A Quadruplex Reverse Transcription Quantitative Polymerase Chain Reaction for Detecting Canine Coronavirus, Canine Rotavirus, Canine Parvovirus, and Canine Distemper Virus
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Approval
2.2. Vaccine Strains
2.3. Positive Samples
2.4. Clinical Samples
2.5. Primers and Probes
2.6. Extraction of Nucleic Acids
2.7. Generation of Standard Plasmid Constructs
2.8. Determination of the Reaction Conditions
2.9. Generation of Standard Curves
2.10. Assessment of Analytical Specificity
2.11. Assessment of Analytical Sensitivity
2.12. Repeatability Analysis
2.13. Detection of Clinical Samples
3. Results
3.1. Determination of the Reaction Conditions
3.2. Generation of Standard Curves
3.3. Specificity Analysis
3.4. Sensitivity Analysis
3.5. Repeatability Analysis
3.6. Detection Results of Clinical Samples
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Licitra, B.N.; Duhamel, G.E.; Whittaker, G.R. Canine enteric coronaviruses: Emerging viral pathogens with distinct recombinant spike proteins. Viruses 2014, 6, 3363–3376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buonavoglia, A.; Pellegrini, F.; Decaro, N.; Galgano, M.; Pratelli, A. A one health perspective on canine coronavirus: A wolf in sheep’s clothing? Microorganisms 2023, 11, 921. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Caddy, S.; Papa, G.; Borodavka, A.; Desselberger, U. Rotavirus research: 2014–2020. Virus Res. 2021, 304, 198499. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jampanil, N.; Kumthip, K.; Maneekarn, N.; Khamrin, P. Genetic diversity of rotaviruses circulating in pediatric patients and domestic animals in Thailand. Trop. Med. Infect. Dis. 2023, 8, 347. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miranda, C.; Thompson, G. Canine parvovirus: The worldwide occurrence of antigenic variants. J. Gen. Virol. 2016, 97, 2043–2057. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tuteja, D.; Banu, K.; Mondal, B. Canine parvovirology—A brief updated review on structural biology, occurrence, pathogenesis, clinical diagnosis, treatment and prevention. Comp. Immunol. Microbiol. Infect. Dis. 2022, 82, 101765. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Loots, A.K.; Mitchell, E.; Dalton, D.L.; Kotzé, A.; Venter, E.H. Advances in canine distemper virus pathogenesis research: A wildlife perspective. J. Gen. Virol. 2017, 98, 311–321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dema, A.; Tallapally, M.R.; Ganji, V.K.; Buddala, B.; Kodi, H.; Ramidi, A.; Yella, N.R.; Putty, K. A comprehensive molecular survey of viral pathogens associated with canine gastroenteritis. Arch. Virol. 2023, 168, 36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amrani, N.; Desario, C.; Kadiri, A.; Cavalli, A.; Berrada, J.; Zro, K.; Sebbar, G.; Colaianni, M.L.; Parisi, A.; Elia, G.; et al. Molecular epidemiology of canine parvovirus in Morocco. Infect. Genet. Evol. 2016, 41, 201–206. [Google Scholar] [CrossRef] [Scilit]
