version]
- Makris, S.; Bajorek, M.; Culley, F.J.; Goritzka, M.; Johansson, C. Alveolar Macrophages Can. Control. Respiratory Syncytial Virus Infection in the Absence of Type I Interferons. J. Innate Immun. 2016, 8, 452–463. [Google Scholar] [CrossRef]
- Branchett, W.J.; Lloyd, C.M. Regulatory cytokine function in the respiratory tract. Mucosal. Immunol. 2019, 12, 589–600. [Google Scholar] [CrossRef] [Green Version]
- Guilliams, M.; De Kleer, I.; Henri, S.; Post, S.; Vanhoutte, L.; De Prijck, S.; Deswarte, K.; Malissen, B.; Hammad, H.; Lambrecht, B.N. Alveolar macrophages develop from fetal monocytes that differentiate into long-lived cells in the first week of life via GM-CSF. J. Exp. Med. 2013, 210, 1977–1992. [Google Scholar] [CrossRef] [Green Version]
- De Kleer, I.M.; Kool, M.; de Bruijn, M.J.; Willart, M.; van Moorleghem, J.; Schuijs, M.J.; Plantinga, M.; Beyaert, R.; Hams, E.; Fallon, P.G.; et al. Perinatal Activation of the Interleukin-33 Pathway Promotes Type 2 Immunity in the Developing Lung. Immunity 2016, 45, 1285–1298. [Google Scholar] [CrossRef] [Green Version]
- Saluzzo, S.; Gorki, A.D.; Rana, B.M.; Martins, R.; Scanlon, S.; Starkl, P.; Lakovits, K.; Hladik, A.; Korosec, A.; Sharif, O.; et al. First-Breath-Induced Type 2 Pathways Shape the Lung Immune Environment. Cell Rep. 2017, 18, 1893–1905. [Google Scholar] [CrossRef] [Green Version]
- Burgueno-Bucio, E.; Mier-Aguilar, C.A.; Soldevila, G. The multiple faces of CD5. J. Leukoc. Biol. 2019, 105, 891–904. [Google Scholar] [CrossRef] [PubMed]
- Gary-Gouy, H.; Harriague, J.; Bismuth, G.; Platzer, C.; Schmitt, C.; Dalloul, A.H. Human CD5 promotes B-cell survival through stimulation of autocrine IL-10 production. Blood 2002, 100, 4537–4543. [Google Scholar] [CrossRef] [PubMed]
- Murai, H.; Terada, A.; Mizuno, M.; Asai, M.; Hirabayashi, Y.; Shimizu, S.; Morishita, T.; Kakita, H.; Hussein, M.H.; Ito, T.; et al. IL-10 and RANTES are elevated in nasopharyngeal secretions of children with respiratory syncytial virus infection. Allergol. Int. 2007, 56, 157–163. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fan, R.; Wen, B.; Liu, W.; Zhang, J.; Liu, C.; Fan, C.; Qu, X. Altered regulatory cytokine profiles in cases of pediatric respiratory syncytial virus infection. Cytokine 2018, 103, 57–62. [Google Scholar] [CrossRef]
- Hughes, C.E.; Nibbs, R.J.B. A guide to chemokines and their receptors. FEBS J. 2018, 285, 2944–2971. [Google Scholar] [CrossRef]
- Shapouri-Moghaddam, A.; Mohammadian, S.; Vazini, H.; Taghadosi, M.; Esmaeili, S.A.; Mardani, F.; Seifi, B.; Mohammadi, A.; Afshari, J.T.; Sahebkar, A. Macrophage plasticity, polarization, and function in health and disease. J. Cell. Physiol. 2018, 233, 6425–6440. [Google Scholar] [CrossRef]
- Arora, S.; Dev, K.; Agarwal, B.; Das, P.; Syed, M.A. Macrophages: Their role, activation and polarization in pulmonary diseases. Immunobiology 2018, 223, 383–396. [Google Scholar] [CrossRef]
- Hussell, T.; Bell, T.J. Alveolar macrophages: Plasticity in a tissue-specific context. Nat. Rev. Immunol. 2014, 14, 81–93. [Google Scholar] [CrossRef]
- Pyle, C.J.; Uwadiae, F.I.; Swieboda, D.P.; Harker, J.A. Early IL-6 signalling promotes IL-27 dependent maturation of regulatory T cells in the lungs and resolution of viral immunopathology. PLoS Pathog. 2017, 13, e1006640. [Google Scholar] [CrossRef] [Green Version]
- Zeng, R.; Zhang, H.; Hai, Y.; Cui, Y.; Wei, L.; Li, N.; Liu, J.; Li, C.; Liu, Y. Interleukin-27 inhibits vaccine-enhanced pulmonary disease following respiratory syncytial virus infection by regulating cellular memory responses. J. Virol. 2012, 86, 4505–4517. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, L.; Cornell, T.T.; LeVine, A.; Berlin, A.A.; Hinkovska-Galcheva, V.; Fleszar, A.J.; Lukacs, N.W.; Shanley, T.P. Dual role of interleukin-10 in the regulation of respiratory syncitial virus (RSV)-induced lung inflammation. Clin. Exp. Immunol. 2013, 172, 263–279. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Loebbermann, J.; Schnoeller, C.; Thornton, H.; Durant, L.; Sweeney, N.P.; Schuijs, M.; O’Garra, A.; Johansson, C.; Openshaw, P.J. IL-10 regulates viral lung immunopathology during acute respiratory syncytial virus infection in mice. PLoS ONE 2012, 7, e32371. [Google Scholar] [CrossRef] [Green Version]