- Fu, P.; He, D.; Cheng, X.; Niu, X.; Wang, C.; Fu, Y.; Li, K.; Zhu, H.; Lu, W.; Wang, J.; et al. Prevalence and characteristics of canine parvovirus type 2 in Henan province, China. Microbiol. Spectr. 2022, 10, e0185622. [Google Scholar] [CrossRef] [Scilit]
- Ikeda, Y.; Nakamura, K.; Miyazawa, T.; Takahashi, E.; Mochizuki, M. Feline host range of canine parvovirus: Recent emergence of new antigenic types in cats. Emerg. Infect. Dis. 2002, 8, 341–346. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.; Wu, R.; Mi, W.; Ghonaim, A.H.; Ren, W.; Yang, L.; Ruan, S.; He, Q.; Chen, H.; Jiang, Y. Molecular evolution and genetic characteristics of G3P[3] group A canine rotavirus isolated in Wuhan, China. J. Gen. Virol. 2022, 103, 1784. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Azevedo, L.S.; Costa, F.F.; Ghani, M.B.A.; Viana, E.; França, Y.; Medeiros, R.S.; Guiducci, R.; Morillo, S.G.; Primo, D.; Lopes, R.D.; et al. Full genotype characterization of Brazilian canine G3P[3] strains during a 10-year survey (2012–2021) of rotavirus infection in domestic dogs and cats. Arch. Virol. 2023, 168, 176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ortega, A.F.; Martínez-Castañeda, J.S.; Bautista-Gómez, L.G.; Muñoz, R.F.; Hernández, I.Q. Identification of co-infection by rotavirus and parvovirus in dogs with gastroenteritis in Mexico. Braz. J. Microbiol. 2017, 48, 769–773. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Castro, T.X.; Cubel Garcia Rde, C.; Gonçalves, L.P.; Costa, E.M.; Marcello, G.C.; Labarthe, N.V.; Mendes-de-Almeida, F. Clinical, hematological, and biochemical findings in puppies with coronavirus and parvovirus enteritis. Can. Vet. J. 2013, 54, 885–888. [Google Scholar] [PubMed]
- Bustin, S.A.; Mueller, R. Real-time reverse transcription PCR (qRT-PCR) and its potential use in clinical diagnosis. Clin. Sci. 2005, 109, 365–379. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Decaro, N.; Pratelli, A.; Campolo, M.; Elia, G.; Martella, V.; Tempesta, M.; Buonavoglia, C. Quantitation of canine coronavirus RNA in the faeces of dogs by TaqMan RT-PCR. J. Virol. Methods 2004, 119, 145–150. [Google Scholar] [CrossRef] [PubMed]
- Elia, G.; Decaro, N.; Martella, V.; Cirone, F.; Lucente, M.S.; Lorusso, E.; Di Trani, L.; Buonavoglia, C. Detection of canine distemper virus in dogs by real-time RT-PCR. J. Virol. Methods 2006, 136, 171–176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoang, M.; Wu, H.Y.; Lien, Y.X.; Chiou, M.T.; Lin, C.N. A SimpleProbe® real-time PCR assay for differentiating the canine parvovirus type 2 genotype. J. Clin. Lab. Anal. 2019, 33, e22654. [Google Scholar] [CrossRef] [Scilit]
- Sui, P.; Sun, Y.; Shi, Y.; Ran, W.; Shi, N.; Sun, D.; Zheng, J.; Zhao, J. Establishment and evaluation of a multiplex real-time RT-PCR for quantitative and differential detection of wild-type canine distemper virus from vaccine strains. Heliyon 2023, 9, e19344. [Google Scholar] [CrossRef] [Scilit]
- Wang, R.; Zhang, W.; Ye, R.; Pan, Z.; Li, G.; Su, S. One-step multiplex TaqMan probe-based method for real-time PCR detection of four canine diarrhea viruses. Mol. Cell. Probes 2020, 53, 101618. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, Y.; Cheng, Y.; Lin, P.; Yi, L.; Tong, M.; Cao, Z.; Wang, G.; Li, S.; Cheng, S.; Yuan, W.; et al. A multiplex TaqMan real-time PCR for detection and differentiation of four antigenic types of canine parvovirus in China. Mol. Cell. Probes 2018, 38, 7–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.; Shim, K.; Liu, H.; Yin, Y.; Zhao, J.; Long, F.; Lu, W.; Si, H. Development of a multiplex qRT-PCR assay for detection of African swine fever virus, classical swine fever virus and porcine reproductive and respiratory syndrome virus. J. Vet. Sci. 2021, 22, e87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thieulent, C.J.; Carossino, M.; Peak, L.; Wolfson, W.; Balasuriya, U.B.R. Multiplex one-step RT-qPCR assays for simultaneous detection of SARS-CoV-2 and other enteric viruses of dogs and cats. Viruses 2023, 15, 1890. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Soma, T.; Ohinata, T.; Ishii, H.; Takahashi, T.; Taharaguchi, S.; Hara, M. Detection and genotyping of canine coronavirus RNA in diarrheic dogs in Japan. Res. Vet. Sci. 2011, 90, 205–207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alves, C.D.B.T.; Granados, O.F.O.; Budaszewski, R.D.F.; Streck, A.F.; Weber, M.N.; Cibulski, S.P.; Pinto, L.D.; Ikuta, N.; Canal, C.W. Identification of enteric viruses circulating in a dog population with low vaccine coverage. Braz. J. Microbiol. 2018, 49, 790–794. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, B.; Zhang, X.; Bai, J.; Zhang, G.; Li, C.; Lin, W. Epidemiological investigation of canine coronavirus infection in Chinese domestic dogs: A systematic review and data synthesis. Prev. Vet. Med. 2022, 209, 105792. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qi, S.; Zhao, J.; Guo, D.; Sun, D. A mini-review on the epidemiology of canine parvovirus in China. Front. Vet. Sci. 2020, 7, 5. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, B.; Zhang, G.; Zhang, J.; Bai, J.; Lin, W. A systematic literature review and meta-analysis of characterization of canine parvoviruses 2 prevalent in mainland China. Virol. J. 2020, 17, 195. [Google Scholar] [CrossRef] [Scilit]
- Costa, V.G.D.; Saivish, M.V.; Rodrigues, R.L.; Lima Silva, R.F.; Moreli, M.L.; Krüger, R.H. Molecular and serological surveys of canine distemper virus: A meta-analysis of cross-sectional studies. PLoS ONE 2019, 14, e0217594. [Google Scholar] [CrossRef] [Scilit]
- Vlasova, A.N.; Toh, T.H.; Lee, J.S.; Poovorawan, Y.; Davis, P.; Azevedo, M.S.P.; Lednicky, J.A.; Saif, L.J.; Gray, G.C. Animal alphacoronaviruses found in human patients with acute respiratory illness in different countries. Emerg. Microbes Infect. 2022, 11, 699–702. [Google Scholar] [CrossRef] [Scilit]