- Laubreton, D.; Descamps, D. Lung Explants from 6 day-old Neonates Made Detectable Amounts IL-10 upon RSV Infection and at Greater Levels than Adult Lung Explants; Université Paris-Saclay, INRAE, UVSQ, VIM, 78350: Jouy-en-Josas, France, 2016. [Google Scholar]
- Wu, Y.H.; Lai, A.C.; Chi, P.Y.; Thio, C.L.; Chen, W.Y.; Tsai, C.H.; Lee, Y.L.; Lukacs, N.W.; Chang, Y.J. Pulmonary IL-33 orchestrates innate immune cells to mediate respiratory syncytial virus-evoked airway hyperreactivity and eosinophilia. Allergy 2020, 75, 818–830. [Google Scholar] [CrossRef]
- Vu, L.D.; Siefker, D.; Jones, T.L.; You, D.; Taylor, R.; DeVincenzo, J.; Cormier, S.A. Elevated Levels of Type 2 Respiratory Innate Lymphoid Cells in Human Infants with Severe Respiratory Syncytial Virus Bronchiolitis. Am. J. Respir. Crit. Care Med. 2019, 200, 1414–1423. [Google Scholar] [CrossRef] [PubMed]
- Qi, F.; Bai, S.; Wang, D.; Xu, L.; Hu, H.; Zeng, S.; Chai, R.; Liu, B. Macrophages produce IL-33 by activating MAPK signaling pathway during RSV infection. Mol. Immunol. 2017, 87, 284–292. [Google Scholar] [CrossRef] [PubMed]
- Qi, F.; Wang, D.; Liu, J.; Zeng, S.; Xu, L.; Hu, H.; Liu, B. Respiratory macrophages and dendritic cells mediate respiratory syncytial virus-induced IL-33 production in TLR3- or TLR7-dependent manner. Int. Immunopharmacol. 2015, 29, 408–415. [Google Scholar] [CrossRef]
- Sattler, S.; Ling, G.S.; Xu, D.; Hussaarts, L.; Romaine, A.; Zhao, H.; Fossati-Jimack, L.; Malik, T.; Cook, H.T.; Botto, M.; et al. IL-10-producing regulatory B cells induced by IL-33 (Breg(IL-33)) effectively attenuate mucosal inflammatory responses in the gut. J. Autoimmun. 2014, 50, 107–122. [Google Scholar] [CrossRef] [Green Version]
Name of Gene | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) |
---|---|---|
GAPDH | GGGGTCGTTGATGGCAACA | AGGTCGGTGTGAACGGATTTG |
N (huRSV-A2) | AGATCAACTTCTGTCATCCAGCAA | TTCTGCACATCATAATTAGGAGTATCAAT |
IL-10 | GCTGGACAACATACTGCTAACC | ATTTCCGATAAGGCTTGGCAA |
IFNα1 | GAGAAGAAACACAGCCCCTG | TCAGTCTTCCCAGCACATTG |
IFNβ | CCCTATGGAGATGACGGAGA | CTGTCTGCTGGTGGAGTTCA |
Fluorochrome | Antibody | Clone | Supplier | Reference | Lot |
---|---|---|---|---|---|
APC | B220 | RA36B2 | Biolegend | 103212 | B189921 |
PerCPCy5.5 | CD3 | 17A2 | Biolegend | 100218 | B188934 |
PECy7 | CD4 | RM4-5 | Biolegend | 100528 | B173316 |
PE | CD5 | 53-7.3 | BD | 553022 | 3343749 |
BV421 | CD5 | 53-7.3 | SONY Biotechnology, San Jose, CA, USA | 100617 | 1103090 |
APC | CD19 | 1D3 | BD | 550992 | 38354 |
FITC | CD23 | B3B4 | BD | 553138 | 3234818 |
PECy7 | CD23 | B3B4 | SONY Biotechnology | 101614 | 99531 |
PE | CD40 | 3/23 | BD | 553791 | 31674 |
APC-Cy7 | CD45.2 | 104 | Biolegend | 109824 | B205513 |
FITC | CD80 | 16-10A1 | BD | 553768 | 48602 |
PE | CD86 | GL1 | BD | 553692 | 05843 |
FITC | IA-IE | 2G9 | BD | 553623 | 4237594 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Laubreton, D.; Drajac, C.; Eléouët, J.-F.; Rameix-Welti, M.-A.; Lo-Man, R.; Riffault, S.; Descamps, D. Regulatory B Lymphocytes Colonize the Respiratory Tract of Neonatal Mice and Modulate Immune Responses of Alveolar Macrophages to RSV Infection in IL-10-Dependant Manner. Viruses 2020, 12, 822. https://doi.org/10.3390/v12080822
Laubreton D, Drajac C, Eléouët J-F, Rameix-Welti M-A, Lo-Man R, Riffault S, Descamps D. Regulatory B Lymphocytes Colonize the Respiratory Tract of Neonatal Mice and Modulate Immune Responses of Alveolar Macrophages to RSV Infection in IL-10-Dependant Manner. Viruses. 2020; 12(8):822. https://doi.org/10.3390/v12080822
Chicago/Turabian StyleLaubreton, Daphné, Carole Drajac, Jean-François Eléouët, Marie-Anne Rameix-Welti, Richard Lo-Man, Sabine Riffault, and Delphyne Descamps. 2020. "Regulatory B Lymphocytes Colonize the Respiratory Tract of Neonatal Mice and Modulate Immune Responses of Alveolar Macrophages to RSV Infection in IL-10-Dependant Manner" Viruses 12, no. 8: 822. https://doi.org/10.3390/v12080822