- Díaz Alarcón, R.G.; Liotta, D.J.; Miño, S. Zoonotic RVA: State of the art and distribution in the animal world. Viruses 2022, 14, 2554. [Google Scholar] [CrossRef] [Scilit]
- Vlasova, A.N.; Diaz, A.; Damtie, D.; Xiu, L.; Toh, T.H.; Lee, J.S.; Saif, L.J.; Gray, G.C. Novel canine coronavirus isolated from a hospitalized patient with pneumonia in East Malaysia. Clin. Infect. Dis. 2022, 74, 446–454. [Google Scholar] [CrossRef] [Scilit]
- Lednicky, J.A.; Tagliamonte, M.S.; White, S.K.; Blohm, G.M.; Alam, M.M.; Iovine, N.M.; Salemi, M.; Mavian, C.; Morris, J.G. Isolation of a novel recombinant canine coronavirus from a visitor to Haiti: Further evidence of transmission of coronaviruses of zoonotic origin to humans. Clin. Infect. Dis. 2022, 75, e1184–e1187. [Google Scholar] [CrossRef] [Scilit]
- Theamboonlers, A.; Samransamruajkit, R.; Thongme, C.; Amonsin, A.; Chongsrisawat, V.; Poovorawan, Y. Human coronavirus infection among children with acute lower respiratory tract infection in Thailand. Intervirology 2007, 50, 71–77. [Google Scholar] [CrossRef] [Scilit]
- Wu, F.T.; Bányai, K.; Lin, J.S.; Wu, H.S.; Hsiung, C.A.; Huang, Y.C.; Hwang, K.P.; Jiang, B.; Gentsch, J.R. Putative canine origin of rotavirus strain detected in a child with diarrhea, Taiwan. Vector. Borne. Zoonotic Dis. 2012, 12, 170–173. [Google Scholar] [CrossRef] [Scilit]
- Luchs, A.; Cilli, A.; Morillo, S.G.; Carmona Rde, C.; Timenetsky Mdo, C. Rare G3P[3] rotavirus strain detected in Brazil: Possible human-canine interspecies transmission. J. Clin. Virol. 2012, 54, 89–92. [Google Scholar] [CrossRef] [Scilit]
- Tsugawa, T.; Hoshino, Y. Whole genome sequence and phylogenetic analyses reveal human rotavirus G3P[3] strains Ro1845 and HCR3A are examples of direct virion transmission of canine/feline rotaviruses to humans. Virology 2008, 380, 344–353. [Google Scholar] [CrossRef] [Scilit]






| Name | Sequence (5′–3′) | Tm/°C | Genotype | Product/bp |
|---|---|---|---|---|
| CCoV(M)-F | GGTGGTATGAACATCGACAATT | 57.3 | CCoV-I, CCoV-II | 134 |
| CCoV(M)-R | TTAGATTTTACATAGTAAGCCCATCC | 56.0 | ||
| CCoV(M)-P | FAM-CGTAATGGTTGCATTACCTAGCAGGACCAT-BHQ1 | 65.6 | ||
| CRV(VP7)-F | GCKGATCCAACTACAGC | 52.2 | CRV-G3P[3] | 128 |
| CRV(VP7)-R | CGTGATCTTTTGGACATTG | 53.6 | ||
| CRV(VP7)-P | Texas red-GATGCGTGTTAATTGGAAGAAATGGTGGC-BHQ2 | 64.0 | ||
| CPV(VP2)-F | CCATTTACTCCAGCAGCTATG | 56.4 | CPV-2, CPV-2a, CPV-2b, CPV-2c | 131 |
| CPV(VP2)-R | CCACTAGTTCCAGTATGAGATGGTATT | 58.7 | ||
| CPV(VP2)-P | CY5-ATGGAAACCAACCATACCAACTCCATGG-BHQ3 | 64.9 | ||
| CDV(N)-F | TTCATGGTGGCACTCATCTTGG | 53.6 | CDV | 143 |
| CDV(N)-R | GTTTCAATGCCAAATTTGATAGT | 54.4 | ||
| CDV(N)-P | VIC-CAGGGAACAAGCCTAGAATTGCTGAAAT-BHQ1 | 63.4 |
| Reagent | Volume (µL) | Final Concentration (nM) |
|---|---|---|
| CCoV(M)-F (200 pmol/µL) | 0.4 | 400 |
| CCoV(M)-R (200 pmol/µL) | 0.4 | 400 |
| CCoV(M)-P (200 pmol/µL) | 0.3 | 300 |
| CRV(VP7)-F (200 pmol/µL) | 0.4 | 400 |
| CRV(VP7)-R (200 pmol/µL) | 0.4 | 400 |
| CRV(VP7)-P (200 pmol/µL) | 0.2 | 200 |
| CPV(VP2)-F (200 pmol/µL) | 0.3 | 300 |
| CPV(VP2)-R (200 pmol/µL) | 0.3 | 300 |
| CPV(VP2)-P (200 pmol/µL) | 0.3 | 300 |
| CDV(N)-F (200 pmol/µL) | 0.4 | 400 |
| CDV(N)-R (200 pmol/µL) | 0.4 | 400 |
| CDV(N)-P (200 pmol/µL) | 0.2 | 200 |
| 2 × One-Step RT-PCR Buffer III | 10 | / |
| Ex Taq HS (5 U/µL) | 0.4 | / |
| PrimeScript RT Enzyme Mix II | 0.4 | / |
| Nucleic acid template | 2 | / |
| Nuclease-free distilled water | 3.2 | / |
| Total | 20 | / |
| Standard Plasmid | Concentration (Copies/Reaction) | Number of Samples | Multiplex qRT-PCR | |
|---|---|---|---|---|
| Ct (Average) | Hit Rate (%) | |||
| p-CCoV | 420 | 26 | 34.91 | 100 |
| 210 | 26 | 35.43 | 100 | |
| 105 | 26 | 35.98 | 92.31 | |
| 52.5 | 26 | ND | 0 | |
| P-CRV | 420 | 26 | 34.71 | 100 |
| 210 | 26 | 35.35 | 100 | |
| 105 | 26 | 35.96 | 96.15 | |
| 52.5 | 26 | ND | 0 | |
| P-CPV | 420 | 26 | 34.19 | 100 |
| 210 | 26 | 34.82 | 100 | |
| 105 | 26 | 35.50 | 92.31 | |
| 52.5 | 26 | ND | 0 | |
| P-CDV | 420 | 26 | 34.45 | 100 |
| 210 | 26 | 35.13 | 100 | |
| 105 | 26 | 35.78 | 88.46 | |
| 52.5 | 26 | ND | 0 | |
| Plasmid Construct | Concentration (Copies/µL) | Concentration (Copies/Reaction) | Ct Value of Intra-Assay | Ct Value of Inter-Assay | ||||
|---|---|---|---|---|---|---|---|---|
| X | SD | CV (%) | X | SD | CV (%) | |||
| p-CCoV | 2.1 × 107 | 4.2 × 108 | 14.66 (14.49–14.81) | 0.13 | 0.90 | 14.74 (14.58–14.83) | 0.11 | 0.75 |
| 2.1 × 105 | 4.2 × 106 | 21.97 (21.77–22.21) | 0.18 | 0.82 | 21.66 (21.43–21.93) | 0.20 | 0.94 | |
| 2.1 × 105 | 4.2 × 104 | 28.60 (28.49–28.82) | 0.15 | 0.54 | 28.32 (28.12–28.59) | 0.20 | 0.71 | |
| P-CRV | 2.1 × 107 | 4.2 × 108 | 14.49 (14.43–14.59) | 0.08 | 0.53 | 14.82 (14.82–14.83) | 0.01 | 0.02 |
| 2.1 × 105 | 4.2 × 106 | 21.60 (21.51–21.68) | 0.07 | 0.32 | 21.43 (21.42–21.45) | 0.01 | 0.06 | |
| 2.1 × 103 | 4.2 × 104 | 28.47 (28.27–28.59 | 0.15 | 0.51 | 28.39 (28.28–28.48) | 0.08 | 0.29 | |
| p-CPV | 2.1 × 107 | 4.2 × 108 | 15.49 (15.48–15.50) | 0.01 | 0.05 | 15.89 (15.86–15.93) | 0.03 | 0.19 |
| 2.1 × 105 | 4.2 × 106 | 20.79 (20.73–20.85) | 0.05 | 0.23 | 20.18 (20.14–20.20) | 0.03 | 0.16 | |
| 2.1 × 103 | 4.2 × 104 | 27.72 (27.60–27.84) | 0.10 | 0.37 | 27.17 (27.00–27.43) | 0.18 | 0.68 | |
| p-CDV | 2.1 × 107 | 4.2 × 108 | 14.54 (14.47–14.59) | 0.05 | 0.34 | 14.36 (14.25–14.44) | 0.08 | 0.56 |
| 2.1 × 105 | 4.2 × 106 | 20.97 (20.87–21.05) | 0.08 | 0.36 | 20.69 (20.53–20.81) | 0.12 | 0.57 | |
| 2.1 × 103 | 4.2 × 104 | 28.57 (28.44–28.77) | 0.14 | 0.50 | 28.07 (27.99–28.13) | 0.06 | 0.19 | |
| Pathogen | Sample | Established RT-qPCR | Reference RT-qPCR | ||
|---|---|---|---|---|---|
| Positive Sample | Percentage (%) | Positive Sample | Percentage (%) | ||
| Single Infection | |||||
| CCoV | 1028 | 39 | 3.79% | 36 | 3.50% |
| CRV | 1028 | 5 | 0.49% | 5 | 0.49% |
| CPV | 1028 | 195 | 18.97% | 199 | 19.36% |
| CDV | 1028 | 26 | 2.53% | 27 | 2.63% |
| Co-Infection | |||||
| CCoV+CPV | 1028 | 45 | 4.38% | 44 | 4.28% |
| CCoV+CDV | 1028 | 7 | 0.68% | 6 | 0.58% |
| CRV+CPV | 1028 | 5 | 0.49% | 4 | 0.39% |
| CPV+CDV | 1028 | 12 | 1.17% | 10 | 0.97% |
| CCoV+CPV+CDV | 1028 | 7 | 0.68% | 7 | 0.68% |
| Total (Single+Co-Infection) | |||||
| CCoV | 1028 | 98 | 9.53% | 93 | 9.05% |
| CRV | 1028 | 10 | 0.97% | 9 | 0.88% |
| CPV | 1028 | 264 | 25.68% | 264 | 25.68% |
| CDV | 1028 | 52 | 5.06% | 50 | 4.86% |
| The Current RT-qPCR | The Reference RT-qPCR | Total | Clinical Sensitivity (95% CI) | Clinical Specificity (95% CI) | ||
|---|---|---|---|---|---|---|
| Positive | Negative | |||||
| CCoV | Positive | 92 | 6 | 98 | 98.92% (94.16–99.81%) | 99.36% (98.61–99.71%) |
| Negative | 1 | 929 | 930 | |||
| Total | 93 | 935 | 1028 | |||
| CRV | Positive | 9 | 1 | 10 | 100% (70.09–100%) | 99.80% (99.45–99.98%) |
| Negative | 0 | 1018 | 1018 | |||
| Total | 9 | 1019 | 1028 | |||
| CPV | Positive | 264 | 0 | 264 | 100% (98.57–100%) | 100% (99.50–100%) |
| Negative | 0 | 764 | 764 | |||
| Total | 264 | 764 | 1028 | |||
| CDV | Positive | 49 | 3 | 52 | 98.00% (89.51–99.65%) | 99.69% (99.10–99.91%) |
| Negative | 1 | 975 | 976 | |||
| Total | 50 | 978 | 1028 | |||
| Method | Positive Sample | |||
|---|---|---|---|---|
| CCoV (%) | CRV (%) | CPV (%) | CDV (%) | |
| The Current RT-qPCR | 98/1028 (9.53%) | 10/1028 (0.97%) | 264/1028 (25.68%) | 52/1028 (5.06%) |
| The Reference RT-qPCR [24] | 93/1028 (9.05%) | 9/1028 (0.88%) | 264/1028 (25.68%) | 50/1028 (4.86%) |
| Agreements (95% CI) | 99.32% (98.60–99.67%) | 99.90% (99.44–99.98%) | 100% (99.63–100%) | 99.61% (99.00–99.85%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, Y.; Long, F.; Shi, K.; He, M.; Shi, Y.; Feng, S.; Yin, Y.; Wei, X.; Li, Z. A Quadruplex Reverse Transcription Quantitative Polymerase Chain Reaction for Detecting Canine Coronavirus, Canine Rotavirus, Canine Parvovirus, and Canine Distemper Virus. Microbiol. Res. 2024, 15, 746-761. https://doi.org/10.3390/microbiolres15020049
Shi Y, Long F, Shi K, He M, Shi Y, Feng S, Yin Y, Wei X, Li Z. A Quadruplex Reverse Transcription Quantitative Polymerase Chain Reaction for Detecting Canine Coronavirus, Canine Rotavirus, Canine Parvovirus, and Canine Distemper Virus. Microbiology Research. 2024; 15(2):746-761. https://doi.org/10.3390/microbiolres15020049
Chicago/Turabian StyleShi, Yandi, Feng Long, Kaichuang Shi, Mengyi He, Yuwen Shi, Shuping Feng, Yanwen Yin, Xiankai Wei, and Zongqiang Li. 2024. "A Quadruplex Reverse Transcription Quantitative Polymerase Chain Reaction for Detecting Canine Coronavirus, Canine Rotavirus, Canine Parvovirus, and Canine Distemper Virus" Microbiology Research 15, no. 2: 746-761. https://doi.org/10.3390/microbiolres15020049
APA StyleShi, Y., Long, F., Shi, K., He, M., Shi, Y., Feng, S., Yin, Y., Wei, X., & Li, Z. (2024). A Quadruplex Reverse Transcription Quantitative Polymerase Chain Reaction for Detecting Canine Coronavirus, Canine Rotavirus, Canine Parvovirus, and Canine Distemper Virus. Microbiology Research, 15(2), 746-761. https://doi.org/10.3390/microbiolres15020049

